Tryptophan synthetase mutant with improved enzymatic activity and application of tryptophan synthetase mutant in production of L-cysteine

Abstract

The invention belongs to the field of bioengineering, and particularly discloses a tryptophan synthetase mutant with improved enzymatic activity and application of the tryptophan synthetase mutant in production of L-cysteine. Compared with wild tryptophan synthetase from escherichia coli, the amino acid sequence of the tryptophan synthetase mutant has the advantages that a beta catalytic subunit has T69A, S143A, R219E and F280H site combined mutation. Researches show that the enzyme activity of the mutant is increased by 2.4 times compared with that of a wild type through enzyme activity determination and analysis of inducible expression and purification. The beneficial tryptophan synthetase mutant provided by the invention can efficiently biocatalyze L-serine and sodium hydrosulfide to synthesize L-cysteine, and has a better industrial application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to the construction of a tryptophan synthase mutant with improved enzyme activity and its application. Background Art

[0002] L-cysteine ​​is a sulfur-containing amino acid with important economic value due to its wide application in food, medicine, cosmetics and agriculture. In the food industry, L-cysteine ​​is often used as an antioxidant and dough improver, and in the pharmaceutical field it is widely used in the synthesis of mucolytics, detoxifiers and other drug intermediates. In addition, it also shows unique application potential in cosmetics and agriculture. As the main producer of L-cysteine, my country currently relies mainly on the traditional process of hydrolyzing skin and hair with hydrochloric acid. However, this process not only has the problem of low L-cysteine ​​yield, but also is accompanied by a large amount of "three wastes" emissions, causing serious environmental pollution, and the high cost of waste treatment limits its industrial sustainable development.

[0003] In recent years, with the rapid development of green biomanufacturing technology, microbial fermentation has become a hot topic in L-cysteine ​​production research due to its renewable raw materials, environmentally friendly production process and mild reaction conditions. Transforming microbial chassis cells through metabolic engineering and synthetic biology to construct an efficient L-cysteine ​​synthesis pathway is the key to achieving green production. However, the current L-cysteine ​​yield and sulfur conversion efficiency of the fermentation method still do not have the economy required for industrial application, which is mainly limited by the reconstruction efficiency of the sulfur metabolic pathway, the ability of chassis cells to utilize precursor substances and the catalytic performance of key enzymes.

[0004] As an innovative route for L-cysteine ​​production, the bioenzymatic conversion method was first proposed by Japanese scholar Sano K et al., which achieves efficient conversion of L-cysteine ​​by chemically synthesized DL-2-amino-Δ²-thiazoline-4-carboxylic acid (DL-ATC) catalyzed by microbial enzymes. However, the implementation of this process is highly dependent on chemically synthesized DL-ATC, which not only leads to high production costs, but also fails to effectively alleviate the environmental burden and economic feasibility difficulties brought about by large-scale production. Compared with traditional protein hydrolysis, bioenzymatic conversion and microbial fermentation, the whole-cell catalytic method has been widely used in the industrial production of chiral chemicals such as pharmaceutical intermediates and fine chemicals due to its unique advantages, such as mild reaction conditions, high substrate stereoselectivity, environmental friendliness and high compatibility with the concept of green production.

[0005] The whole-cell catalytic method is centered on efficient enzyme-catalyzed reactions. It can not only use cheap renewable biological raw materials as substrates, but also effectively reduce the generation of by-products, thereby significantly improving the yield of the target product. As a green and sustainable biomanufacturing strategy, this method not only achieves efficient L-cysteine ​​synthesis, but also meets the requirements of modern industry for environmental friendliness and economic efficiency. However, the current whole-cell catalytic method still has technical bottlenecks such as insufficient catalytic efficiency of key enzymes, imperfect optimization of chassis cell metabolism, and insufficient stability of the reaction system. Therefore, the development of a simpler, more efficient and economically feasible method for producing L-cysteine ​​remains the focus and challenge of current research.

[0006] Escherichia coli tryptophan synthase (Ts) is a tetrameric bifunctional enzyme that can catalyze the conversion of L-serine and indole to L-tryptophan. Its structural and functional properties provide an important basis for studying the catalytic mechanism of the enzyme. The tertiary structure of the enzyme consists of two subunits (α and β) arranged in a linear manner of αββα. The active centers of each α-β dimer are interconnected by a channel about 25 Å long, thereby achieving efficient transfer of substrates and intermediates. Studies have shown that the α subunit is responsible for catalyzing the cleavage of indole-3-glycerol phosphate into indole and glyceraldehyde-3-phosphate, while the β subunit, with the assistance of the coenzyme pyridoxal phosphate (PLP), synthesizes indole and L-serine into L-tryptophan. In addition, the study further revealed the catalytic diversity of Ts. Its β subunit can catalyze the conversion of L-serine to L-cysteine ​​under specific conditions, providing new possibilities for its potential application in the field of amino acid biosynthesis. Summary of the invention

[0007] Based on the above needs, the primary purpose of the present invention is to provide a tryptophan synthase mutant so that its catalytic activity is improved, which is beneficial to the catalytic production of metabolites such as L-cysteine ​​and its derivatives.

[0008] The present invention is realized by the following technical ideas: according to Escherichia coli Escherichia coli The gene sequence encoding the wild-type tryptophan synthase β subunit TrpB of MG1655 was modified using site-directed mutagenesis technology to obtain an optimized target gene sequence.

[0009] The present invention provides a tryptophan synthase mutant with improved enzyme activity, comprising a tryptophan synthase α subunit TrpA and a tryptophan synthase β subunit TrpB, wherein the tryptophan synthase β subunit TrpB has a combined mutation of threonine T at position 69 to alanine A, serine T at position 143 to alanine A, arginine R at position 219 to glutamic acid E, and phenylalanine at position 280 to histidine, relative to the wild type shown in SEQ ID No. 1. The specific amino acid sequence is shown in SEQ ID No. 2.

[0010] Specifically, the GenBank accession number of the tryptophan synthase α subunit TrpA is AAA57301.1.

[0011] The present invention also provides a gene encoding the tryptophan synthetase mutant, wherein the tryptophan synthetase α subunit TrpA and the tryptophan synthetase β subunit TrpB genes exist separately or are connected in series.

[0012] The present invention further provides a recombinant expression vector containing the coding gene. Preferably, it is a prokaryotic expression vector, such as an Escherichia coli expression vector pET21b and a Corynebacterium glutamicum expression vector pXMJ19. The two subunits can be constructed on different recombinant expression vectors, or can be constructed in series on one recombinant expression vector.

[0013] Specifically, the coding gene of the tryptophan synthase α subunit TrpA, the conserved RBS spacer sequence and the coding gene of the tryptophan synthase β subunit TrpB were concatenated and subcloned into the pET21b or pXMJ19 backbone to obtain the recombinant expression plasmid pET21b-TrpAB or pXMJ19-TrpAB.

[0014] In a specific embodiment, the inducible expression vector selected by the present invention is pET21b, which carries a strong T7 promoter and its related regulatory elements, including an operator sequence lacO and a conserved ribosome binding site (RBS). After adding inducers such as isopropyl-β-D-thiogalactoside (IPTG) or lactose, the repressor protein LacI dissociates from lacO, allowing RNA polymerase to bind to the promoter region, thereby efficiently starting the transcription and expression of the target gene. In another specific embodiment, the inducible expression vector selected by the present invention is pXMJ19, which contains a strong promoter tac and its related regulatory elements (such as lacO operator sequence and conserved RBS sequence), which can not only replicate in Escherichia coli, but also be suitable for expression systems of Gram-positive bacteria such as Corynebacterium glutamicum. When an inducer such as IPTG or lactose is added, the inhibitory effect of LacI on the operator sequence will also be released, and the expression of the target gene will be started, which is suitable for efficient protein expression systems of various host strains.

[0015] The present invention also provides a recombinant bacterium containing the recombinant expression vector, specifically, a recombinant Escherichia coli engineered bacterium or a recombinant Corynebacterium glutamicum engineered bacterium.

[0016] The present invention further provides the use of the above-mentioned tryptophan synthase mutant, or its encoding gene, or the recombinant expression vector containing the above-mentioned, or the recombinant bacteria as described above in catalyzing the synthesis of L-cysteine ​​or its derivatives.

[0017] The invention constructs a recombinant engineering bacterium containing a tryptophan synthase mutant encoding gene, adopts a whole-cell catalytic system, and uses low-value bulk chemicals such as L-serine and sodium hydrosulfide as raw materials to efficiently synthesize high-value-added L-cysteine.

[0018] The beneficial effect of the present invention is reflected in that studies have shown that the enzyme activity of the mutant can be increased by up to 2.4 times compared with the wild type after induced expression purification and enzyme activity assay analysis. When used to produce L-cysteine, the raw materials used in the present invention are low in cost and widely available, and have high economic efficiency; and the comprehensive utilization rate of raw materials in the process is significantly improved, effectively reducing production costs and environmental burdens. The beneficial mutant of tryptophan synthase provided by the present invention can efficiently biocatalyze the synthesis of L-cysteine ​​from L-serine and sodium hydrosulfide, and has better prospects for industrial application. DETAILED DESCRIPTION

[0019] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below in conjunction with specific examples, but it should not be understood as limiting the present invention. The experimental methods used in the examples are conventional methods well known to those skilled in the art unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0020] Example 1. Construction of tryptophan synthase mutant plasmid and strain Escherichia coli tryptophan synthase (Ts) is composed of an α subunit (TrpA) [GenBank: AAA57301.1] and a β subunit (TrpB) [GenBank: AAA57300.1], arranged in a linear manner of αββα. It is a tetrameric bifunctional enzyme with a complex structure, and its main function is to catalyze the synthesis of L-tryptophan, playing a key role in the biosynthetic pathway. In this embodiment, we use a single plasmid dual enzyme co-expression strategy to express the Escherichia coli tryptophan synthase complex, that is, the Escherichia coli tryptophan synthase α subunit (TrpA) encoding gene [sequence as shown in SEQ ID No. 3] and the β subunit (TrpB) encoding gene [sequence as shown in SEQ ID No. 4] are simultaneously expressed in one plasmid. In a specific embodiment, the dual enzyme co-expression vector uses a single promoter mode to express a promoter and the tryptophan synthase α subunit (TrpA) encoding gene and the β subunit (TrpB) encoding gene in tandem.

[0021] The present invention further provides a recombinant expression vector for dual enzyme tandem expression, preferably a prokaryotic expression vector, including but not limited to pET21b and pXMJ19. In a specific embodiment, the tryptophan synthase α subunit (TrpA) encoding gene and the β subunit (TrpB) encoding gene are tandemly expressed using an inducible T7 strong promoter or a tac strong promoter, wherein the two encoding genes are separated by a conservative RBS spacer sequence. The promoter and RBS spacer sequences used for the construction of the co-expression system of the present invention are: The inducible T7 promoter sequence is shown in SEQ ID NO.5: GAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCTCTAGAAAATAATTTTGTTTAACTTTAAGAAGGAGATATACAT.

[0022] The inducible tac promoter sequence is shown in SEQ ID NO.6: TGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGAATTAA.

[0023] The conservative RBS sequence is shown in SEQ ID NO.7: TTTGTTTAACTTTAAGAAGGAGATACAT.

[0024] Through rapid DNA fragment assembly techniques such as commercialized one-step high-efficiency seamless cloning (ClonExpress®II One Step Cloning Kit, Vazyme Biotech, China), the genes encoding the α subunit of tryptophan synthase (TrpA), the conserved RBS spacer sequence, and the gene encoding the β subunit of tryptophan synthase (TrpB) were concatenated and subcloned into the pET21b or pXMJ19 backbone to obtain the recombinant expression plasmids pET21b-TrpAB and pXMJ19-TrpAB. Subsequently, the pET21b-TrpAB plasmid was transformed into Escherichia coli BL21 (DE3) to obtain a recombinant E. coli engineering strain, and the pXMJ19-TrpAB plasmid was transformed into Corynebacterium glutamicum ATCC 13032 to obtain a recombinant Corynebacterium glutamicum engineering strain.

[0025] Protein language models have demonstrated significant advantages in functional protein design and optimization, providing a new research tool for the fields of life science and biotechnology. Among them, the ESM (Evolutionary Scale Modeling) model treats protein sequences as language and amino acids as characters, and uses the autoregressive neural network Transformer to extract the evolutionary rules between sequences and the deep associations between sequence-structure-function from large-scale protein sequence databases, enabling accurate prediction of the effects of protein mutations on their structure and function (such as stability, activity, affinity, etc.) [Meier J, et al. Language models enable zero-shot prediction of the effects of mutations on protein function. Advances in neural information processing systems, 2021, 34: 29287-29303.]. This method breaks through the limitations of traditional experimental screening, greatly improving the screening efficiency of mutation sites and prediction accuracy. In the present invention, based on the ESM model combined with machine learning algorithms, a systematic analysis was carried out on the potential mutation sites of tryptophan synthase (TrpB subunit), and four mutation sites with the highest predicted scores, T69A, S143A, R219E, and F280H, were screened out, and the catalytic efficiency of the enzyme was improved by combinatorial superposition optimization. In a specific embodiment, the tryptophan synthase mutant was achieved through the following technical solution: adopting a site-directed mutagenesis strategy, designing site-directed mutagenesis primers according to the amino acid sites to be mutated, using the pET21b-TrpAB plasmid or pXMJ19-TrpAB plasmid as a template, and obtaining the recombinant plasmid pET21b-TrpAB containing the tryptophan synthase mutant sequence by PCR mutand pXMJ19-TrpAB mut .

[0026] Example 2: Determination of enzyme activity of tryptophan synthase mutants The selected inducible expression vector is pET21b, which contains T7 strong promoter-related sequences (including the operator sequence lacO and the conserved RBS sequence). When inducers such as IPTG or lactose are added, the repressor protein will leave the operator sequence and initiate gene expression.

[0027] The inducible expression vector selected in the present invention is pXMJ19, which contains a strong promoter tac-related sequence (including the operator sequence lacO and the conserved RBS sequence) and can be replicated in Escherichia coli and Corynebacterium glutamicum. When inducers such as IPTG or lactose are added, the repressor protein will also be prompted to leave the operator sequence and initiate gene expression.

[0028] In this example, the recombinant Escherichia coli cells induced by expression vector pET21b were collected, the culture medium was removed by centrifugation, and the cell pellet was resuspended in 10 mL of pre-cooled lysis buffer (20 mM Na 2 HPO 3 , 200 mM NaCl, pH 7.5). The cells were disrupted using an ultrasonic cell disruptor, with a power of 200 W, 2 s of ultrasound followed by 1 s of rest, and 10 min of ultrasound. The cells were then centrifuged at 8000 × g for 10 min in a high-speed refrigerated centrifuge, and the supernatant was collected for subsequent protein purification and enzyme activity determination.

[0029] According to the catalytic activity of tryptophan synthase, the enzyme activity was determined using the ability to generate L-cysteine ​​products as a standard. The enzyme activity assay system consisted of 1 mL (100 mM Tris-HCl, pH 8.0), 100 mM L-serine, 100 mM sodium bisulfide, 50 μM PLP and 10 μL crude enzyme solution. o C incubation for 30 min, and HPLC was used to detect the L-cysteine ​​content in the system. The study found that compared with the wild unmutated tryptophan synthase activity (0.61 µmol / min / mg), the tryptophan synthase T69A / S143A / R219E / F280H combined mutant showed significantly enhanced catalytic performance, and its enzyme activity was increased by 2.4 times.

[0030] Example 3: Application of tryptophan synthase mutants in the production of L-cysteine This embodiment is based on the whole cell transformation method, using basic raw materials such as L-serine and sodium hydrosulfide, and efficiently catalyzing the synthesis of L-cysteine ​​under the condition of adding PLP cofactor. In a preferred specific embodiment of producing L-cysteine, in a 100mL Tris-HCl buffer system, 75 g / L serine substrate is added, a sodium hydrosulfide substrate with a final concentration of 0.8-1.0 mol / L is added, 20~30 g / L induced recombinant Corynebacterium glutamicum (based on the expression vector pXMJ19) is added, and a final concentration of 0.20~0.4 g / L of pyridoxal phosphate is added, the speed is controlled at 200~300 r / min, the catalytic reaction pH is 6-8, the catalytic reaction temperature is 30~40°C, and the catalytic reaction time is 12~24 h. After the reaction is completed, the components of the catalytic reaction liquid are quantitatively analyzed by HPLC liquid chromatography.

[0031] According to the analysis of liquid chromatography, the components of the whole cell conversion liquid are relatively simple, and there are few substrates and other impurities. Although the wild-type tryptophan synthase of Escherichia coli has a certain ability to convert L-serine to L-cysteine, the conversion level is still relatively low under the condition of high concentration of L-serine substrate. In the experiment described above, the conversion rate is only 31.8%. The tryptophan synthase combination mutant T69A / S143A / R219E / F280H has excellent L-cysteine ​​production capacity, and finally 85.6 g / L L-cysteine ​​can be obtained, with a conversion rate of more than 99%, showing good industrial application prospects.

[0032] The above contents are only preferred embodiments of the present invention, which are intended to illustrate the technical solutions of the present invention, rather than to limit the protection scope of the present invention. Without departing from the core technical concept of the present invention, those skilled in the art may, based on the specification and claims of the present invention, make appropriate adjustments, changes or equivalent substitutions thereto, and all technical improvements, equivalent solutions and variations within the scope defined by the claims of the present invention shall be deemed to be the protection scope of the present invention. In addition, technical contents not specifically described in the present invention, if they belong to conventional technical means of those skilled in the art, shall also be deemed to be part of the present invention.

Claims

1. A tryptophan synthase mutant with improved enzyme activity, comprising a tryptophan synthase α subunit TrpA and a tryptophan synthase β subunit TrpB, characterized in that: Wherein, the tryptophan synthase β subunit TrpB has a combined mutation of amino acid sequence position 69 from threonine T to alanine A, position 143 from serine T to alanine A, position 219 from arginine R to glutamate E, and position 280 from phenylalanine to histidine, relative to the wild type shown in SEQ ID No.

1.

2. The tryptophan synthase mutant according to claim 1, characterized in that The GenBank accession number of tryptophan synthase α subunit TrpA is AAA57301.

1.

3. The gene encoding the tryptophan synthase mutant according to claim 1 or 2, wherein the tryptophan synthase α subunit TrpA and the tryptophan synthase β subunit TrpB genes exist separately or are connected in series.

4. A recombinant expression vector containing the coding gene as claimed in claim 3.

5. The recombinant expression vector according to claim 4, characterized in that It is a prokaryotic expression vector.

6. The recombinant expression vector according to claim 4, characterized in that They are the E. coli expression vector pET21b and the Corynebacterium glutamicum expression vector pXMJ19.

7. The recombinant expression vector according to claim 6, characterized in that The coding gene of tryptophan synthase α subunit TrpA, the conserved RBS spacer sequence and the coding gene of tryptophan synthase β subunit TrpB were concatenated and subcloned into the pET21b or pXMJ19 backbone to obtain the recombinant expression plasmid pET21b-TrpAB or pXMJ19-TrpAB.

8. A recombinant bacterium containing the recombinant expression vector according to any one of claims 4 to 7.

9. The recombinant bacterium according to claim 8, characterized in that The invention is a recombinant Escherichia coli engineering bacterium or a recombinant Corynebacterium glutamicum engineering bacterium.

10. Use of the tryptophan synthase mutant according to claim 1 or 2, or a gene encoding the same, or a recombinant expression vector containing the same, or a recombinant bacterium according to claim 8 or 9 in catalyzing the synthesis of L-cysteine ​​or its derivatives.

11. The use according to claim 10, characterized in that L-cysteine ​​is synthesized from L-serine and sodium hydrosulfide.