A strain of Bacillus coagulans producing high unsaturated fatty acids and its application

By adding Bacillus coagulis DZNBC-11-068 to animal feed, the problem of imbalance in the ratio of high-unsaturated fatty acids to saturated fatty acids in meat is solved, the content of high-unsaturated fatty acids in muscles is improved, and the nutritional value and health of meat is improved.

CN120041357BActive Publication Date: 2025-08-22GUANGDONG DAZENONG BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510510291.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-23
Publication Date
2025-08-22
Estimated Expiration
2045-04-23

AI Technical Summary

Technical Problem

The imbalance between the ratio of high-unsaturated fatty acids and saturated fatty acids in existing meats leads to an increase in cholesterol and an increase in blood lipid content, affecting the nutritional value and health of meat.

Method used

A Bacillus coagulans DZNBC-11-068 was used to prepare bacterial powder or bacterial agents to add them to animal feed, thereby increasing the content of high unsaturated fatty acids in animal muscles, especially the ratio of n-3 PUFA and n-6 ​​PUFA.

Benefits of technology

It significantly increases the content of high unsaturated fatty acids in animal muscles, reduces the content of saturated fatty acids, improves the nutritional value and health of meat, and is suitable for long-term use.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120041357B_ABST
    Figure CN120041357B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of microbial technology and specifically relates to a strain of Bacillus coagulans that produces highly unsaturated fatty acids and its applications. The purpose of the present invention is to increase the content of highly unsaturated fatty acids in the muscle fat of farmed animals. The technical solution of the present invention is a strain of Bacillus coagulans (DZNBC-11-068), which has a deposit number of CGMCC No. 29595. The Bacillus coagulans of the present invention efficiently produces highly unsaturated fatty acids during its growth and metabolism. In animal application tests, the strain was able to colonize the intestines, improving the absorption efficiency of highly unsaturated fatty acids in farmed animals, thereby promoting the content of highly unsaturated fatty acids in the muscle fat of farmed animals.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a Bacillus coagulans strain producing high-unsaturated fatty acids and an application thereof. Background Art

[0002] Intramuscular fat content and composition are important economic traits in farmed animals, crucially impacting meat quality, including tenderness, flavor, and juiciness. Over the years, scholars both domestically and internationally have conducted extensive research on this topic, with findings providing valuable insights into meat processing and utilization. Fat is primarily composed of various fatty acids, which are important aromatic substances and muscle flavor enhancers. The primary fat component is phospholipids, which comprise 60-70% of total fat. Lecithin is primarily composed of oleic acid and stearic acid, accounting for 98.5% of total fatty acids. Fatty acids are categorized into three main groups: saturated fatty acids (stearic acid, palmitic acid, lauric acid, myristic acid, palmitic acid, pentadecanoic acid, heptadecanoic acid, etc.), monounsaturated fatty acids, and polyunsaturated fatty acids. Monounsaturated and polyunsaturated fatty acids are also known as unsaturated fatty acids.

[0003] It is generally believed that high concentrations of saturated fatty acids can increase low-density lipoprotein cholesterol levels in the blood, potentially leading to cardiovascular and cerebrovascular diseases, particularly coronary artery disease. Saturated fatty acids can indeed increase cholesterol levels in the body. The most important fatty acids in subcutaneous fat and intramuscular fat are monounsaturated fatty acids and oleic acid (C18:1), accounting for 34.15% to 43.75% of the total fatty acids. Long-chain fatty acids, also known as the polyunsaturated fatty acid system (PUFAs), contain two or more double bonds, such as linoleic acid, linolenic acid, arachidonic acid, docosahexaenoic acid (DHA), and eicosapentaenoic acid (EPA). Highly unsaturated fatty acids play a crucial role in human metabolism, possessing positive biological benefits. These fatty acids include essential fatty acids (EFAs). Linoleic acid (C18:2n-6), linoleic acid (C18:3n-3), and 2,0- and 2,2-dicarboxylic acids, essential for animal metabolism, are synthesized from these fatty acids. Linoleic acid (C18:2), the main essential fatty acid in living organisms, is of great significance in nutrition and health, playing a crucial role in human metabolism.

[0004] Linoleic acid converts cholesterol into bile acids in the body, thereby lowering blood cholesterol levels. Linoleic acid also synthesizes two essential fatty acids, linolenic acid and arachidonic acid, which help reduce the incidence of coronary heart disease. Many metabolic pathways in the body rely on a balanced balance of polyunsaturated fatty acids. Furthermore, fat improves muscle tenderness and flavor.

[0005] Livestock remain the primary source of fatty acids. Therefore, improving the fatty acid content and composition of livestock meat is crucial for my country's nutritional composition. The ratio of highly unsaturated fatty acids to saturated fatty acids (P:S) is a key indicator of meat's nutritional value. Another indicator of meat's nutritional value is the n-6:n-3 ratio, which should generally be between 1.0 and 2.0. The ideal ratio of highly unsaturated fatty acids to saturated fatty acids (P:S) in meat varieties is above 0.4, but the natural P:S ratio in meat is mostly around 0.1. Clearly, current meat consumption can lead to an imbalance in fatty acid intake, raising cholesterol and blood lipid levels. Therefore, improving the P:S ratio during meat production is crucial. The edible value of muscle is directly influenced by the content of higher unsaturated fatty acids (PUFAs) in muscle tissue. Only when muscle contains a certain amount of PUFAs is it tender, flavorful, and highly nutritious. Furthermore, highly unsaturated fatty acids can lower blood lipids, inhibit platelet aggregation, combat autoimmune responses, and promote growth and development. As the public pays more attention to healthy food, the presence of high unsaturated fatty acids in food sources is becoming increasingly important, as it is suitable for human growth, development and healthy eating habits. Summary of the Invention

[0006] The purpose of the invention is to increase the content of highly unsaturated fatty acids in muscle fat of farmed animals.

[0007] The technical solution of the present invention is a strain of Bacillus coagulans DZNBC-11-068, whose preservation number is CGMCC No.29595.

[0008] The present invention also provides the use of the Bacillus coagulans DZNBC-11-068 in providing high unsaturated fatty acid content to farmed animals.

[0009] Wherein, the highly unsaturated fatty acid is n-3 PUFA (ω-3 polyunsaturated fatty acid) and / or n-6 PUFA (ω-6 polyunsaturated fatty acid).

[0010] Specifically, the farmed animals are pigs.

[0011] Preferably, in the application, the Bacillus coagulans is prepared into feed, bacterial powder or bacterial agent for use.

[0012] In particular, the preparation method of the bacterial powder includes the following steps: collecting the fermentation liquid of Bacillus coagulans DZNBC-11-068, centrifuging, collecting bacterial mud, and re-dissolving the bacterial mud with the centrifuged supernatant to form a viscous state; uniformly mixing the bacterial mud with a carrier; granulating, and drying; and obtaining bacterial powder.

[0013] Specifically, the carrier is an inorganic salt carrier, such as corn cob powder, montmorillonite powder, medical stone and / or stone powder.

[0014] Specifically, the weight ratio of the bacterial mud to the carrier is 1:1.

[0015] Wherein, the drying temperature is controlled below 35°C.

[0016] Specifically, the humidity of the bacterial powder is below 10%.

[0017] In particular, the feed preparation method includes the following steps: collecting the fermentation liquid of Bacillus coagulans DZNBC-11-068, centrifuging, collecting bacterial sludge, and re-dissolving the bacterial sludge with the centrifugal supernatant to make it viscous; uniformly mixing the bacterial sludge with a carrier; granulating and drying; obtaining bacterial powder; and mixing the bacterial powder with a basic feed.

[0018] Specifically, the carrier is corn cob powder, montmorillonite powder, medical stone and / or stone powder.

[0019] Specifically, the weight ratio of the bacterial mud to the carrier is 1:1.

[0020] Wherein, the drying temperature is controlled below 35°C.

[0021] Specifically, the humidity of the bacterial powder is below 10%.

[0022] Preferably, the amount of Bacillus coagulans DZNBC-11-068 added to the feed is 10 4 ~10 5 CFU / g.

[0023] The present invention also provides a Bacillus coagulans powder, which comprises Bacillus coagulans DZNBC-11-068 bacterial slurry and a carrier in a weight ratio of 1:1.

[0024] Specifically, the carrier is corn cob powder, montmorillonite powder, medical stone and / or stone powder.

[0025] The present invention also provides a feed containing Bacillus coagulans. The Bacillus coagulans DZNBC-11-068 is prepared into bacterial powder and then mixed with a basic feed.

[0026] Preferably, the amount of Bacillus coagulans DZNBC-11-068 added to the feed is 10 4 ~10 5 CFU / g.

[0027] The present invention also provides a method for breeding animals with a high content of highly unsaturated fatty acids, comprising the following steps: feeding the animals with Bacillus coagulans DZNBC-11-068.

[0028] Specifically, the highly unsaturated fatty acid is n-3 PUFA and / or n-6 PUFA.

[0029] Specifically, Bacillus coagulans DZNBC-11-068 is prepared into fermentation liquid, bacterial powder, bacterial agent or feed containing Bacillus coagulans DZNBC-11-068.

[0030] In particular, the preparation method of the bacterial powder includes the following steps: collecting the fermentation liquid of Bacillus coagulans DZNBC-11-068, centrifuging, collecting bacterial mud, and re-dissolving the bacterial mud with the centrifuged supernatant to form a viscous state; uniformly mixing the bacterial mud with a carrier; granulating, and drying; and obtaining bacterial powder.

[0031] Specifically, the carrier is corn cob powder, montmorillonite powder, medical stone and / or stone powder.

[0032] Specifically, the weight ratio of the bacterial mud to the carrier is 1:1.

[0033] Wherein, the drying temperature is controlled below 35°C.

[0034] Specifically, the humidity of the bacterial powder is below 10%.

[0035] In particular, the feed preparation method includes the following steps: collecting the fermentation liquid of Bacillus coagulans DZNBC-11-068, centrifuging, collecting bacterial sludge, and re-dissolving the bacterial sludge with the centrifugal supernatant to make it viscous; uniformly mixing the bacterial sludge with a carrier; granulating and drying; obtaining bacterial powder; and mixing the bacterial powder with a basic feed.

[0036] Specifically, the carrier is corn cob powder, montmorillonite powder, medical stone and / or stone powder.

[0037] Specifically, the weight ratio of the bacterial mud to the carrier is 1:1.

[0038] Wherein, the drying temperature is controlled below 35°C.

[0039] Specifically, the humidity of the bacterial powder is below 10%.

[0040] Preferably, the amount of Bacillus coagulans DZNBC-11-068 added to the feed is 10 4 ~10 5 CFU / g.

[0041] Furthermore, the animal is a pig.

[0042] The present invention discloses a strain of Bacillus coagulans (CGMCC No. 29595) that efficiently produces highly unsaturated fatty acids during its growth and metabolism. In animal studies, the strain was able to colonize the intestines, improving the absorption efficiency of highly unsaturated fatty acids in farmed animals, thereby increasing the content of highly unsaturated fatty acids in muscle fat, resulting in healthier and more sustainable meat products. This strain has minimal impact on pig production performance, modestly increasing the proportion of fat in muscle while significantly altering the fat composition within the muscle. Within the total fat, it can increase the content of highly unsaturated fatty acids by 5%, while significantly reducing the content of saturated fatty acids. The strain converts saturated fatty acids into n-3 PUFA, n-6 PUFA, monounsaturated fatty acids (MUFA), and highly unsaturated fatty acids (PUFA), thereby improving the nutritional value of fat in fattening pig muscle and enhancing meat quality. The Bacillus coagulans of the present invention produces high PUFAs and is suitable for long-term use. The use methods include feed, bacterial agents, bacterial powder, etc. It can improve the absorption efficiency of highly unsaturated fatty acids in farmed animals, increase the PUFA (highly unsaturated fatty acids) content in muscle fat, improve meat quality, and is suitable for promotion and application.

[0043] The Bacillus coagulans of the present invention is deposited in the China Center for Type Culture Collection (CGMCC), address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 29595 and the deposit date January 15, 2024. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 This is a microscopic picture of Bacillus coagulans, with a scale of 2500:1.

[0045] Figure 2 This is a picture of the colony morphology of Bacillus coagulans. DETAILED DESCRIPTION

[0046] By chance, the researchers isolated multiple strains from animal feces on a farm. After separation and purification, they prepared fermentation broths from each strain in the laboratory, extracted total lipids, and, using experimental parameters set according to GB 5009.168-2016, measured PUFA content. This resulted in a strain with a high yield of highly unsaturated fatty acids (particularly bile acid). Through biological characterization, physiological and biochemical characterization, and 16S rDNA sequencing analysis, the strain was ultimately identified as Bacillus coagulans DZNBC-11-068, with accession number CGMCC No. 29595. This strain exhibits remarkable high-unsaturated fatty acid production.

[0047] In order to further illustrate the technical means and effects adopted by the present invention to achieve the predetermined purpose of the invention, the specific implementation methods, structures, features and effects of the present invention are described in detail below in conjunction with the accompanying drawings and preferred embodiments.

[0048] Example 1 Screening of high bile acid producing strains

[0049] 1) Screening and Verification

[0050] Multiple strains were isolated from animal feces in aquaculture, and single colonies were isolated by streaking on Petri dishes. The culture medium (g / L) consisted of: 20g cornmeal, 10g soybean meal, 5g glucose, 5g yeast extract, 5g sodium chloride, 3g potassium phosphate (KHPO), 3g potassium phosphate (KHPO), 0.3g manganese sulfate (MnSO), and 17% agar adjusted to pH 7.0. Sterilize at 121°C, cool to 55°C, invert the plate, and ferment at 36°C in an anaerobic jar with oxygen purifier added. Incubate the plate statically. Single colonies were passaged and set aside. A total of 20 single colonies were obtained by streaking and picking individual colonies.

[0051] 2) Liquid fermentation

[0052] Each isolated colony was inoculated into a liquid culture medium containing the following components (g / L): 20g corn steep liquor, 10g soybean meal, 5g glucose, 5g yeast extract, 5g sodium chloride, and 3g potassium phosphate (KH2PO4). The pH was adjusted to 8.5. Sterilization was performed at 121°C. The fermentation temperature was 36°C, and the culture was allowed to stand for 24 hours to obtain fermentation broths from different colonies.

[0053] 3) PUFAs content detection

[0054] Total lipids were extracted, and experimental parameters were set according to GB 5009.168-2016. Muscle fatty acids were treated with 15% KOH in methanol at 20°C for 1 hour to methylate the fatty acids. Lipids were then esterified with 6.5% boron trifluoride (BF3) in methanol at 85°C for 15 minutes. After mixing, the mixture was dissolved in hexane (25 mg / mL), and the fatty acid methyl esters were analyzed by gas chromatography (GC). The resulting fatty acid methyl esters were analyzed and quantified using a Hewlett-Packard HP-5890 gas chromatograph equipped with a cross-linked 5% phenylmethyl silicone gel column (L = 25 m, ID = 0.32 min, DF = 0.25 μmol / L, HP-Ultra2, nitrogen as carrier gas). Nonadecanoic acid (50 g / L) was used as an internal standard, representing 10% of the total fatty acids. Detection was performed using a flame ionization detector (FID) with nozzle and detector temperatures at 190°C and 250°C, respectively. The column temperature was set to increase from 190°C to 260°C (2°C / min) and maintained for 5 minutes. Phenotypic data were sorted in descending order, with high and low phenotypic values ​​considered extreme. The Shapiro-Wilk test confirmed that the PUFA phenotypic data followed a normal distribution (P>0.05). To facilitate calculation of actual fatty acid intake by the general public and relevant scientific research and management personnel, data were analyzed and presented using the absolute quantification method (mg / 100 g sample wet weight).

[0055] Data processing: The obtained data were analyzed by one-way ANOVA method using SPSS11 statistical software, and Duncan's multiple comparisons were performed. The results were expressed as mean ± standard deviation.

[0056] The PUFAs test results are shown in Table 1. The PUFAs content in the fermentation broth of strain 16 (designated DZNBC-11-068) was 2.214 g / L, indicating that the strain has nutritional value and can be further developed and tested in animals.

[0057] Table 1 Determination results of fatty acid content in different fermentation broth samples (unit: g / L)

[0058] 4) Identification of the above strain No. 16

[0059] Based on the colony morphology and culture method of the early culture, it was basically determined to be Bacillus coagulans ( Figure 1 and Figure 2 ). Further physiological, biochemical and molecular identifications were carried out.

[0060] 1. Physiological and biochemical identification: The purchased Bacillus coagulans biochemical identification strips were used for identification according to the prescribed procedures. The results are shown in Table 2. The morphological characteristics of Bacillus 16 are: the bacteria are rod-shaped, can form spores, are generally 0.8-1.2μm × 1.5-2.0μm in size, and are Gram-positive.

[0061] Table 2 Physiological and biochemical reaction results

[0062] 2. DNA extraction of Bacillus coagulans and sequencing and identification of 16s rDNA fragments amplified by PCR

[0063] The isolated strains were amplified in vitro using 16sDNA specific tag sequences by PCR, and the PCR products were sent to a biological company for sequencing. The sequencing results were blasted to identify the species of the strains.

[0064] Add 400µL of sterile pure water to the sterilized 1.5mL centrifuge tube. At the same time, pick up a full loop of the test strain from the culture dish in the clean bench and add it to the centrifuge tube. Place the centrifuge tube on an oscillator to shake and mix, insert it into the float, and place it in an ultrasonic instrument. Ultrasonicate at 40KHZ, 600w power for 5 minutes. Take it out and shake and mix again, and ultrasonicate for 5 minutes again. Ultrasonicate for a total of 3 times, each time for 5 minutes. After that, put the bacterial solution after ultrasonic disruption into the refrigerator as a DNA template for use.

[0065] During the experiment, we found that a small number of strains were difficult to effectively release the DNA within their cells, regardless of whether they were subjected to ultrasonic disruption or high-temperature heating to denature the cells. Therefore, for these strains, a DNA extraction kit was used to extract the bacterial DNA, which was used as a template for PCR amplification. In this process, a bacterial genomic DNA rapid extraction kit (Shanghai Sangon, product number: B518225) was used for extraction. The standard operating steps are as follows:

[0066] Transfer 1 mL of overnight bacterial culture to a 1.5 mL centrifuge tube and centrifuge at 8,000 rpm for 1 minute at room temperature. Discard the supernatant and collect the cells. Add 500 µL of Buffer Digestion and vortex to mix thoroughly. Incubate at 65°C for 2 hours until the cells are completely lysed. Invert and mix every 10 minutes while in the water bath to promote lysis. Lysis is complete when the mixture becomes clear. If the solution does not become clear, the sample is not completely lysed and the incubation time should be extended appropriately. Add 200 µL of Buffer PB, mix thoroughly by inversion, and incubate on ice for 5 minutes. Centrifuge at 10,000 rpm for 5 minutes at room temperature. Transfer the supernatant (500-550 µL) to a new 1.5 mL centrifuge tube. Add an equal volume of isopropanol and invert 5-8 times to mix thoroughly. Incubate at room temperature for 2-3 minutes. Centrifuge at 10,000 rpm for 5 minutes at room temperature and discard the supernatant. Add 1 mL of 75% ethanol, rinse by inversion for 1–3 minutes, centrifuge at 10,000 rpm for 2 minutes, and discard the supernatant (twice). Uncover and invert at room temperature for 5–10 minutes to completely evaporate any residual ethanol. Dissolve the resulting DNA in 50–100 µL of TE Buffer. The extracted DNA can be used immediately for the next step or stored at -20°C.

[0067] PCR system (25µL): purified water 16µL, PCR buffer 2.5µL, dNTP 0.5µL, upstream and downstream primers 1µL each (27F and 1492R), template 2µL, Taq enzyme 0.5µL, Mg 2+ 1.5 µL. PCR parameters were set as follows: 94°C for 10 min (to increase DNA release); 30 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 90 s; extension at 72°C for 10 min; and storage at 10°C.

[0068] The PCR products were subjected to gel electrophoresis using 1% agarose gel. During the gel run, the color developer (Shanghai Sangon, 4S Green) was added at a rate of 1 µL / 100 mL. 2 µL of the PCR product was mixed with 1 µL of loading buffer and spotted into the agarose gel electrophoresis tank. The voltage was set to 170 V for 20 min.

[0069] Copy the 16s rDNA fragment sequence and the base sequence from the nucleic acid sequence txt file sent back by Bioengineering. At the same time, log in to the NCBI gene database, enter the Blast alignment mode, select the nucleic acid alignment database, enter the sequenced seq file sequence into the alignment window, adjust the alignment parameters, and select a strain with a sequence similarity of more than 90% as the reference strain for identification.

[0070] DNA concentration is determined by a nucleic acid analyzer, so a gradient dilution method was used to explore the DNA template concentration, with dilutions of 10, 100, 150, and 200 times. A 10-fold dilution was determined to be suitable for the current PCR system. Blast analysis revealed that the 16S rDNA sequence of this strain shared 98% similarity with various Bacillus coagulans strains, confirming that this strain belongs to Bacillus coagulans. The strain was also sent to the China National Center for Microbiological Culture Collection in Beijing for preservation under the CGMCC No. 29595.

[0071] SEQ ID No.1 16s rDNA

[0072] gacgaacgct ggcggcgtgc ctaatacatg caagtcgtgc ggacctttta aaagcttgcttttaaaaggt tagcggcgga cgggtgagta acacgtgggc aacctgcctg taagatcggg ataacgccgggaaaccgggg ctaataccgg atagtttttt cctccgcatg gaggaaaaag gaaagacggc ttttgctgtcacttacagat gggcccgcgg cgcattagct agttggtggg gtaacggctc accaaggcaa cgatgcgtagccgacctgag agggtgatcg gccacattgg gactgagaca cggcccaaac tcctacggga ggcagcagtagggaatcttc cgcaatggac gaaagtctga cggagcaacg ccgcgtgagt gaagaaggcc ttcgggtcgtaaaactctgt tgccggggaa gaacaagtgc cgttcgaaca gggcggcgcc ttgacggtac ccggccagaaagccacggct aactacgtgc.

[0073] Example 2: Drying and pulverizing the fermentation liquid of Bacillus coagulans to prepare microecological products

[0074] The concentrated bacterial liquid was obtained by centrifugation in a disc centrifuge, and then the bacterial sludge was obtained by centrifugation in a tubular centrifuge. The bacterial sludge was re-dissolved with a small amount of centrifugal supernatant to make it uniform and viscous, which was easy to mix evenly. The bacterial sludge was mixed with corn cob powder in a weight ratio of 1:1 using a high-speed mixer and placed in a boiling dryer for drying. During boiling drying, the material temperature was controlled below 35°C to keep the humidity of the dried bacterial powder below 10%. The single batch processing time was about 30 to 60 minutes. After that, the PUFAs content in the bacterial powder product was efficiently detected to be 1.112%.

[0075] Example 3 Results of clinical animal experiments on farms

[0076] 54 "Du×Da×Chang" three-way crossbred pigs with similar age and weight (43.3±1.58) kg were selected and randomly divided into 3 groups, 18 pigs in each group, and each group was divided into 6 pens (repeated), 3 pigs in each pen. The control group was fed with the basic feed, and the experimental groups were fed with 10 4 CFU / g Bacillus coagulans (low dose group) and 10 5 CFU / g of Bacillus coagulans (high-dose group). The diets were formulated according to the "Pig Feeding Standard" (NY / T65-2004) for lean growing-finishing pigs. Their composition and nutritional levels included crude fat content of 2.88%, 7.31%, and 7.28%, respectively. Nutrients such as digestible energy, crude protein, and acid detergent fiber were essentially the same. The pre-trial period lasted 10 days, and the test chamber lasted 44 days. During the trial, pigs were fed twice a day at 8:00 AM and 5:30 PM, with free access to food and water.

[0077] During the trial, feed intake and residual feed were recorded daily for each replicate. All pigs were weighed on an empty stomach on days 1, 22, and 44 of the main trial period to calculate average daily feed intake, average daily weight gain, and feed-to-gain ratio. At the end of the trial, one pig with near-average weight was selected from each replicate, with six pigs per group. After fasting for 12 hours, the pigs were slaughtered and subcutaneous adipose tissue from the 13th and 14th ribs of the right half of the carcass was quickly collected. After rinsing with phosphate buffered saline, the samples were frozen in liquid nitrogen for fatty acid content determination.

[0078] Fatty acid content was determined by extracting total lipids using the chloroform-methanol method (1:2) according to the experimental parameters set in accordance with GB 5009.168-2016. Muscle fatty acids were treated with 15% KOH in methanol at 20°C for 1 h to methylate the fatty acids. Lipids were then esterified with 6.5% boron trifluoride (BF3) in methanol (Morita, Osaka, Japan) at 85°C for 15 minutes. After mixing, the fatty acid methyl esters were dissolved in hexane (25 mg / ml) and analyzed by gas chromatography (GC). The resulting fatty acid methyl esters were analyzed and quantified using a Hewlett-Packard HP-5890 gas chromatograph equipped with a cross-linked 5% phenylmethyl silicone gel column (L = 25 m, ID = 0.32 min, DF = 0.25 μmol / L, HP-Ultra2, nitrogen as carrier gas). Nonadecanoic acid (50 g / L) was used as an internal standard, representing 10% of the total fatty acids. Detection was performed using a flame ionization detector (FID), with nozzle and detector temperatures at 190°C and 250°C, respectively. The column temperature was set to increase from 190°C to 260°C (2°C / min) and maintained for 5 minutes. Phenotypic data were sorted in descending order, with high and low phenotypic values ​​considered extreme. The Shapiro-Wilk test confirmed that PUFA phenotypic data followed a normal distribution (P>0.05). To facilitate calculation of actual fatty acid intake by the general public and relevant scientific research and management personnel, data were analyzed and presented using the absolute quantification method (mg / 100g sample wet weight).

[0079] Table 3 Changes in growth performance and fat content of 54 samples (3 groups) on day 44 (unit: kg)

[0080]

[0081] Table 4 Changes in fatty acid composition in muscle of 54 samples (3 groups) on day 44 (unit: % dry matter)

[0082]

[0083] In summary: This Bacillus coagulans has little effect on pig production performance, can appropriately increase the proportion of fat in muscle, but can significantly change the fat composition in muscle. In the total fat, it can increase the content of highly unsaturated fatty acids by 5%, while significantly reducing the content of saturated fatty acids, and converting saturated fatty acids into n-3 PUFA, n-6 PUFA, monounsaturated fatty acids (MUFA), and highly unsaturated fatty acids (PUFA), thereby improving the nutritional value of fat in fattening pig muscle and making the meat quality healthier.

[0084] The above description is merely a preferred embodiment of the present invention and does not constitute any form of limitation to the present invention. Although the present invention has been disclosed as above in terms of a preferred embodiment, it is not intended to limit the present invention. Any person skilled in the art can, without departing from the scope of the technical solution of the present invention, make some changes or modifications to equivalent embodiments using the technical contents disclosed above. However, any brief modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention are still within the scope of the technical solution of the present invention.

Claims

1. The application of Bacillus coagulans in increasing the content of highly unsaturated fatty acids in farmed animals is characterized by: The deposit number of the Bacillus coagulans is CGMCC No. 29595; the highly unsaturated fatty acid is n-3 PUFA and / or n-6 PUFA; and the farmed animal is a pig.

2. The application according to claim 1, characterized in that: In the application, the Bacillus coagulans is prepared into feed or bacterial powder for use.

3. The application according to claim 2, characterized in that: The preparation method of the bacterial powder comprises the following steps: collecting the fermentation liquid of the Bacillus coagulans, centrifuging, collecting bacterial mud, and redissolving the bacterial mud with the centrifugal supernatant to make it viscous; uniformly mixing the bacterial mud with a carrier; granulating and drying; obtaining the bacterial powder; the carrier is corn cob powder, montmorillonite powder and / or medical stone; and the weight ratio of the bacterial mud to the carrier is 1:

1.

4. The application according to claim 2, characterized in that: The feed preparation method comprises the following steps: collecting the fermentation liquid of the Bacillus coagulans, centrifuging it, collecting bacterial mud, and re-dissolving it into a viscous state with the centrifugal supernatant; uniformly mixing the bacterial mud with a carrier; granulating and drying; obtaining bacterial powder; mixing the bacterial powder with a basic feed; the carrier is corn cob powder, montmorillonite powder and / or medical stone; and the weight ratio of the bacterial mud to the carrier is 1:

1.

5. The use according to claim 3 or 4, characterized in that: The drying temperature is controlled below 35° C.; and the moisture content of the bacterial powder is below 10%.

6. A Bacillus coagulans powder, characterized in that: The composition comprises bacillus coagulans slurry and a carrier in a weight ratio of 1:1; the preservation number of the bacillus coagulans is CGMCC No. 29595; and the carrier is corn cob powder, montmorillonite powder and / or medical stone.

7. A feed containing Bacillus coagulans, characterized in that: The Bacillus coagulans was prepared into bacterial powder and then mixed with the basic feed; the preservation number of the Bacillus coagulans was CGMCC No.29595; the addition amount of the Bacillus coagulans in the feed was 10 4 ~10 5 CFU / g.

8. A breeding method for increasing the content of highly unsaturated fatty acids in animals, characterized by: The method comprises the following steps: feeding Bacillus coagulans to animals; the highly unsaturated fatty acid is n-3 PUFA and / or n-6 PUFA; the preservation number of the Bacillus coagulans is CGMCC No. 29595; and the animals are pigs.