Escherichia coli engineering bacterium with high yield of ergothioneine as well as construction method and application thereof

Abstract

The invention belongs to the technical field of biochemical engineering, and provides Escherichia coli engineering bacteria with high yield of ergothioneine as well as a construction method and application of the Escherichia coli engineering bacteria. By introducing fusarium ergothioneine synthetase FpEGT1 and saccharomycetes ergothioneine synthetase SoEGT2, ergothioneine can be efficiently synthesized in escherichia coli, and the method has an important application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of biochemistry, and specifically relates to an Escherichia coli engineering bacterium with high yield of ergothioneine, and a construction method and application thereof. Background Art

[0002] Ergothioneine is a unique cell physiological protectant, which has broad application prospects in multiple industries such as food, beverage, cosmetics and medicine. It has multiple functions such as scavenging free radicals, detoxifying, maintaining DNA biosynthesis, promoting normal cell growth, enhancing cell immunity, anti-radiation, whitening and anti-aging, and plays a key role especially in antioxidant and energy regulation. It is a multifunctional cell physiological protectant. Ergothioneine has a significant effect on food preservation, can extend the shelf life of food, and can be used as a food additive; in addition, ergothioneine also shows potential in the treatment of chronic inflammation, preeclampsia, cardiovascular diseases, etc. Therefore, ergothioneine has been widely used in multiple fields such as food, cosmetics, and medicine. At present, the production methods of ergothioneine mainly include natural biological extraction method, chemical synthesis method and biosynthesis method. Compared with the first two methods, the biosynthesis method has become the main development direction of industrial production of ergothioneine due to its advantages such as low cost, easy availability of raw materials, and easy expansion of production.

[0003] However, the natural synthesis pathway of ergothioneine is complex and involves a series of complex enzyme-catalyzed conversion processes, making it very difficult to supply precursors synergistically and balance the pathway, thus restricting the construction of strains with high efficiency in producing ergothioneine. Previous studies have found that introducing ergothioneine synthesis pathways from different sources, such as bacteria or fungi, into Escherichia coli will result in a huge difference in the yield of ergothioneine due to differences in adaptation mechanisms. Therefore, exploring efficient ergothioneine synthesis elements and their adapted element combinations is crucial for the construction of an efficient ergothioneine cell factory. Summary of the Invention

[0004] The purpose of the present invention is to provide an Escherichia coli engineering bacterium with high yield of ergothioneine, and a construction method and application thereof.

[0005] In the first aspect, the present invention provides an Escherichia coli engineering bacterium with high yield of ergothioneine, which is constructed by overexpressing the ergothioneine synthase FpEGT1 gene derived from Fusarium ( Fusarium poae ), and the ergothioneine synthase SoEGT2 gene derived from Saccharomyces cerevisiae ( Schizosaccharomyces osmophilus ) in Escherichia coli by means of genetic engineering.

[0006] In the present invention, the overexpression method is selected from the following 1) to 3), or an optional combination: 1) By introducing a plasmid with the said gene; 2) by operably linking a strong promoter to said gene; 3) by introducing an enhancer.

[0007] Furthermore, replace the genes in the Escherichia coli genome with the FpEGT1 gene and the SoEGT2 gene yjgX genes.

[0008] In the present invention, the nucleotide sequence of the FpEGT1 gene is: The nucleotide sequence of the FpEGT1 gene is: a1) the nucleotide sequence shown in SEQ ID NO: 1; a2) a nucleotide sequence in which one or more nucleotides of the nucleotide sequence shown in SEQ ID NO: 1 are substituted, deleted and / or added and which expresses the same functional protein; a3) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO: 1 under stringent conditions and expresses the same functional protein, said stringent conditions being hybridization in a solution of 0.1×SSPE containing 0.1% SDS or 0.1×SSC containing 0.1% SDS at 65°C and washing the membrane with this solution; or a4) a nucleotide sequence having more than 90% homology with the nucleotide sequence of a1), a2) or a3) and expressing the same functional protein.

[0009] The nucleotide sequence of the SoEGT2 gene is: b1) the nucleotide sequence shown in SEQ ID NO: 2; b2) a nucleotide sequence in which one or more nucleotides of the nucleotide sequence shown in SEQ ID NO: 2 are substituted, deleted and / or added and which expresses the same functional protein; b3) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO: 2 under stringent conditions and expresses the same functional protein, said stringent conditions being hybridization in a solution of 0.1×SSPE containing 0.1% SDS or 0.1×SSC containing 0.1% SDS at 65°C and washing the membrane with this solution; or b4) a nucleotide sequence having more than 90% homology with the nucleotide sequence of b1), b2) or b3) and expressing the same functional protein.

[0010] yjgX The nucleotide sequence of the gene is: c1) the nucleotide sequence shown in SEQ ID NO: 3; c2) a nucleotide sequence in which one or more nucleotides of the nucleotide sequence shown in SEQ ID NO: 3 are substituted, deleted and / or added and which expresses the same functional protein; c3) A nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:3 under stringent conditions and expresses the same functional protein, wherein the stringent conditions are hybridization at 65°C in a solution of 0.1×SSPE containing 0.1% SDS or 0.1×SSC containing 0.1% SDS, and washing the membrane with this solution; or c4) A nucleotide sequence having more than 90% homology with the nucleotide sequence of c1), c2) or c3) and expressing the same functional protein.

[0011] Preferably, the starting strain is Escherichia coli MG1655.

[0012] In a second aspect, the present invention provides a method for constructing the engineering bacterium. By means of genetic engineering, the ergothioneine synthase FpEGT1 gene derived from Fusarium and the ergothioneine synthase SoEGT2 gene derived from yeast are overexpressed in Escherichia coli to construct an Escherichia coli engineering bacterium with high yield of ergothioneine.

[0013] Further, the method includes: replacing the yjgX gene in the Escherichia coli genome with the FpEGT1 gene and the SoEGT2 gene.

[0014] In a third aspect, the present invention provides the application of the engineering bacterium in the fermentative production of ergothioneine.

[0015] In a fourth aspect, the present invention provides the application of the engineering bacterium in the preparation of a product containing ergothioneine.

[0016] In a fifth aspect, the present invention provides a method for fermentatively producing ergothioneine, which comprises fermenting the engineering bacterium in a culture medium and separating ergothioneine from the fermentation product.

[0017] Preferably, the formula of the culture medium used for fermentation is: glucose 20 g / L, magnesium sulfate heptahydrate 0.8 g / L, diammonium hydrogen phosphate 4 g / L, potassium dihydrogen phosphate 6.67 g / L, potassium citrate 1.35 g / L, 3-morpholinopropanesulfonic acid 20.9 g / L, yeast powder 2.5 g / L, ferrous sulfate heptahydrate 50 mg / L, calcium chloride dihydrate 10 mg / L, zinc sulfate heptahydrate 11 mg / L, manganese sulfate tetrahydrate 2.5 mg / L, copper sulfate pentahydrate 5 mg / L, ammonium molybdate 0.5 mg / L, sodium borate decahydrate 0.1 mg / L, histidine 1 g / L, cysteine 1.5 g / L, and methionine 5 g / L.

[0018] By means of the above technical solutions, the present invention has at least the following advantages and beneficial effects: In view of the current efficient ergothioneine catalytic elements and their adaptation problems, the present invention can efficiently synthesize ergothioneine in Escherichia coli by introducing Fusarium ergothioneine synthase FpEGT1 and Saccharomyces cerevisiae ergothioneine synthase SoEGT2, and has important application prospects. Detailed implementation mode

[0019] The present invention provides a method for efficiently synthesizing ergothioneine by co-overexpressing the genes of Fusarium ergothioneine synthase FpEGT1 and Saccharomyces cerevisiae ergothioneine synthase SoEGT2 in Escherichia coli.

[0020] The present invention adopts the following technical solutions: (1) Introduce Fusarium ergothioneine synthase FpEGT1 and Saccharomyces cerevisiae ergothioneine synthase SoEGT2 into Escherichia coli; and, (2) Ferment and culture the above strains to detect the growth of the bacteria and the yield of ergothioneine.

[0021] The following examples are used to illustrate the present invention, but do not limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0022] Example 1 Expression of FpEGT1 and SoEGT2 genes in Escherichia coli In this example, the ergothioneine synthase FpEGT1 (sequence shown in SEQ ID NO:1) and SoEGT2 (sequence shown in SEQ ID NO:2) were replaced at the pseudogene locus of Escherichia coli MG1655 ATCC 700926 yjgX (sequence shown in SEQID NO:3).

[0023] Using the genome of Escherichia coli MG1655 as a template, with yjgX -U-F (acattagactgcttgcatcagccag, SEQ ID NO:4) and yjgX -U-R (gcggcagcagctggagacgccgtaagagaaggcattgtaggttctgaaccggttctagcg, SEQ ID NO:5) as primers for PCR to obtain a gene fragment yjgX -UP of about 1000bp and purify the PCR product. Using the genomes of Fusarium Fusarium poae 252244, purchased from ATCC), Saccharomyces cerevisiae ( Schizosaccharomyces osmophilus , purchased from ATCC) as templates, and using primers egt1-F (agcctcacaaccccgctagaaccggttcagaacctacaatgccttctcttacggcgtctc, SEQ ID NO:6) and egt1 -R (taaagcacgtccaaaaggaatacattctgacatttaaatatcccgtaccagtctggctcc, SEQ ID NO:7), egt2 -F (gggtaggagccagactggtacgggatatttaaatgtcagaatgtattccttttggacgtg, SEQ ID NO:8) and egt2 -R (taggggcaaatccaccttgtgctgatatgttagttttcaggtgaattttgacaaagctct, SEQ ID NO:9) were used as primers for PCR to obtain gene fragments egt1 and egt2 of approximately 3000 bp and 1100 bp, and the PCR products were purified. Using the genome of Escherichia coli MG1655 as a template, with primers yjgX -D-F (aaaagagctttgtcaaaattcacctgaaaactaacatatcagcacaaggtggatttgccc, SEQ ID NO:10) and yjgX -D-R (aggaagtcttactgctgtcgcc, SEQ ID NO:11) as primers for PCR, a gene fragment yjgX -DOWN of approximately 1000 bp was obtained and the PCR products were purified. The fragments yjgX -UP, egt1 , egt2 , yjgX -DOWN were subjected to overlap PCR to obtain the targeting fragment. Using plasmid pTarget (Jiang, Y., Chen, B., Duan, C.L., Sun, B.B., Yang, J.J., and Yang, S. (2015) Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and Environmental Microbiology, 81: 2506–2514, purchased from Addgene) as a template, with primers yjgX-N20-F (gataaacaggaaacacgggggttttagagctagaaatagcaagttaaaataaggct, SEQ ID NO:12) and yjgX -N20-R (ccccgtgtttcctgtttatcactagtattatacctaggactgagctagctgtcaag, SEQ ID NO:13) were used for amplification to obtain pTarget- yjgX . The targeting fragment, plasmid pTarget- yjgX and plasmid pCas9 were electrotransformed into Escherichia coli MG1655 using an electroporator (Bio-Rad). The electroporation conditions were a voltage of 2.5 KV, a resistance of 200 Ω, and a capacitance of 25 μF (the width of the electroporation cuvette was 2 mm). The recombinant strain was screened and named MG1655- egt12 .

[0024] Example 2 Expression of FpEGT1 and SoEGT2 with plasmids in Escherichia coli In this example, plasmids were used to express ergothioneine synthase FpEGT1 and SoEGT2.

[0025] Respectively, using F. poae and S. osmophilus genomic DNA as templates, and using primers egt1 -F (attgtgagcggataacaatttcacacaggaaacagaccatgccttctcttacggcgtctc, SEQ ID NO:14) and egt1 -R (taaagcacgtccaaaaggaatacattctgacatttaaatatcccgtaccagtctggctcc, SEQ ID NO:15), egt2 -F (taaagcacgtccaaaaggaatacattctgacatttaaatatcccgtaccagtctggctcc, SEQ ID NO:16) and egt2 -R (tgcaggtcgactctagaggatccttagttttcaggtgaattttgacaaagctcttttaag, SEQ ID NO:17) for PCR to obtain gene fragments egt1 and egt2, the fragment was ligated to the vector pTrc99A (Budiardjo, S.J., Stevens, J. J., Calkins, A. L., Ikujuni, A. P., Wimalasena, V. K., Firlar, E., Case, D. A., Biteen, J. S., Kaelber, J. T., & Slusky, J. S. G. (2022). Colicin E1 opens its hinge to plug TolC. eLife, 11, e73297, purchased from Addgene), and the name of the resulting recombinant plasmid was pTrc99A- egt12 . The recombinant plasmid pTrc99A- egt12 was transformed into MG1655 by electroporation (conditions as in Example 1), and the resulting recombinant strain was named MG1655 / pTrc99A- egt12 .

[0026] Example 3 Fermentation culture of recombinant Escherichia coli for the production of ergothioneine The recombinant strains MG1655, MG1655- egt12 and MG1655 / pTrc99A- egt12 were cultured overnight on an LB plate. Single colonies were inoculated from this fresh plate into test tubes containing 5 ml of LB medium and cultured at 37 °C and 200 rpm for 12 hours.

[0027] They were inoculated into 500 ml baffled shake flasks containing 50 ml of fermentation medium at an inoculation amount of 5% and cultured at 37 °C and 200 rpm until OD 600 reached 0.6, and 0.1 mM IPTG was added and co-cultured for 48 h.

[0028] The fermentation medium formulation included (g / L): glucose 20 g, magnesium sulfate heptahydrate 0.8 g, diammonium hydrogen phosphate 4 g, potassium dihydrogen phosphate 6.67 g, potassium citrate 1.35 g, 3-morpholinopropanesulfonic acid 20.9 g, yeast powder 2.5 g, ferrous sulfate heptahydrate 50 mg, calcium chloride dihydrate 10 mg, zinc sulfate heptahydrate 11 mg, manganese sulfate tetrahydrate 2.5 mg, copper sulfate pentahydrate 5 mg, ammonium molybdate 0.5 mg, sodium borate decahydrate 0.1 mg, histidine 1 g, cysteine 1.5 g, methionine 5 g.

[0029] During the fermentation process, the product concentration and the growth of the strain were detected by liquid chromatography, and the results are shown in Table 1 and Table 2. As can be seen from Table 1 and Table 2, after expressing ergothioneine synthase in Escherichia coli, the strain MG1655- egt12and MG1655 / pTrc99A- egt12 Compared with the control strain MG1655, ergothioneine was significantly accumulated without affecting the bacterial cells. Comparing with the ergothioneine production reported in the existing literature (Table 3), the ergothioneine synthases from Fusarium and yeast in the present invention are more favorable for the synthesis of ergothioneine.

[0030] Table 1 Growth conditions of different strains (OD 600 )

[0031] Table 2 Ergothioneine production of different strains (mg / L)

[0032] Table 3 Production of ergothioneine synthases from different sources

[0033] Although the present invention has been described in detail with general descriptions and specific embodiments above, some modifications or improvements can be made based on the present invention, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.

[0034] References: Jiang, Y., Chen, B., Duan, C.L., Sun, B.B., Yang, J.J., and Yang, S.(2015) Multigene editing in the Escherichia coli genome via the CRISPR-Cas9system. Appl Environ Microbiol 81: 2506–2514.

Claims

1. An Escherichia coli engineering bacterium for high-yield thioneine production, characterized in that: The engineered bacteria are obtained by genetic engineering to overexpress Fusarium spp. Fusarium poae ) and the ergothioneine synthase FpEGT1 gene from yeast ( Schizosaccharomyces osmophilus ) The ergothioneine synthase SoEGT2 gene was constructed; The nucleotide sequence of the FpEGT1 gene is: a1) the nucleotide sequence shown in SEQ ID NO: 1; a2) a nucleotide sequence in which one or more nucleotides of the nucleotide sequence shown in SEQ ID NO: 1 are replaced, deleted and / or added and the nucleotide sequence expresses a protein with the same function; a3) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:1 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS at 65°C and the membrane is washed with the solution; or a4) a nucleotide sequence that has more than 90% homology with the nucleotide sequence of a1), a2) or a3) and expresses a protein with the same function; The nucleotide sequence of the SoEGT2 gene is: b1) the nucleotide sequence shown in SEQ ID NO: 2; b2) a nucleotide sequence in which one or more nucleotides of the nucleotide sequence shown in SEQ ID NO: 2 are replaced, deleted and / or added and the nucleotide sequence expresses a protein with the same function; b3) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:2 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS at 65°C, and the membrane is washed with the solution; or b4) A nucleotide sequence that has more than 90% homology with the nucleotide sequence of b1), b2) or b3) and expresses a protein with the same function.

2. The engineered bacteria according to claim 1, characterized in that The overexpression method is selected from the following 1) to 3), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by operably linking a strong promoter to the gene; 3) By introducing enhancers.

3. The engineered bacteria according to claim 1, characterized in that Replacement of the FpEGT1 and SoEGT2 genes in the Escherichia coli genome xy Gene; xy The nucleotide sequence of the gene is: c1) the nucleotide sequence shown in SEQ ID NO:3; c2) a nucleotide sequence in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 3 and the nucleotide sequence expresses a protein with the same function; c3) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO:3 under stringent conditions and expresses a protein with the same function, wherein the stringent conditions are hybridization at 65°C in a 0.1×SSPE solution containing 0.1% SDS or a 0.1×SSC solution containing 0.1% SDS, and the membrane is washed with the solution; or c4) is a nucleotide sequence that has more than 90% homology with the nucleotide sequence of c1), c2) or c3) and expresses a protein with the same function.

4. The engineered bacteria according to any one of claims 1 to 3, characterized in that The starting strain was Escherichia coli MG1655.

5. The method for constructing the engineered bacteria according to any one of claims 1 to 4, characterized in that: By adopting genetic engineering means, the ergothioneine synthase FpEGT1 gene from Fusarium and the ergothioneine synthase SoEGT2 gene from yeast were overexpressed in Escherichia coli to construct an Escherichia coli engineered bacterium with high ergothioneine production; The FpEGT1 gene and the SoEGT2 gene are the same as the FpEGT1 gene and the SoEGT2 gene described in claim 1.

6. The method according to claim 5, characterized in that The overexpression method is selected from the following 1) to 3), or an optional combination: 1) by introducing a plasmid carrying the gene; 2) by operably linking a strong promoter to the gene; 3) By introducing enhancers.

7. The method according to claim 5 or 6, characterized in that: The method comprises: replacing the FpEGT1 gene and the SoEGT2 gene in the Escherichia coli genome with xy Gene; xy The gene is the same as that described in claim 3 xy Gene.

8. the application of engineering bacteria described in any one of claims 1-4 in fermentation production of ergothioneine.

9. the application of engineering bacteria described in any one of claims 1-4 in the preparation of products containing thioneine.

10. A method for producing ergothioneine by fermentation, characterized in that, Fermenting the engineered bacteria according to any one of claims 1 to 4 in a culture medium, and separating ergothioneine from the fermentation product; The formula of the culture medium used for fermentation is: glucose 20g / L, magnesium sulfate heptahydrate 0.8g / L, diammonium hydrogen phosphate 4g / L, potassium dihydrogen phosphate 6.67g / L, potassium citrate 1.35g / L, 3-morpholinepropanesulfonic acid 20.9g / L, yeast powder 2.5g / L, ferrous sulfate heptahydrate 50mg / L, calcium chloride dihydrate 10mg / L, zinc sulfate heptahydrate 11mg / L, manganese sulfate tetrahydrate 2.5mg / L, copper sulfate pentahydrate 5mg / L, ammonium molybdate 0.5mg / L, sodium borate decahydrate 0.1mg / L, histidine 1g / L, cysteine ​​1.5g / L and methionine 5g / L.

Images