Method for promoting synthesis of vitamin K2MK7 through large chromosome deletion of escherichia coli genome

Abstract

The present disclosure provides engineered Escherichia coli bacteria capable of producing vitamin K2 MK7 having increased fermentation titer and / or yield of vitamin K2 MK7. Also provided are methods of making and using the engineered Escherichia coli, including methods for producing vitamin K2 MK7.

Description

Technical Field

[0001] The present invention relates to an engineered Escherichia coli capable of producing vitamin K2 MK7, which has an increased fermentation titer and / or yield of vitamin K2 MK7. Also provided are methods for preparing and using the engineered Escherichia coli, including methods for producing vitamin K2 MK7. Background Art

[0002] Vitamin K2 is a fat-soluble vitamin, a derivative of naphthoquinone group with phylloquinone biological activity, and one of the important vitamins that are indispensable to the human body. The structure of vitamin K2 is a series of terpene side chains containing 2-methyl-1,4-naphthoquinone nucleus and C3 position with different numbers of isoprene structural units. According to the number of isoprene structural units on the terpene side chain, vitamin K2 can be divided into different types. The currently commercialized vitamin K2 is MK-4 containing 4 isoprene structural units and MK-7 (Menaquinone-7, MK7, PubChemCID5287554) containing 7 isoprene structural units.

[0003] Currently, MK-7 is produced mainly through chemical synthesis and fermentation. In addition, both rational engineering (e.g., genetic engineering) and mutagenesis approaches are key strategies for optimizing metabolic pathways in microbial hosts such as E. coli. While rational engineering relies on a deep understanding of enzyme kinetics, regulatory elements, and pathway fluxes to make precise genetic modifications, mutagenesis approaches introduce variability that can discover beneficial mutations that may not be easily predicted. The combination of these strategies enables fine-tuning of complex biosynthetic pathways to achieve high yields of target compounds. In this context, the production of vitamin K2 in E. coli is a challenging goal because it requires multi-step synthesis and an intrinsic balance between competing cellular processes.

[0004] In E. coli, rational engineering often employs CRISPR-Cas9 to introduce precise genetic modifications by using a single guide RNA (sgRNA) to target a specific genomic site, followed by providing a donor DNA template for homology-directed repair. This allows for targeted insertion, deletion, or modification of genes in metabolic pathways. However, the E. coli genome also contains many intrinsically repeated regions, which can complicate repair and lead to unexpected recombination events.

[0005] Interestingly, omitting donor DNA during CRISPR-Cas9 editing can exploit these intrinsic genomic features, as the cell's natural repair mechanisms are activated to resolve double-strand breaks. This design approach, while rational engineering, can sometimes lead to beneficial large-scale deletions or rearrangements that cannot be easily anticipated through rational design alone, resulting in unpredictable beneficial mutations (similar to the unexpected technical effects of mutagenesis). This underrated approach can discover new phenotypes and gene arrangements, improve the metabolic efficiency of strains, and provide additional flexibility and creativity for strain engineering.

[0006] Considering the high demand for Vitamin K2 MK7, there remains a need in the art for alternative and improved methods for producing Vitamin K2 MK7 while increasing the production efficiency and production yield of Vitamin K2 MK7. Summary of the invention

[0007] It has been found that the targeted cutting of the genome sequence of Escherichia coli by the CRISPR-Cas9 editing system that omits donor DNA sometimes leads to beneficial large-scale deletions or rearrangements through the natural repair mechanism of the cell. Therefore, the present invention screened out Escherichia coli engineered bacteria with high vitamin K2 MK7 production, and there was a large chromosome deletion of about 15303bp or 15303±86 bp in the genome of this engineered bacteria. Among them, after fermentation, the fermentation titer of vitamin K2 MK7 of the Escherichia coli engineered bacteria strain BOTA17013 containing this 15303bp deletion was detected to be 571.25 mg / L, which was significantly improved compared with the logical parent cell BOTA17012 that did not contain the 15303bp deletion (252.5 mg / L).

[0008] This provides the following invention:

[0009] In a first aspect, the present invention provides an engineered Escherichia coli having a genetically modified genome sequence, wherein the genetic modification is as follows: compared with the Escherichia coli strain BOTA17012 (accession number: CGMCC No. 33534), the genome sequence of the engineered bacterium lacks or knocks out sequences of 15303 bp and 15303±86 bp.

[0010] In some embodiments, the genetic modification is that compared with the Escherichia coli strain BOTA17012 (accession number: CGMCC No. 33534), the genome sequence of the engineered bacteria lacks or knocks out a sequence of 15303 bp.

[0011] In some embodiments, the genetic modification is that compared with the Escherichia coli strain BOTA17012 (accession number: CGMCC No. 33534), the genome sequence of the engineered bacteria lacks or knocks out a sequence of 15303+86 bp.

[0012] In some embodiments, the genetic modification is that compared with the Escherichia coli strain BOTA17012 (accession number: CGMCC No. 33534), the genome sequence of the engineered bacteria is deleted or the sequence of 15303-86 bp is knocked out.

[0013] As used herein, "compared with Escherichia coli strain BOTA17012 (accession number: CGMCC No.33534), the genome sequence of the engineered bacteria lacks or knocks out the sequence of 15303 bp, 15303±86 bp" means that, in addition to the lack or knockout of the sequence of 15303 bp or 15303±86 bp, the genome sequence of the engineered bacteria may or may not contain other replacements, deletions or knockouts, or mutations compared with the genome sequence of Escherichia coli strain BOTA17012.

[0014] In some embodiments, the genomic deleted or knocked-out sequence is a sequence fragment corresponding to positions 1,949,204 to 1,964,506 of the NCBI genome sequence NZ_CP011938.1.

[0015] In some embodiments, the engineered Escherichia coli has a genetic modification of its genome sequence, and the genetic modification is that compared with the Escherichia coli strain BOTA17012 (accession number: CGMCC No. 33534), the genome sequence of the engineered bacterium only lacks or knocks out sequences of 15303 bp and 15303±86 bp.

[0016] In some embodiments, the genetic modification is that compared with the Escherichia coli strain BOTA17012 (accession number: CGMCC No. 33534), the genome sequence of the engineered bacteria only lacks or knocks out a sequence of 15303 bp.

[0017] In some embodiments, the genomic deleted or knocked-out sequence is a sequence fragment corresponding to positions 1,949,204 to 1,964,506 of the NCBI genome sequence NZ_CP011938.1.

[0018] As used herein, "compared with Escherichia coli strain BOTA17012 (accession number: CGMCC No.33534), the genome sequence of the engineered bacteria only lacks or knocks out sequences of 15303 bp or 15303±86 bp" means that, except for the lack or knockout of sequences of 15303 bp or 15303±86 bp, the genome sequence of the engineered bacteria is the same as the genome sequence of Escherichia coli strain BOTA17012.

[0019] In some embodiments, the deleted or knocked out 15303 bp, 15303 ± 86 bp sequence contains many genes. In some embodiments, there is no "rewinding" or finding the exact random gene in this large deletion in the present application, however, the 15303 bp, 15303 ± 86 bp deletion or knockout has a clear beneficial phenotype, for example, an increased fermentation titer and / or yield of vitamin K2MK7.

[0020] In a second aspect, the present invention further provides an engineered Escherichia coli strain BOTA17012, whose deposit number is CGMCC No.33534, and the depositary is the General Microbiology Center of China National Microbiological Culture Collection Committee (CGMCC).

[0021] In a third aspect, the present invention also provides a method for constructing an engineered Escherichia coli, comprising deleting or knocking out a large chromosome of the genome of the Escherichia coli strain BOTA17012 (accession number: CGMCC No. 33534) through a gene editing system;

[0022] In some embodiments, the gene editing system includes, for example, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or clustered regularly interspaced short palindromic repeats (CRISPRs).

[0023] In some embodiments, the gene editing system is CRISPR-Cas9.

[0024] In some embodiments, the sgRNA targeting the cleavage site in the CRISPR-Cas9 comprises a nucleotide sequence as described in SEQ ID NO: 1.

[0025] In some embodiments, a PAM is not included in the sgRNA design. In some embodiments, no donor DNA is provided in the CRISPR-Cas9 system because the genome will repair itself through the intrinsic repeat sequences on both sides of the double-strand break.

[0026] In some embodiments, single guide RNAs (sgRNAs) are typically composed of a 20-nucleotide sequence (20-mer) and a required protospacer adjacent motif (PAM), usually denoted as "NGG" in the case of the CRISPR-Cas9 system. The 20-mer sequence is complementary to the target DNA site, enabling precise hybridization and guiding the Cas9 endonuclease to the desired genomic location. Cas9 binding and subsequent double-stranded cleavage require the presence of the PAM sequence located downstream of the target sequence. Upon binding, Cas9 induces a site-specific double-strand break (DSB) at three nucleotide positions upstream of the PAM sequence, located within the target site defined by the 20-mer guide. This targeted cleavage mechanism facilitates the introduction of modifications at a predetermined site, thereby enabling precise genetic editing for research and therapeutic applications.

[0027] In a fourth aspect, the present invention also provides the use of the Escherichia coli engineered bacteria or the Escherichia coli engineered bacteria obtained according to the construction method in the production of vitamin K2 MK7.

[0028] In a fifth aspect, the present invention also provides a method for producing vitamin K2 MK7, comprising culturing the engineered Escherichia coli bacteria described in the first aspect or the second aspect or the engineered Escherichia coli bacteria obtained according to the construction method described in the third aspect in a culture medium.

[0029] In some embodiments, the method further comprises recovering vitamin K2 MK7 from the culture.

[0030] In a sixth aspect, the present invention also provides a method for increasing the fermentation titer and / or yield of vitamin K2 MK7, comprising introducing the genetic modification defined in the first aspect into Escherichia coli.

[0031] The engineered bacteria disclosed herein can produce increased amounts of vitamin K2MK7 compared to a host cell that does not contain the genetic modification of the engineered bacteria disclosed herein but is otherwise genetically identical (eg, a wild-type or parental host cell).

[0032] In some embodiments, the increased amount is at least about 10% (e.g., at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) or at least about 2-fold (e.g., about 3-fold, about 4-fold, about 5-fold, about 6-fold, about 7-fold, about 8-fold, about 9-fold, about 10-fold, about 15-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 60-fold, about 70-fold, about 80-fold, about 90-fold, or about 100-fold), as measured, e.g., in grams per liter of cell culture, milligrams per gram of dry cell weight, per unit volume of cell culture, per unit dry cell weight, per unit volume of cell culture per unit time, or per unit dry cell weight per unit time under the same culture conditions.

[0033] Further features and advantages of certain embodiments of the present disclosure will become more apparent from the following description of the embodiments and their accompanying drawings, and from the claims.

[0034] Definition of terms

[0035] In the present disclosure, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In order to better understand the present disclosure, the definitions and explanations of the terms are provided below.

[0036] As used herein, the term "parent cell" refers to a cell having the same genetic background as the host cell disclosed herein, except that it does not contain a specific genetic modification (e.g., mutation or knockout of endogenous nucleic acids, introduction of exogenous or heterologous nucleic acids, or a combination thereof), and it serves as the starting point for introducing the genetic modification, resulting in the host cell disclosed herein. In addition, it is easy to understand that when describing a relative change (e.g., deletion, enhancement, improvement, increase, etc.) of a substance such as a gene or protein or pathway, if no reference object is specified, the reference object can be a corresponding substance such as a gene or protein or pathway in a wild-type cell or parent cell. In some embodiments, "Escherichia coli strain BOTA17012" used herein can be used as a reference object. In some embodiments, compared to Escherichia coli strain BOTA17012 (preservation number: CGMCCNo.33534), the engineered bacteria comprises a large chromosome deletion or knockout of the genome.

[0037] As used herein, the term "Escherichia coli", scientific name Escherichia coli, also known as Escherichia coli, is a species of the genus Escherichia in the family Enterobacteriaceae.

[0038] As used herein, the terms "deletion" and "knockout" have the meanings commonly understood by those skilled in the art. The term "deletion" refers to the deletion of one or more nucleotides in a genome. The term "knockout" refers to the complete deletion or inactivation of the DNA sequence of a target gene from a cell or organism, blocking its transcription and translation processes, and completely rendering the target gene nonfunctional. The deletion or knockout of endogenous genes can be achieved by any gene editing system known in the art, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), or clustered regularly interspaced short palindromic repeats (CRISPRs).

[0039] As used herein, the NCBI reference genome sequence of the term "Escherichia coli C43 (DE3)" is NZ_CP011938.1, which is used to describe the specific location of the large chromosome deletion or knockout in this application. As is well known to those skilled in the art, the detailed sequence of the NZ_CP011938.1 genome can be retrieved from the NCBI website.

[0040] Beneficial effects of the present invention

[0041] Compared with the Escherichia coli strain BOTA17012 (preservation number: CGMCC No.33534), the Escherichia coli engineered bacteria provided by the present invention, which contain 15303 bp and 15303±86 bp deletions, have significantly improved vitamin K2 MK7 fermentation titer and / or yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 : Annotation coordinates of the 15303 bp deletion sequence in the Escherichia coli C43 (DE3) genome (sequence reference: NZ_CP011938.1) [1,949,204-1,964,506].

[0043] Figure 2 :Time course fermentation titer test results of Escherichia coli engineered strain BOTA17013 producing vitamin K2 MK7. DETAILED DESCRIPTION

[0044] Example 1: Construction of an engineered strain of Escherichia coli with a large chromosome deletion

[0045] 1.1. Design of sgRNA targeting the E. coli genome

[0046] Using the NCBI genome sequence NZ_CP011938.1 of Escherichia coli C43 (DE3) as the reference standard for gene location, the sgRNA sequence targeting the cleavage site was designed: ACTCAAGTTTTATAATCGAGGGG (NGG PAM highlighted by underline, not included in the sgRNA sequence). This sgRNA sequence occurs exactly once in the reference genome at coordinates [1949342-1949364].

[0047] The E. coli genome contains a natural repeat sequence of 86 bp in length, the specific sequence is as follows:

[0048] ACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAAATTC (SEQ ID NO: 2).

[0049] This sequence occurs at 3 sites, including 2 sites immediately surrounding the double-strand break site introduced by the sgRNA described above. The coordinates of the 86 bp sites on either side are [1,949,118-1,949,203] and [1,964,421-1,964,506]. After a double-strand break, the genome repairs itself by "looping out," or removing the sequence between these sites. During this loop-out event, one of the repeat sites is also removed. Therefore, this sequence that is expected to be removed is taken from the coordinates [1,949,204-1,964,506], a 15,303 bp region with specific coordinates as shown below. Figure 1 shown.

[0050] 1.2. Construction of an engineered E. coli strain with a large chromosome deletion

[0051] The above-mentioned sgRNA knockout vector plasmid and the vector plasmid expressing Cas9 protein were transformed into the starting strain BOTA17012, wherein the specific nucleotide sequence of sgRNA is shown in SEQ ID NO: 1. Then, the engineering strain was cultured according to the standard operating procedure, and the transformants were screened by a medium containing Kan+Spec antibiotics. Finally, the Escherichia coli engineered strain BOTA17013 was obtained.

[0052] 1.3. Sequencing characterization of engineered E. coli strains with large chromosome deletions

[0053] Confirm the expected deletions in the engineered strains described above by colony PCR (cPCR) or whole genome sequencing according to standard procedures.

[0054] The results showed that the engineered strain BOTA17013 obtained by using BOTA17012 as the logical parent cell had a 15303 bp deletion. Except for this deletion, the two had the same engineering, indicating that the double-strand break introduced by the CRISPR-Cas9 system was deleted after intrinsic genome repair.

[0055] Figure 1 The coordinates of the 15,303 bp deletion sequence in the E. coli C43 (DE3) genome (sequence reference: NZ_CP011938.1) are annotated as [1,949,204-1,964,506].

[0056] Example 2: Determination of Vitamin K2 Content in the Engineered Strain MK7 with Large Genome Fragment Deletion

[0057] 2.1. Fermentation experiments with engineered E. coli strains

[0058] Fermentation experiments were performed using the BOTA17012 starting strain (parent strain) and the resulting strain BOTA17013 (daughter strain) obtained in Example 1 containing the 15303 bp deletion.

[0059] The specific steps are as follows: Fermentation was performed using a high-throughput parallel bioreactor (0.5-liter scale) from TJX Bioengineering. The fermentation carbon source was a mixture of glucose and glycerol. Yeast extract was also provided as a fermentation feed medium component. The temperature was controlled at a set point of 30°C and the pH was controlled at 7. The aeration rate was 1 vvm (l / l / m). The oxygen uptake rate (OUR) was controlled in the range of 60-80 mmol O2 / L / h, while the dissolved oxygen (DO) was optimized to <10%.

[0060] Quantification of Menaquinone-7

[0061] For the quantification of Menaquinone-7, a reverse phase HPLC method was applied by using an Agilent 1290 UPLC equipped with a diode array detector, with a C18 column from Phenomenex Kinetex® 1.7 µm C18 100é, LC column 50 × 2.1 mm, 00B-4475-AN. The column temperature was set at 40 °C, 2 µL sample injection, methanol as the mobile phase, a flow rate of 0.5 mL / min, UV detection at 248 nm, and a total run time of 3 min. Before performing the assay, 100 µl of the fermentation culture was mixed with 100 µl of isopropanol. The membrane was flow-coated and vortexed for 1 h. Next, 300 µl of ethyl acetate was added, the membrane was sealed and vortexed for 1 h. Finally, the plate was centrifuged and the supernatant was aspirated for analysis.

[0062] Figure 2 The data show the time course fermentation titer, where the Y-axis is the concentration of vitamin K2 MK7 (mg / L) and the X-axis is the fermentation time (in hours). Two repeated experiments were performed for each strain (n=2), the fermentation volume was 0.5 liters, and the fermentation time was 82 hours.

[0063] The results showed that the terminal titer of vitamin K2 MK7 of the BOTA17013 strain (green) containing a 15303 bp deletion was significantly higher than that of its parent strain BOTA17012 (blue), with average titers of 571.25 mg / L and 252.5 mg / L, respectively, indicating that the large chromosome deletion in Escherichia coli can increase the production yield of vitamin K2 MK7.

[0064] In addition, E. coli strain BOTA17012 had an increased vitamin K2 MK7 fermentation titer (252.5 mg / L) compared to wild-type E. coli C43 (DE3).

[0065] Sequence information

[0066] >SEQ ID NO:1

[0067] ACTCAAGTTTTATAATCGAG

[0068] >SEQ ID NO:2

[0069] ACGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCAAATTC.

Claims

1. An engineered Escherichia coli having a genetic modification of its genome sequence, wherein the genetic modification is: Compared with the Escherichia coli strain BOTA17012 (preservation number: CGMCC No. 33534), the genome sequence of the engineered bacteria lacks or knocks out sequences of 15303 bp and 15303±86 bp.

2. The engineered Escherichia coli of claim 1, wherein the genetic modification is: Compared with the Escherichia coli strain BOTA17012 (preservation number: CGMCC No. 33534), the genome sequence of the engineered bacteria lacks or knocks out a sequence of 15303 bp.

3. The engineered Escherichia coli bacteria according to claim 1 or 2, wherein the sequence deleted or knocked out in the genome is a sequence fragment corresponding to positions 1,949,204 to 1,964,506 of the NCBI genome sequence NZ_CP011938.

1.

4. The engineered Escherichia coli according to any one of claims 1 to 3, which has a genetic modification of the genome sequence, wherein the genetic modification is: Compared with the Escherichia coli strain BOTA17012 (accession number: CGMCC No. 33534), the genome sequence of the engineered bacteria only lacks or knocks out sequences of 15303 bp and 15303±86 bp; Preferably, compared with the Escherichia coli strain BOTA17012 (accession number: CGMCC No. 33534), the genome sequence of the engineered bacteria only lacks or knocks out a sequence of 15303 bp; Preferably, the genomic deletion or knockout sequence is a sequence fragment corresponding to positions 1,949,204 to 1,964,506 of the NCBI genome sequence NZ_CP011938.

1.

5. An engineered Escherichia coli strain BOTA17012, whose deposit number is CGMCC No.33534, and the depositor is China General Microbiology Center (CGMCC).

6. A method for constructing an engineered Escherichia coli according to any one of claims 1 to 4, comprising deleting or knocking out the genome of the Escherichia coli strain BOTA17012 (Accession No.: CGMCC No. 33534) by a gene editing system; Preferably, the gene editing system comprises, for example, zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN) or clustered regularly interspaced short palindromic repeats (CRISPR); Preferably, the gene editing system is CRISPR-Cas9; Preferably, the sgRNA targeting the cleavage site in the CRISPR-Cas9 comprises the nucleotide sequence as described in SEQ ID NO:

1.

7. Use of the Escherichia coli engineered bacteria according to any one of claims 1 to 4 or the Escherichia coli engineered bacteria obtained by the construction method according to claim 6 in the production of vitamin K2 MK7.

8. A method for producing vitamin K2 MK7, comprising culturing the Escherichia coli engineered bacteria according to any one of claims 1 to 4 or the Escherichia coli engineered bacteria obtained according to the construction method of claim 6 in a culture medium.

9. The method of claim 8, further comprising recovering vitamin K2 MK7 from the culture.

10. A method for increasing the fermentation titer and / or yield of vitamin K2 MK7, comprising introducing into Escherichia coli a genetic modification as defined in any one of claims 1 to 4.

Images