Tryptophan synthase mutant with enhanced enzyme activity and its application in producing L-cysteine

Abstract

The present invention belongs to the field of bioengineering, and specifically discloses a tryptophan synthase mutant with improved enzyme activity and its application in the production of L-cysteine. Compared with the wild-type tryptophan synthase derived from Escherichia coli, the amino acid sequence of the tryptophan synthase mutant has T69A, S143A, R219E and F280H site combination mutations in its β catalytic subunit. Studies have shown that, after analysis of enzyme activity assays of induced expression and purification, the enzyme activity of the mutant can be increased by up to 2.4 times compared with the wild type. The beneficial mutant of tryptophan synthase provided by the present invention can efficiently biocatalyze the synthesis of L-cysteine ​​from L-serine and sodium bisulfide, and has better prospects for industrial application.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and particularly relates to the construction and application of a tryptophan synthase mutant with improved enzyme activity. Background Art

[0002] L-cysteine ​​is a sulfur-containing amino acid with significant economic value due to its widespread applications in food, medicine, cosmetics, and agriculture. In the food industry, L-cysteine ​​is often used as an antioxidant and dough improver. In the pharmaceutical field, it is widely used in the synthesis of mucolytics, antidotes, and other drug intermediates. Furthermore, it exhibits unique application potential in cosmetics and agriculture. my country, as a major producer of L-cysteine, currently relies primarily on the traditional hydrochloric acid hydrolysis process of skin and hair. However, this process not only suffers from low L-cysteine ​​yields but also involves the discharge of large amounts of "three wastes," causing serious environmental pollution. The high cost of waste disposal also limits its sustainable development.

[0003] In recent years, with the rapid development of green biomanufacturing technologies, microbial fermentation has become a hot topic in L-cysteine ​​production research due to its renewable raw materials, environmentally friendly production process, and mild reaction conditions. Modifying microbial chassis cells through metabolic engineering and synthetic biology to construct efficient L-cysteine ​​synthesis pathways is key to achieving green production. However, the current L-cysteine ​​yield and sulfur conversion efficiency of fermentation methods are still not economical for industrial application, primarily due to limitations in the efficiency of sulfur metabolism pathway reconstruction, the ability of chassis cells to utilize precursors, and the catalytic performance of key enzymes.

[0004] Enzymatic conversion, an innovative approach to L-cysteine ​​production, was first proposed by Japanese researchers Sano K et al. It achieves efficient conversion of L-cysteine ​​using chemically synthesized DL-2-amino-Δ²-thiazoline-4-carboxylic acid (DL-ATC) catalyzed by microbial enzymes. However, this process relies heavily on chemically synthesized DL-ATC, leading to high production costs and failing to effectively mitigate the environmental burden and economic feasibility challenges associated with large-scale production. Compared to traditional protein hydrolysis, enzymatic conversion, and microbial fermentation, whole-cell catalysis has been widely used in the industrial production of chiral chemicals such as pharmaceutical intermediates and fine chemicals due to its unique advantages, including mild reaction conditions, high substrate stereoselectivity, environmental friendliness, and strong alignment with green production concepts.

[0005] The whole-cell catalytic method is centered on efficient enzyme-catalyzed reactions. It can not only utilize cheap renewable biological raw materials as substrates, but also effectively reduce the formation of by-products, thereby significantly improving the yield of the target product. As a green and sustainable biomanufacturing strategy, this method not only achieves efficient L-cysteine ​​synthesis, but also meets the requirements of modern industry for environmental friendliness and economic efficiency. However, the current whole-cell catalytic method still has technical bottlenecks such as insufficient catalytic efficiency of key enzymes, imperfect optimization of chassis cell metabolism, and insufficient stability of the reaction system. Therefore, developing a simpler, more efficient and economically feasible method for producing L-cysteine ​​remains the focus and challenge of current research.

[0006] Escherichia coli tryptophan synthase (Ts) is a tetrameric bifunctional enzyme that catalyzes the conversion of L-serine to indole to L-tryptophan. Its structural and functional properties provide an important foundation for understanding the enzyme's catalytic mechanism. The enzyme's tertiary structure consists of two subunits (α and β) arranged in a linear αββα configuration. The active sites of each α-β dimer are interconnected by a ~25 Å-long channel, enabling efficient transfer of substrates and intermediates. Studies have shown that the α subunit catalyzes the cleavage of indole-3-glycerolphosphate into indole and glyceraldehyde-3-phosphate, while the β subunit, assisted by the coenzyme pyridoxal phosphate (PLP), converts indole to L-serine to form L-tryptophan. Furthermore, studies have revealed the catalytic versatility of Ts, with the β subunit being able to catalyze the conversion of L-serine to L-cysteine ​​under specific conditions, suggesting new possibilities for its potential applications in amino acid biosynthesis. Summary of the Invention

[0007] Based on the above needs, the primary purpose of the present invention is to provide a tryptophan synthase mutant so that its catalytic activity is improved, which is conducive to the catalytic production of metabolites such as L-cysteine ​​and its derivatives.

[0008] The present invention is realized by the following technical ideas: Escherichia coli The wild-type tryptophan synthase β subunit TrpB encoding gene sequence of MG1655 was modified using site-directed mutagenesis technology to obtain an optimized target gene sequence.

[0009] The present invention provides a tryptophan synthase mutant with enhanced enzyme activity, comprising a tryptophan synthase α subunit TrpA and a tryptophan synthase β subunit TrpB. The tryptophan synthase β subunit TrpB, relative to the wild-type shown in SEQ ID No. 1, comprises a combination of mutations in the amino acid sequence: threonine T is mutated to alanine A at position 69; serine T is mutated to alanine A at position 143; arginine R is mutated to glutamic acid E at position 219; and phenylalanine is mutated to histidine at position 280. The specific amino acid sequence is shown in SEQ ID No. 2.

[0010] Specifically, the GenBank accession number of the tryptophan synthase α subunit TrpA is AAA57301.1.

[0011] The present invention also provides a gene encoding the tryptophan synthase mutant, wherein the tryptophan synthase α subunit TrpA and the tryptophan synthase β subunit TrpB genes exist separately or are connected in series.

[0012] The present invention further provides a recombinant expression vector containing the coding gene. Preferably, it is a prokaryotic expression vector, for example, an Escherichia coli expression vector pET21b and a Corynebacterium glutamicum expression vector pXMJ19. The two subunits can be constructed on different recombinant expression vectors, or can be constructed in series on a recombinant expression vector.

[0013] Specifically, the gene encoding the tryptophan synthase α subunit TrpA, the conserved RBS spacer sequence and the gene encoding the tryptophan synthase β subunit TrpB were concatenated and subcloned into the pET21b or pXMJ19 backbone to obtain the recombinant expression plasmid pET21b-TrpAB or pXMJ19-TrpAB.

[0014] In one specific embodiment, the inducible expression vector used in the present invention is pET21b, which carries the strong T7 promoter and its associated regulatory elements, including the operator sequence lacO and a conserved ribosome binding site (RBS). Upon addition of inducers such as isopropyl-β-D-thiogalactopyranoside (IPTG) or lactose, the repressor protein LacI dissociates from lacO, allowing RNA polymerase to bind to the promoter region, thereby efficiently initiating transcription and expression of the target gene. In another specific embodiment, the inducible expression vector used in the present invention is pXMJ19, which contains the strong promoter tac and its associated regulatory elements (such as the lacO operator sequence and conserved RBS sequence). This plasmid is not only capable of replication in Escherichia coli but is also suitable for expression systems in Gram-positive bacteria such as Corynebacterium glutamicum. Addition of inducers such as IPTG or lactose also relieves the inhibitory effect of LacI on the operator sequence, initiating expression of the target gene, making it suitable for efficient protein expression in a variety of host strains.

[0015] The present invention also provides a recombinant bacterium containing the recombinant expression vector, specifically, a recombinant Escherichia coli engineered bacterium or a recombinant Corynebacterium glutamicum engineered bacterium.

[0016] The present invention further provides the use of the above-mentioned tryptophan synthase mutant, or its encoding gene, or the recombinant expression vector containing the above-mentioned, or the recombinant bacteria as described above in catalyzing the synthesis of L-cysteine ​​or its derivatives.

[0017] The present invention constructs a recombinant engineered bacterium containing a gene encoding a tryptophan synthase mutant, adopts a whole-cell catalytic system, and uses low-value bulk chemicals such as L-serine and sodium hydrosulfide as raw materials to efficiently synthesize high-value-added L-cysteine.

[0018] The beneficial effects of the present invention are reflected in studies showing that, after induced expression, purification, and enzyme activity assay analysis, the enzyme activity of the mutant can be increased by up to 2.4 times compared to the wild type. Furthermore, when used to produce L-cysteine, the present invention utilizes low-cost, widely available raw materials, resulting in high economic efficiency. Furthermore, the comprehensive utilization rate of raw materials during the process is significantly improved, effectively reducing production costs and environmental burdens. The beneficial mutant of tryptophan synthase provided by the present invention can efficiently biocatalyze the synthesis of L-cysteine ​​from L-serine and sodium bisulfide, and has a better prospect for industrial application. DETAILED DESCRIPTION

[0019] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention is further described in detail below with reference to specific examples, but it should not be understood as limiting the present invention. Unless otherwise specified, the experimental methods used in the examples are conventional methods well known to those skilled in the art. Unless otherwise specified, the materials, reagents, etc. used in the following examples can be obtained from commercial sources.

[0020] Example 1. Construction of tryptophan synthase mutant plasmids and strains

[0021] Escherichia coli tryptophan synthase (Ts) consists of an α-subunit (TrpA) [GenBank: AAA57301.1] and a β-subunit (TrpB) [GenBank: AAA57300.1] arranged in a linear αββα configuration. It is a complex tetrameric bifunctional enzyme that catalyzes the synthesis of L-tryptophan, playing a key role in the biosynthetic pathway. In this example, a single-plasmid dual-enzyme co-expression strategy was used to express the E. coli tryptophan synthase complex. Specifically, the genes encoding the α-subunit (TrpA) [sequence shown in SEQ ID No. 3] and the β-subunit (TrpB) of the E. coli tryptophan synthase were co-expressed in a single plasmid. In one specific embodiment, the dual-enzyme co-expression vector employs a single promoter to express the genes encoding the α-subunit (TrpA) and β-subunit (TrpB) of the tryptophan synthase in tandem.

[0022] The present invention further provides a recombinant expression vector for tandem expression of two enzymes, preferably a prokaryotic expression vector, including but not limited to pET21b and pXMJ19. In one embodiment, the gene encoding the tryptophan synthase α subunit (TrpA) and the gene encoding the β subunit (TrpB) are tandemly expressed using a strong inducible T7 promoter or a strong tac promoter, with the two coding genes separated by a conserved RBS spacer sequence. The promoter and RBS spacer sequences used in the co-expression system of the present invention are:

[0023] The inducible T7 promoter sequence is shown in SEQ ID NO.5:

[0024] GAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCTCTAGAAAATAATTTTGTTTAACTTTAAGAAGGAGATATACAT.

[0025] The inducible tac promoter sequence is shown in SEQ ID NO.6:

[0026] TGAGCTGTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGAATTAA.

[0027] The conserved RBS sequence is shown in SEQ ID NO.7:

[0028] TTTGTTTAACTTTAAGAAGGAGATATACAT.

[0029] Using commercial, one-step, efficient, seamless cloning (ClonExpress® II One Step Cloning Kit, Vazyme Biotech, China), and other rapid DNA fragment assembly technologies, the gene encoding the tryptophan synthase α subunit (TrpA), a conserved RBS spacer sequence, and the gene encoding the tryptophan synthase β subunit (TrpB) were concatenated and subcloned into the pET21b or pXMJ19 backbones to generate the recombinant expression plasmids pET21b-TrpAB and pXMJ19-TrpAB. The pET21b-TrpAB plasmid was then transformed into Escherichia coli BL21 (DE3) to generate recombinant E. coli strains, and the pXMJ19-TrpAB plasmid was transformed into Corynebacterium glutamicum ATCC 13032 to generate recombinant C. glutamicum strains.

[0030] Protein language models have demonstrated significant advantages in the design and optimization of functional proteins, providing a novel research tool for the life sciences and biotechnology fields. The ESM (Evolutionary Scale Modeling) model, which treats protein sequences as a language and amino acids as characters, leverages an autoregressive neural network (Transformer) to extract evolutionary patterns and deep sequence-structure-function relationships from large-scale protein sequence databases. This approach can accurately predict the effects of protein mutations on their structure and function (e.g., stability, activity, and affinity) [Meier J, et al. Language models enable zero-shot prediction of the effects of mutations on protein function. Advances in neural information processing systems, 2021, 34: 29287-29303.]. This approach overcomes the limitations of traditional experimental screening and significantly improves the efficiency of mutation site screening and prediction accuracy. In the present invention, based on the ESM model combined with a machine learning algorithm, a systematic analysis of potential mutation sites of tryptophan synthase (TrpB subunit) was conducted, and four mutation sites with the highest prediction scores, T69A, S143A, R219E, and F280H, were screened out. The catalytic efficiency of the enzyme was improved through combined superposition optimization. In a specific embodiment, the tryptophan synthase mutant was achieved by the following technical scheme: using a site-directed mutagenesis strategy, point mutation primers were designed according to the amino acid site to be mutated, and using the pET21b-TrpAB plasmid or the pXMJ19-TrpAB plasmid as a template, a recombinant plasmid pET21b-TrpAB containing the tryptophan synthase mutant sequence was obtained by PCR. mut and pXMJ19-TrpAB mut .

[0031] Example 2: Determination of enzyme activity of tryptophan synthase mutants

[0032] The selected inducible expression vector is pET21b, which contains T7 strong promoter-related sequences (including the operator sequence lacO and the conserved RBS sequence). When inducers such as IPTG or lactose are added, the repressor protein will be prompted to leave the operator sequence and initiate gene expression.

[0033] The inducible expression vector selected in the present invention is pXMJ19. The plasmid itself contains a strong promoter tac-related sequence (including the operator sequence lacO and the conserved RBS sequence), which can be replicated in Escherichia coli and Corynebacterium glutamicum. When inducers such as IPTG or lactose are added, the repressor protein will also be prompted to leave the operator sequence and initiate gene expression.

[0034] In this example, recombinant E. coli cells expressing the protein in the expression vector pET21b were harvested, the culture medium removed by centrifugation, and the pellet resuspended in 10 mL of pre-chilled lysis buffer (20 mM Na₂HPO₃, 200 mM NaCl, pH 7.5). The cells were disrupted using an ultrasonic cell disruptor at 200 W power, with a 2-second interval and a 1-second pause for 10 minutes. The cells were then centrifuged at 8000 × g for 10 minutes in a high-speed refrigerated centrifuge, and the supernatant collected for subsequent protein purification and enzyme activity assays.

[0035] The enzyme activity of tryptophan synthase was determined based on the catalytic activity of L-cysteine ​​product production. The enzyme activity assay system consisted of 1 mL (100 mM Tris-HCl, pH 8.0), 100 mM L-serine, 100 mM sodium bisulfide, 50 μM PLP, and 10 μL crude enzyme solution. o The cells were incubated at 400 °C for 30 min, and the L-cysteine ​​content in the system was determined by HPLC. The study found that the T69A / S143A / R219E / F280H combined mutant of tryptophan synthase exhibited significantly enhanced catalytic performance compared to the wild-type unmutated tryptophan synthase (0.61 µmol / min / mg), with the enzyme activity increased by 2.4 times.

[0036] Example 3: Application of tryptophan synthase mutants in the production of L-cysteine

[0037] This example is based on a whole-cell transformation method, using basic raw materials such as L-serine and sodium bisulfide, and efficiently catalyzing the synthesis of L-cysteine ​​under the condition of adding PLP cofactor. In a preferred embodiment of producing L-cysteine, 75 g / L of serine substrate, a final concentration of 0.8-1.0 mol / L of sodium bisulfide substrate, 20-30 g / L of induced recombinant Corynebacterium glutamicum (based on the expression vector pXMJ19) and a final concentration of 0.20-0.4 g / L of pyridoxal phosphate were added to a 100 mL Tris-HCl buffer system. The speed was controlled at 200-300 r / min, the catalytic reaction pH was 6-8, the catalytic reaction temperature was 30-40 ° C, and the catalytic reaction time was 12-24 h. After the reaction was completed, the components of the catalytic reaction liquid were quantitatively analyzed by HPLC liquid chromatography.

[0038] Liquid chromatography analysis revealed a relatively homogeneous composition in the whole-cell conversion solution, with minimal residual substrate and other impurities. While wild-type E. coli tryptophan synthase has a modest ability to convert L-serine to L-cysteine, the conversion rate remains relatively low under high L-serine substrate concentrations, reaching only 31.8% in the experiments described above. The tryptophan synthase mutant combination, T69A / S143A / R219E / F280H, exhibited excellent L-cysteine ​​production, ultimately yielding 85.6 g / L of L-cysteine ​​with a conversion rate exceeding 99%, demonstrating promising industrial application prospects.

[0039] The above contents are only preferred embodiments of the present invention, which are intended to illustrate the technical solutions of the present invention, rather than to limit the scope of protection of the present invention. Without departing from the core technical concept of the present invention, those skilled in the art may, based on the description and claims of the present invention, make appropriate adjustments, changes or equivalent substitutions thereto. All technical improvements, equivalent solutions and variations within the scope defined by the claims of the present invention shall be deemed to be within the scope of protection of the present invention. In addition, technical contents not specifically described in the present invention, if they belong to conventional technical means of those skilled in the art, shall also be deemed to be part of the present invention.

Claims

1. A tryptophan synthase mutant with improved enzyme activity, comprising a tryptophan synthase α subunit TrpA and a tryptophan synthase β subunit TrpB, characterized in that: Wherein, the tryptophan synthase beta subunit TrpB has a combination of mutations at amino acid sequence position 69 from threonine to alanine, position 143 from serine to alanine, position 219 from arginine to glutamate, and position 280 from phenylalanine to histidine, relative to the wild type shown in SEQ ID No. 1; The GenBank accession number of tryptophan synthase α subunit TrpA is AAA57301.

1.

2. The gene encoding the tryptophan synthase mutant according to claim 1, wherein the tryptophan synthase α subunit TrpA and the tryptophan synthase β subunit TrpB genes are present separately or in series.

3. A recombinant expression vector containing the coding gene according to claim 1.

4. The recombinant expression vector according to claim 3, wherein It is a prokaryotic expression vector.

5. The recombinant expression vector according to claim 3, wherein They are the Escherichia coli expression vector pET21b and the Corynebacterium glutamicum expression vector pXMJ19.

6. The recombinant expression vector according to claim 5, wherein The coding gene of tryptophan synthase α subunit TrpA, the conserved RBS spacer sequence and the coding gene of tryptophan synthase β subunit TrpB were concatenated and subcloned into the pET21b or pXMJ19 backbone to obtain the recombinant expression plasmid pET21b-TrpAB or pXMJ19-TrpAB.

7. A recombinant bacterium containing the recombinant expression vector according to any one of claims 3 to 6.

8. The recombinant bacterium according to claim 7, wherein The invention is a recombinant Escherichia coli engineering bacterium or a recombinant Corynebacterium glutamicum engineering bacterium.

9. Use of the tryptophan synthase mutant according to claim 1, or its encoding gene, or the recombinant expression vector according to any one of claims 3 to 6, or the recombinant bacterium according to claim 7 or 8 in catalyzing the synthesis of L-cysteine.

10. The use according to claim 9, characterized in that L-cysteine ​​was synthesized from L-serine and sodium hydrosulfide.