Application of decline-related protein in preparation of L-lysine
By regulating the expression of proteins encoded by specific genes, the problems of foam production and cell death during lysine production by microbial fermentation are solved, and the effect of improving L-lysine production and enhancing the acid production efficiency of bacteria is achieved.
Patent Information
- Application Number
- CN202311620424.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-30
- Publication Date
- 2025-05-30
AI Technical Summary
During the microbial fermentation and production of lysine, as lysine accumulates, toxic substances and proteins that promote cell death will be produced, resulting in bacterial autolysis and foam production, increasing production costs and reducing acid production efficiency.
By regulating the expression or activity of proteins encoded by NCgl1706, NCgl1707, NCgl2777, NCgl1050 and NCgl1051 genes, proteins that promote cell death are reduced or eliminated, thereby reducing foam production and increasing L-lysine production.
It effectively reduces foam production, reduces the use of defoaming agent, improves the acid production efficiency of bacteria, and significantly increases the production of L-lysine.
Smart Images

Figure SMS_12 
Figure SMS_13 
Figure SMS_14
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of cell apoptosis-related proteins in the preparation of L-lysine. Background Art
[0002] At present, the microbial fermentation method is the main method for producing lysine, which has the advantages of low raw material cost, mild reaction conditions and easy large-scale production. However, there is still great room for improvement in the fermentation performance and conversion rate of current lysine strains. During the process of producing lysine by microbial fermentation, with the accumulation of lysine, a large amount of toxic substances and proteins that promote cell apoptosis will be produced during the lysine fermentation process, leading to autolysis of the bacterial cells, and a large amount of foam will be generated during the fermentation process. This not only increases the usage amount of defoamers and raises the production cost, but also the large amount of foam will reduce the acid production of the bacterial cells. Therefore, how to eliminate or alleviate the stress inhibition caused by such toxic substances, proteins that promote cell apoptosis, and foam is the key to obtaining highly efficient lysine-producing strains.
[0003] Therefore, it is necessary to develop a strain that can reduce or eliminate the expression level of proteins that promote cell apoptosis during the fermentation process to produce high-yield L-lysine. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide a strain that can reduce or eliminate the expression level of proteins that promote cell apoptosis during the fermentation process to produce high-yield L-lysine. The technical problems to be solved are not limited to the described technical themes, and those skilled in the art can clearly understand other technical themes not mentioned herein through the following description.
[0005] To solve the above technical problems, the present invention provides the following technical solutions:
[0006] The present invention provides an application, which includes the application of a protein or a substance that regulates the expression of the protein-encoding gene or a substance that regulates the activity or content of the protein in the preparation of L-lysine or the improvement of L-lysine production, and the protein is any one of the following:
[0007] G1) including the protein encoded by the NCgl1706 gene and the protein encoded by the NCgl1707 gene;
[0008] G2) including the protein encoded by the NCgl2777 gene;
[0009] G3) including the protein encoded by the NCgl1050 gene and the protein encoded by the NCgl1051 gene;
[0010] G4) including the protein encoded by the NCgl1706 gene, the protein encoded by the NCgl1707 gene and the protein encoded by the NCgl2777 gene;
[0011] G5) includes the proteins encoded by the NCgl1706 gene, the proteins encoded by the NCgl1707 gene, the proteins encoded by the NCgl1050 gene, and the proteins encoded by the NCgl1051 gene;
[0012] G6) includes the proteins encoded by the NCgl1050 gene, the proteins encoded by the NCgl1051 gene, the proteins encoded by the NCgl2777 gene, the proteins encoded by the NCgl1706 gene, and the proteins encoded by the NCgl1707 gene;
[0013] G7) includes the proteins encoded by the NCgl1050 gene, the proteins encoded by the NCgl1051 gene, and the proteins encoded by the NCgl2777 gene;
[0014] Wherein,
[0015] A1) The protein encoded by the NCgl1050 gene includes any one of the following:
[0016] A1-1) A protein with an amino acid sequence of SEQ ID No. 4;
[0017] A1-2) A protein derived from A1-1) or having more than 80% identity with the protein shown in A1-1), which is obtained by substitution and / or deletion and / or addition of amino acid residues to the amino acid sequence shown in SEQ ID No. 4 and has the same function as the protein encoded by the NCgl1050 gene;
[0018] A1-3) A fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of A1-1) or A1-2);
[0019] A2) The protein encoded by the NCgl1051 gene includes any one of the following:
[0020] A2-1) A protein with an amino acid sequence of SEQ ID No. 5;
[0021] A2-2) A protein derived from A2-1) or having more than 80% identity with the protein shown in A2-1), which is obtained by substitution and / or deletion and / or addition of amino acid residues to the amino acid sequence shown in SEQ ID No. 5 and has the same function as the protein encoded by the NCgl1051 gene;
[0022] A2-3) A fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of A2-1) or A2-2);
[0023] The protein encoded by the NCgl2777 gene includes any one of the following:
[0024] A3-1) A protein with the amino acid sequence of SEQ ID No. 3;
[0025] A3-2) A protein derived from A3-1) or having an identity of more than 80% with the protein shown in A3-1), which is obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in SEQ ID No. 3 and has the same function as the protein encoded by the NCgl2777 gene;
[0026] A3-3) A fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of A3-1) or A3-2);
[0027] A4) The protein encoded by the NCgl1706 gene includes any one of the following:
[0028] A4-1) A protein with the amino acid sequence of SEQ ID No. 1;
[0029] A4-2) A protein derived from A4-1) or having an identity of more than 80% with the protein shown in A4-1), which is obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in SEQ ID No. 1 and has the same function as the protein encoded by the NCgl1706 gene;
[0030] A4-3) A fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of A4-1) or A4-2);
[0031] A5) The protein encoded by the NCgl1707 gene includes any one of the following:
[0032] A5-1) A protein with the amino acid sequence of SEQ ID No. 2;
[0033] A5-2) A protein derived from A5-1) or having an identity of more than 80% with the protein shown in A5-1), which is obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in SEQ ID No. 2 and has the same function as the protein encoded by the NCgl1707 gene;
[0034] A5-3) A fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of A5-1) or A5-2).
[0035] G1) The protein can be composed of two proteins, namely the protein encoded by the NCgl1706 gene and the protein encoded by the NCgl1707 gene;
[0036] G2) The protein may be the protein encoded by the NCgl2777 gene;
[0037] G3) The protein may be composed of two proteins, namely the protein encoded by the NCgl1050 gene and the protein encoded by the NCgl1051 gene;
[0038] G4) The protein may be composed of three proteins, namely the protein encoded by the NCgl2777 gene, the protein encoded by the NCgl1706 gene, and the protein encoded by the NCgl1707 gene;
[0039] G5) The protein may be composed of four proteins, namely the protein encoded by the NCgl1050 gene, the protein encoded by the NCgl1051 gene, the protein encoded by the NCgl1706 gene, and the protein encoded by the NCgl1707 gene;
[0040] G6) The protein may be composed of five proteins, namely the protein encoded by the NCgl1050 gene, the protein encoded by the NCgl1051 gene, the protein encoded by the NCgl2777 gene, the protein encoded by the NCgl1706 gene, and the protein encoded by the NCgl1707 gene;
[0041] G7) The protein may be composed of three proteins, namely the protein encoded by the NCgl1050 gene, the protein encoded by the NCgl1051 gene, and the protein encoded by the NCgl2777 gene;
[0042] In the present invention, the regulation may be up - regulation or enhancement or increase, or may be down - regulation or inhibition or decrease.
[0043] In some specific embodiments of the present invention, the regulation of the expression of the coding gene of the protein may specifically be to inhibit or reduce or down - regulate the expression of the coding gene. The inhibition or reduction or down - regulation of the expression of the coding gene can be achieved by gene knockout or gene silencing.
[0044] The so - called gene knockout refers to the phenomenon that a specific target gene is inactivated through homologous recombination. Gene knockout inactivates a specific target gene by changing the DNA sequence.
[0045] The so-called gene silencing refers to the phenomenon that a gene is not expressed or is expressed at a low level without damaging the original DNA. Gene silencing occurs on the premise of not changing the DNA sequence, resulting in the non-expression or low expression of a gene. Gene silencing can occur at two levels. One is transcriptional gene silencing caused by DNA methylation, heterochromatinization, and position effects, etc. The other is post-transcriptional gene silencing, that is, at the post-transcriptional level of a gene, the gene is inactivated by specifically inhibiting the target RNA, including antisense RNA, co-suppression, quelling, RNA interference (RNAi), and translation inhibition mediated by microRNA (miRNA), etc.
[0046] In the present invention, the substance can be a substance that performs at least one of the following 6 kinds of regulations: 1) regulation carried out at the transcriptional level of the gene; 2) regulation carried out after the transcription of the gene (that is, regulation carried out on the splicing or processing of the primary transcript of the gene); 3) regulation on the RNA transport of the gene (that is, regulation on the transport of the mRNA of the gene from the nucleus to the cytoplasm); 4) regulation on the translation of the gene; 5) regulation on the degradation of the mRNA of the gene; 6) post-translational regulation of the gene (that is, regulation on the activity of the protein translated from the gene).
[0047] When the regulation is inhibition or reduction or down-regulation, the substance can be a reagent for knocking out the protein-coding gene, such as a reagent for knocking out the protein-coding gene by homologous recombination, or a reagent for knocking out the protein-coding gene by the CRISPR-Cas system.
[0048] The reagent can be any of the following:
[0049] B1), a nucleic acid molecule that inhibits or reduces or down-regulates the expression of the protein-coding gene or a nucleic acid molecule that inhibits or reduces or down-regulates the activity or content of the protein; the nucleic acid molecule is a DNA molecule or an RNA molecule;
[0050] B2), the coding gene for expressing the RNA molecule described in B1);
[0051] B3), an expression cassette containing the gene described in B2);
[0052] B4), a recombinant vector containing the gene described in B2), or a recombinant vector containing the expression cassette described in B3);
[0053] B5), a recombinant microorganism containing the gene described in B2), or a recombinant microorganism containing the expression cassette described in B3), or a recombinant microorganism containing the recombinant vector described in B4).
[0054] The DNA molecule may be a nucleic acid molecule (such as circular DNA (such as a vector) or linear DNA) that knocks out the coding gene of the protein in the cell by homologous recombination.
[0055] The nucleotide sequence of the NCgl1050 gene contains the sequence of the NCgl1050 gene ORF (CDS) sequence (1203 bp), the nucleotide sequence of the NCgl1051 gene contains the sequence of the NCgl1051 gene ORF (CDS) sequence (540 bp), the nucleotide sequence of the NCgl2777 gene contains the sequence of the NCgl2777 gene ORF (CDS) sequence (1974 bp), the nucleotide sequence of the NCgl1706 gene contains the sequence of the NCgl1706 gene ORF (CDS) sequence (1524 bp), and the nucleotide sequence of the NCgl1707 gene contains the sequence of the NCgl1707 gene ORF (CDS) sequence (672 bp).
[0056] The present invention also provides a recombinant bacterium that does not contain or lacks the aforementioned protein.
[0057] Furthermore, the recombinant bacterium does not contain or lacks the coding gene of the aforementioned protein.
[0058] Furthermore, the recombinant bacterium includes bacteria. Specifically, the recombinant bacterium may be bacteria.
[0059] The recombinant bacterium can be obtained by knocking out or silencing the coding gene of the protein in the recipient bacterium, and the recipient bacterium contains the coding gene of the protein.
[0060] Furthermore, the recombinant bacterium includes Corynebacterium glutamicum. Specifically, the recombinant bacterium may be Corynebacterium glutamicum.
[0061] The application of the biological material related to the aforementioned protein in the preparation or improvement of glutamic acid, lysine, valine, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutaric acid, citric acid, ornithine, citrulline, preferably in the preparation of L-lysine or the improvement of L-lysine production, also belongs to the protection scope of the present invention.
[0062] The biological material is any one of the following:
[0063] B1), a nucleic acid molecule that inhibits or reduces or down-regulates the expression of the coding gene of the protein or a nucleic acid molecule that inhibits or reduces or down-regulates the activity or content of the protein; the nucleic acid molecule includes a DNA molecule or an RNA molecule;
[0064] B2), a coding gene expressing the RNA molecule described in B1);
[0065] B3), an expression cassette containing the gene described in B2);
[0066] B4), a recombinant vector containing the gene described in B2), or a recombinant vector containing the expression cassette described in B3);
[0067] B5), a recombinant microorganism containing the gene described in B2), or a recombinant microorganism containing the expression cassette described in B3), or a recombinant microorganism containing the recombinant vector described in B4).
[0068] The expression cassette in the above-mentioned biological material refers to a DNA that can express the protein described above in a host cell. The expression cassette may also include a single-stranded or double-stranded nucleic acid molecule containing all the regulatory sequences necessary for the nucleic acid molecule expressing any one of the above proteins. Under its compatible conditions, the regulatory sequences can direct the coding sequence to express any one of the above proteins in a suitable host cell. The regulatory sequences include, but are not limited to, leader sequences, polyadenylation sequences, propeptide sequences, promoters, signal sequences, and transcription terminators. At a minimum, the regulatory sequences should include a promoter and transcription and translation termination signals. To introduce specific restriction enzyme sites into the vector for ligating the regulatory sequences with the coding region of the nucleic acid sequence encoding the protein, regulatory sequences with linkers can be provided. The regulatory sequences can be suitable promoter sequences, i.e., nucleic acid sequences recognizable by the host cell expressing the nucleic acid sequence. The promoter sequence contains transcriptional regulatory sequences mediating protein expression. The promoter can be any nucleic acid sequence having transcriptional activity in the selected host cell, including mutant, truncated, and hybrid promoters, and can be derived from genes encoding extracellular or intracellular proteins homologous or heterologous to the host cell. The regulatory sequences can also be suitable transcription termination sequences, i.e., a sequence that can be recognized by the host cell to terminate transcription. The termination sequence is operably linked to the 3'-end of the nucleic acid sequence encoding the protein. Any terminator that can function in the selected host cell can be used in the present invention. The regulatory sequences can also be suitable leader sequences, i.e., the untranslated region of mRNA that is important for translation in the host cell. The leader sequence is operably linked to the 5'-end of the nucleic acid sequence encoding the protein. Any leader sequence that can function in the selected host cell can be used in the present invention. The regulatory sequences can also be signal peptide coding regions, which encode an amino acid sequence linked to the amino terminus of the protein and can direct the encoded protein into the cell secretion pathway. Signal peptide coding regions that can direct the expressed protein into the secretion pathway of the host cell used can be used in the present invention. It may also be necessary to add regulatory sequences that can regulate protein expression according to the growth of the host cell. Examples of regulatory systems are those that can respond to chemical or physical stimulants (including in the presence of regulatory compounds) to turn on or off gene expression. Other examples of regulatory sequences are those that can amplify genes. In these examples, the nucleic acid sequence encoding the protein should be operably linked to the regulatory sequences.
[0069] The recombinant vector may include a nucleic acid molecule encoding the above-mentioned protein, a promoter, and transcription and translation termination signals. When preparing the recombinant vector, the nucleic acid molecule encoding the above-mentioned protein can be positioned in the vector so as to be operably linked to appropriate expression control sequences. The recombinant vector can be any vector that facilitates recombinant DNA manipulation and expression of the nucleic acid sequence (such as a plasmid or a virus). The choice of vector usually depends on the compatibility of the vector with the host cell into which it will be introduced. The vector can be a linear or closed-loop plasmid. The vector can be an autonomously replicating vector (i.e., a complete structure existing outside the chromosome and capable of replicating independently of the chromosome), such as a plasmid, an episome, a minichromosome, or an artificial chromosome. The vector can contain any mechanism that ensures self-replication. Alternatively, the vector is a vector that, when introduced into the host cell, will integrate into the genome and replicate with the chromosome into which it has integrated. In addition, a single vector or plasmid can be used, or two or more vectors or plasmids that collectively contain all the DNA to be introduced into the host cell genome, or a transposon. The vector contains one or more selectable markers that facilitate the selection of transformed cells. A selectable marker is a gene whose product confers resistance to biocides or viruses, resistance to heavy metals, or prototrophy to auxotrophs, etc. Examples of bacterial selectable markers are the dal gene of Bacillus subtilis or Bacillus licheniformis, or resistance markers for antibiotics such as ampicillin, kanamycin, chloramphenicol, or tetracycline. The vector contains elements that enable the vector to be stably integrated into the host cell genome or ensure autonomous replication of the vector in the cell independently of the cell genome. In the case of autonomous replication, the vector can also contain an origin of replication that enables the vector to replicate autonomously in the target host cell. The origin of replication can carry a mutation that makes it temperature-sensitive in the host cell (see, for example, fEhrlich, 1978, Proceedings of the National Academy of Sciences of the United States of America 75: 1433). One or more copies of the nucleic acid molecule encoding any of the above-mentioned proteins of the present invention can be inserted into the host cell to increase the yield of the gene product. The increase in the copy number of the nucleic acid molecule can be achieved by inserting at least one additional copy of the nucleic acid molecule into the host cell genome or by inserting an amplifiable selectable marker together with the nucleic acid molecule, and by culturing the cells in the presence of a suitable selection reagent to select cells containing the amplified copy of the selectable marker gene and thus containing an additional copy of the nucleic acid molecule. The operations for ligating the above-mentioned elements to construct the recombinant expression vector of the present invention are well known to those skilled in the art (see, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989).
[0070] The term "operably linked" is defined herein as a conformation in which a regulatory sequence is in an appropriate position relative to the coding sequence of a DNA sequence such that the regulatory sequence directs the expression of the protein.
[0071] The present invention also provides a method for preparing a recombinant microorganism, comprising the following steps: down-regulating, reducing or inhibiting the expression level of a gene in a target microorganism, and / or down-regulating, reducing or inhibiting the expression level or activity of the protein encoded by the gene in the target microorganism, to obtain a recombinant microorganism; the gene includes the aforementioned NCgl1706 gene, NCgll707 gene, NCgl2777 gene, NCgl1050 gene and / or NCgll051 gene.
[0072] Specifically, the gene may be the NCgl1706 gene, NCgll707 gene, NCgl2777 gene, NCgl1050 gene and NCgll051 gene; the gene may be the NCgl2777 gene, the NCgl1706 gene and the NCgl1707 gene; the gene may also be the NCgl1050 gene, the NCgl1051 gene and the NCgl2777 gene; the gene may also be the NCgl1050 gene, the NCgl1051 gene, the NCgl1706 gene and the NCgl1707 gene; the gene may be the NCgl1706 gene and the NCgll707 gene; the gene may be the NCgl2777 gene; the gene may be the NCgl1050 gene and the NCgll051 gene;
[0073] Further, in the above method, the target microorganism includes Corynebacterium glutamicum. Specifically, the target microorganism may be Corynebacterium glutamicum.
[0074] The increase in L-lysine production may be an increase in the L-lysine production of bacteria.
[0075] The present invention also provides a whole-cell catalyst, and the whole-cell catalyst includes the aforementioned recombinant bacterium or the aforementioned biological material.
[0076] The present invention also provides a method for preparing L-lysine, comprising fermenting the aforementioned recombinant bacterium, biological material or whole-cell catalyst to prepare L-lysine.
[0077] The present invention proves through experiments that, compared with the target microorganism Corynebacterium glutamicum YP097158, the recombinant Corynebacterium glutamicum YPL-ΔNCgl1706-NCgll707-ΔNCgl2777-ΔNCgl1050-NCgll051 with the NCgl1050 gene, NCgl1051 gene, NCgl2777 gene, NCgl1706 gene and NCgl1707 gene knocked out, the recombinant Corynebacterium glutamicum YPL-ΔNCgl2777-ΔNCgl1050-NCgll051 with the NCgl1050 gene, NCgl1051 gene and NCgl2777 gene knocked out, the recombinant Corynebacterium glutamicum YPL-ΔNCg l1706-NCgll707-ΔNCgl1050-NCgll051 with the NCgl1050 gene, NCgl1051 gene, NCgl1706 gene and NCgl1707 gene knocked out, the recombinant Corynebacterium glutamicum YPL-ΔNCgl1050-NCgll051 with the NCgl1050 gene and NCgl1051 gene knocked out, the recombinant Corynebacterium glutamicum YPL-ΔNCgl1706-NCgll707-ΔNCgl2777 with the NCgl2777 gene, NCgl1706 gene and NCgl1707 gene knocked out, the recombinant Corynebacterium glutamicum YPL-ΔNCgl2777 with the NCgl2777 gene knocked out, and the recombinant Corynebacterium glutamicum YPL-ΔNC gl1706-NCgll707 with the NCgl1706 gene and NCgl1707 gene knocked out all have significantly increased L-lysine production. Description of the Drawings
[0078] Figure 1 Results of NCgl1706-NCgll707 RT-qPCR detection.
[0079] Figure 2 Results of NCgl2777 RT-qPCR detection.
[0080] Figure 3 Results of NCgl1050-NCgll051 RT-qPCR detection.
[0081] Figure 4 Results of NCgl1706-NCgll707-NCgl2777 RT-qPCR detection.
[0082] Figure 5 Results of NCgl1706-NCgll707-NCgl1050-NCgll051 RT-qPCR detection.
[0083] Figure 6Results of RT-qPCR for NCgl2777-NCgl1050-NCgll051.
[0084] Figure 7 Results of RT-qPCR for NCgl1706-NCgll707-NCgl2777-NCgl1050-NCgll051. Detailed implementation manners
[0085] The present invention will be further described in detail below in conjunction with the specific implementation manners. The examples given are only for clarifying the present invention, rather than limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.
[0086] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.
[0087] Wild-type Corynebacterium glutamicum ATCC13032 strain: a product of the American Type Culture Collection (ATCC).
[0088] Corynebacterium glutamicum YP097158 in the following examples is described in the Chinese patent document with the authorization number "CN110607313B" and the name "A recombinant strain for high-yield L-lysine and its construction method and application". The strain number is YP097158, which was deposited on August 16, 2016 at the General Microbiology Center of the China Microbial Culture Collection Management Committee, with the deposit number CGMCC No. 12856 and the deposit address at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. Hereinafter, it is simply referred to as Corynebacterium glutamicum CGMCC No. YP097158.
[0089] The following examples use GraphPad Prism 8 statistical software to process the data. The experimental results are expressed as mean ± standard deviation, and One-way ANOVA test is used. P < 0.05 (*) indicates significant difference.
[0090] In the following quantitative tests, three repeated experiments are set, and the results are averaged. The 2 -ΔΔCt method is used to analyze the qRT-PCR results and calculate the relative gene expression level.
[0091] Example 1: Construction of an engineered strain with deletion of NCgl1706 - NCgll707 genes on the genome
[0092] Based on the Corynebacterium glutamicum ATCC13032 sequence published by NCBI, the NCgl1706 - NCgll707 genes in the genome of Corynebacterium glutamicum YP097158 (derived from Corynebacterium glutamicum ATCC13032) were knocked out using the pk18mobsacB plasmid (confirmed by sequencing that the complete NCgl1706 - NCgll707 genes were retained on the chromosome of the YP097158 strain), in order to more deeply study the effects of these genes on L - lysine synthesis.
[0093] I. Construction of the knockout plasmid
[0094] According to the genomic sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the fragments at both ends of the NCgl1706 - NCgll707 genes were synthesized as upstream and downstream homologous arm fragments. The primer design is as follows (synthesized by Invitrogen, Shanghai):
[0095] P1:
[0096] P2: 5'-CTATTTTCAGGAACATTTACGTGTCGTGAGCGATAAAAAACAC-3';
[0097] P3: 5'-GTGTTTTTTATCGCTCACGACACGTAAATGTTCCTGAAAATAG-3';
[0098] P4:
[0099] Among the above primers, the underlined nucleotide sequences are homologous sequences on pK18, which are used to integrate the DNA fragment (upstream homologous arm - downstream homologous arm) into the pK18mobsacB plasmid (Addgene) by homologous recombination. P2 and P3 are used to ligate the upstream homologous arm and the downstream homologous arm by homologous recombination.
[0100] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed with primers P1 / P2, P3 / P4 and the high-fidelity DNA polymerase KAPA HiFi HotStart (purchased from Shanghai Huayasi Chuang Biotechnology Co., Ltd., KK2601) to obtain an upstream homologous arm fragment of 797 bp for knocking out the NCgl1706-NCgll707 gene (the sequence is shown as the 1st to 797th bases in the ΔNCgl1706-NCgll707 homologous DNA fragment sequence (1490 bp)) and a downstream homologous arm fragment of 693 bp (the sequence is shown as the 798th to 1490th bases in the ΔNCgl1706-NCgll707 homologous DNA fragment sequence (1490 bp)). The amplified products were electrophoresed and purified using a column DNA gel recovery kit. The two recovered DNA fragments were ligated with the pK18mobsacB plasmid (purchased from Addgene) purified after digestion with Xbal I / BamH I at 50 °C for 30 min using NEBuilder enzyme (purchased from NEB). The monoclonal colonies grown after transformation of the ligation products were identified by PCR with primers M13F (5′-TGTAAAACGACGGCCAGT-3′) / M13R (5′-CAGGAAACAGCTATGACC-3′) to obtain the positive knockout vector pK18-ΔNCgl1706-NCgll707, which contains a homologous DNA fragment of 1490 bp for knocking out the NCgl1706-NCgll707 gene (the sequence is shown as the ΔNCgl1706-NCgll707 homologous DNA fragment sequence (1490 bp)). This plasmid contains kanamycin resistance as a screening marker, and the plasmid was sent for sequencing.
[0101] PCR amplification system: 5×HiFi with Mg2+ Buffer 10 μL, dNTP Mixture (10 mM) 1.5 μL, primers (10 pM) 1.6 μL each, KAPA HiFi HotStart (1 U / μL) 0.5 μL, supplemented with ddH2O to a total volume of 50 μL.
[0102] PCR amplification program: Pre-denaturation at 95 °C for 5 min, (denaturation at 98 °C for 20 s; annealing at 60 °C for 15 s; extension at 72 °C for 30 s; 30 cycles), over-extension at 72 °C for 5 min.
[0103] II. Construction of knockout strains
[0104] The correctly sequenced knockout plasmid pK18-ΔNCgl1706-NCgll707 was electrotransformed into Corynebacterium glutamicum YP097158 and cultured according to the medium components and culture conditions shown in Table 1. The single colonies produced by the culture were identified by PCR using primers P1 / P4: Strains that could simultaneously amplify bands of 1490 bp and 3931 bp were positive strains, and strains that only amplified the 3931 bp band were the original bacteria. After culturing the positive strains on a 15% sucrose solid medium (shown in Table 1) for 30 h, monoclonal colonies were selected and screened on solid medium plates with and without kanamycin. Monoclonal strains that grew on the medium without kanamycin but did not grow on the medium with kanamycin were further identified by PCR using primers P1 / P4. Strains that could amplify a band of 1490 bp (shown as the ΔNCgl1706-NCgll707 homologous DNA fragment sequence (1490 bp)) were positive strains with the coding region of the NCgl1706-NCgll707 gene knocked out. The gene fragment of the positive strain (with the coding region of the NCgl1706-NCgll707 gene knocked out) was amplified again by primers P1 / P4 for sequencing, and the strain with correct sequencing was named YPL-ΔNCgl1706-NCgll707.
[0105] The recombinant bacterium YPL-ΔNCgl1706-NCgll707 is a recombinant Corynebacterium glutamicum obtained by replacing the 1,881,670th to 1,885,600th bases of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014) with the ΔNCgl1706-NCgll707 homologous DNA fragment sequence (1490 bp), while keeping other nucleotide sequences unchanged. That is, the coding regions of the NCgl1706 gene (the sequence is like the NCgl1706 gene ORF (CDS) sequence (1524 bp), encoding the amino acid sequence shown in SEQ ID No.1, which is the 1,882,467th to 1,883,990th of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) and the NCgl1707 gene (the sequence is the NCgll707 gene ORF (CDS) sequence (672 bp), encoding the amino acid sequence shown in SEQ ID No.2, which is the 1,884,217th to 1,884,888th of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) in the genome of Corynebacterium glutamicum YP097158 were knocked out, while keeping other nucleotides in the genome of Corynebacterium glutamicum YP097158 unchanged to obtain the recombinant bacterium.
[0106] Table 1 Composition and culture conditions of the medium
[0107] Component Formula Glucose 5 g / L Soybean meal extract 15 g / L Yeast powder 10 g / L Urea 3 g / L Sodium chloride 2.5 g / L <![CDATA[KH 2 PO 4 > 1 g / L Agar powder 18 g / L pH 7.0 Cultivation temperature 32℃ Cultivation time 30h
[0108] III. RT-qPCR Detection of Recombinant Strains
[0109] After culturing the recombinant strain YPL-ΔNCgl1706-NCgll707 and Corynebacterium glutamicum YP097158 for 24 h respectively, the cells were collected by centrifugation at 4°C. RNA was extracted using an RNA extraction kit (purchased from Takara, Code No.: 9108), and then reverse-transcribed into cDNA using a Premix reverse transcription kit (purchased from Takara, Code No.: RR036Q). The transcriptional levels of genes NCgl1706 and NCgll707 were detected using a qPCR kit (purchased from Takara, Code No.: RR42LR). The internal reference gene was selected as 16S RNA, and the primers were designed as follows:
[0110] NCgl1706-F: 5'-GACCGTGACCATCTCTACATC-3';
[0111] NCgl1706-R: 5'-TTCATTGCGTGACCACAC-3';
[0112] NCgl1707-F: 5'-TGTATCCGTAGTAATCCTGGC-3';
[0113] NCgl1707-R: 5'-GGGACGATGAATCCAAATG-3'.
[0114] It can be seen from Figure 1 that, compared with Corynebacterium glutamicum YP097158, the expression levels of genes NCgl1706 and NCgll707 in the recombinant strain YPL-ΔNCgl1706-NCgl l707 decreased significantly, indicating successful knockout.
[0115] Example 2: Construction of an Engineering Strain with Deletion of NCgl2777 Gene on the Genome
[0116] According to the sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, the NCgl2777 gene in the genome of L-lysine producing strain YP097158 (derived from Corynebacterium glutamicum ATCC13032) was knocked out using the pk18mobsacB plasmid (it was confirmed by sequencing that the complete NCgl2777 gene was retained on the chromosome of strain YP097158), so as to further study the influence of these genes on L-lysine synthesis.
[0117] 1. Construction of knockout plasmid
[0118] According to the genomic sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the fragments at both ends of the NCgl2777 gene were synthesized as upstream and downstream homologous arm fragments. The primer design is as follows (synthesized by Invitrogen, Shanghai):
[0119] P5:
[0120] P6: 5'-CAAAATGAGAAGGAAAACTTCCAATGAGAAGTTGATCAAC-3';
[0121] P7 5'-GTTGATCAACTTCTCATTGGAAGTTTTCCTTCTCATTTTG-3';
[0122] P8
[0123] Among the above primers, the underlined nucleotide sequences are homologous sequences on pK18, which are used to integrate the DNA fragment (upstream homologous arm - downstream homologous arm) into the pK18mobsacB plasmid (Addgene) by homologous recombination. P6 and P7 are used to ligate the upstream homologous arm and the downstream homologous arm by homologous recombination.
[0124] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was carried out with primers P5 / P6, P7 / P8 and high-fidelity DNA polymerase KAPA HiFi HotStart (purchased from Shanghai Huayasi Chuang Biotechnology Co., Ltd., KK2601) to obtain an upstream homologous arm fragment of 788 bp for knocking out the NCgl2777 gene (the sequence is shown as 1-788 in the ΔNCgl2777 homologous DNA fragment sequence (1480 bp)) and a downstream homologous arm fragment of 692 bp (the sequence is shown as 789-1480 in the ΔNCgl2777 homologous DNA fragment sequence (1480 bp)). Electrophoresis was performed on the amplified products and purified using a column DNA gel recovery kit. The two recovered DNA fragments were ligated with the pK18mobsacB plasmid (purchased from Addgene) purified after digestion with Xbal I / BamH I using NEBuilder enzyme (purchased from NEB) at 50 °C for 30 min. The monoclonal colonies grown after transformation of the ligation products were identified by PCR with primers M13F (5′-TGTAAAACGACGGCCAGT-3′) / M13R (5′-CAGGAAACAGCTATGACC-3′) to obtain the positive knockout vector pK18-ΔNCgl2777, which contains a homologous DNA fragment of 1480 bp for knocking out the NCgl2777 gene (the sequence is shown as the ΔNCgl2777 homologous DNA fragment sequence (1480 bp)). This plasmid contains kanamycin resistance as a selection marker, and the plasmid was sent for sequencing.
[0125] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10 μL, dNTP Mixture (10 mM) 1.5 μL, primers (10 pM) 1.6 μL each, KAPA HiFi HotStart (1 U / μL) 0.5 μL, supplemented with ddH 2 O to a total volume of 50 μL.
[0126] PCR amplification program: Pre-denaturation at 95 °C for 5 min, (denaturation at 98 °C for 20 s; annealing at 60 °C for 15 s; extension at 72 °C for 30 s; 30 cycles), over-extension at 72 °C for 5 min.
[0127] II. Construction of knockout strains
[0128] The correctly sequenced knockout plasmid pK18-ΔNCgl2777 was electrotransformed into Corynebacterium glutamicum YP097158 and cultured according to the culture medium components and culture conditions shown in Table 1. The single colonies produced by the culture were identified by PCR using primers P5 / P8: Strains that could simultaneously amplify bands of 1480 bp and 3201 bp were positive strains, and strains that only amplified the 3201 bp band were the original bacteria. After culturing the positive strains on a 15% sucrose solid medium (shown in Table 1) for 30 h, monoclonal colonies were selected and screened on solid medium plates with and without kanamycin. Monoclonal strains that grew on the medium without kanamycin but did not grow on the medium with kanamycin were further identified by PCR using primers P5 / P8. Strains that could amplify a band of 1480 bp (shown by the ΔNCgl2777 homologous DNA fragment sequence (1480 bp)) were positive strains with the coding region of the NCgl2777 gene knocked out. The gene fragment of the positive strain (with the coding region of the NCgl2777 gene knocked out) was amplified again by primers P5 / P8 for sequencing, and the strain with correct sequencing was named YPL-ΔNCgl2777.
[0129] The recombinant bacterium YPL-ΔNCgl2777 is a recombinant Corynebacterium glutamicum obtained by replacing the 3,071,113th to 3,074,313th bases of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014) with the ΔNCgl2777 homologous DNA fragment sequence (1480 bp), while keeping other nucleotide sequences unchanged. That is, the coding region of the NCgl2777 gene in the genome of Corynebacterium glutamicum YP097158 (the sequence is shown by the NCgl2777 gene ORF (CDS) sequence (1974 bp), encoding the amino acid sequence shown in SEQ ID No. 3, that is, the 3,071,901st to 3,073,621st positions of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) was knocked out, and other nucleotides in the genome of Corynebacterium glutamicum YP097158 were kept unchanged to obtain the recombinant bacterium.
[0130] III. RT-qPCR Detection of Recombinant Strains
[0131] After culturing the recombinant strain YPL-ΔNCgl2777 and Corynebacterium glutamicum YP097158 for 24 h respectively, the cells were collected by centrifugation at 4°C. RNA was extracted using an RNA extraction kit (purchased from Takara, Code No.: 9108), and reverse transcribed into cDNA using a Premix reverse transcription kit (purchased from Takara, Code No.: RR036Q). The transcriptional level of the gene NCgl2777 was detected using a qPCR kit (purchased from Takara, Code No.: RR42LR). The internal reference gene was 16S RNA, and the primers were designed as follows:
[0132] NCgl2777-F: 5'-CCTGAAATCTGGGCACTTG-3';
[0133] NCgl2777-R: 5'-TTAGAACGGAAACCCTTGTCC-3'.
[0134] It can be seen from Figure 2 that compared with Corynebacterium glutamicum YP097158, the expression level of the NCgl2777 gene in the recombinant strain YPL-ΔNCgl2777 decreased significantly, indicating that the NCgl2777 gene was successfully knocked out.
[0135] Example 3. Construction of an engineered strain with deletion of the NCgl1050-NCgll051 genes on the genome
[0136] Based on the sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, the NCgl1050-NCgll051 genes in the genome of the L-lysine producing strain YP097158 (derived from Corynebacterium glutamicum ATCC13032) were knocked out using the pk18mobsacB plasmid (it was confirmed by sequencing that the complete NCgl1050-NCgll051 genes were retained on the chromosome of the YP097158 strain), so as to more deeply study the effects of these genes on L-lysine synthesis.
[0137] I. Construction of the knockout plasmid
[0138] According to the genomic sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of primers for amplifying the fragments at both ends of the NCgl1050-NCgll051 genes were synthesized as the upstream and downstream homologous arm fragments. The primers were designed as follows (synthesized by Invitrogen, Shanghai):
[0139] P9:
[0140] P10: 5'-GATGTGAGGTAAGAAAACAGATGCGAAACCGGCGCCAAC-3';
[0141] P11: 5'-GTTGGCGCCGGTTTCGCATCTGTTTTCTTACCTCACATC-3';
[0142] P12:
[0143] Among the above primers, the underlined nucleotide sequences are homologous sequences on pK18, which are used to integrate the DNA fragment (upstream homologous arm - downstream homologous arm) into the pK18mobsacB plasmid (Addgene) by homologous recombination. P10 and P11 are used to ligate the upstream homologous arm and the downstream homologous arm by homologous recombination.
[0144] Construction method: Using the genome of Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was carried out with primers P9 / P10, P11 / P12 and the high-fidelity DNA polymerase KAPA HiFi HotStart (purchased from Shanghai Huayasi Chuang Biotechnology Co., Ltd., KK2601) to obtain an 834 bp upstream homologous arm fragment for knocking out the NCgl1050 - NCgll051 gene (the sequence is as shown in positions 1 - 834 of the ΔNCgl1050 - NCgll051 homologous DNA fragment sequence (1716 bp)) and an 882 bp downstream homologous arm fragment (the sequence is as shown in positions 835 - 1716 of the ΔNCgl1050 - NCgll051 homologous DNA fragment sequence (1716 bp)). The amplified products were electrophoresed and purified using a column DNA gel recovery kit. The two recovered DNA fragments and the pK18mobsacB plasmid (purchased from Addgene) purified after digestion with Xbal I / BamH I were ligated with NEBuilder enzyme (purchased from NEB) at 50°C for 30 min. The monoclonal colonies grown after transformation of the ligation products were identified by PCR with primers M13F (5′-TGTAAAACGACGGCCA GT-3′) / M13R (5′-CAGGAAACAGCTATGACC-3′) to obtain the positive knockout vector pK18-ΔNC gl1050-NCgll051, which contains a 1716 bp homologous DNA fragment for knocking out the NCgl1050 - NCgll051 gene (the sequence is as shown in the ΔNCgl1050 - NCgll051 homologous DNA fragment sequence (1716 bp)). This plasmid contains kanamycin resistance as a screening marker, and the plasmid was sent for sequencing.
[0145] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10 μL, dNTP Mixture (10 mM) 1.5 μL, primers (10 pM) 1.6 μL each, KAPA HiFi HotStart (1 U / μL) 0.5 μL, supplemented with ddH 2 O to a total volume of 50 μL.
[0146] PCR amplification program: Pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 60°C for 15 s; extension at 72°C for 30 s; 30 cycles), over-extension at 72°C for 5 min.
[0147] II. Construction of knockout strains
[0148] The correctly sequenced knockout plasmid pK18-ΔNCgl1050-NCgll051 was electrotransformed into Corynebacterium glutamicum YP097158 and cultured according to the medium components and culture conditions shown in Table 1. The single colonies generated from the culture were identified by PCR with primers P9 / P12: Strains that could simultaneously amplify bands of 1716 bp and 3391 bp were positive strains, and strains that only amplified the 3391 bp band were the original strains. After culturing the positive strains on a 15% sucrose solid medium (shown in Table 1) for 30 h, single colonies were selected and screened on solid medium plates containing kanamycin and without kanamycin. Monoclonal strains that grew on the medium without kanamycin but not on the medium with kanamycin were further identified by PCR with primers P9 / P12. Strains that could amplify a band of 1716 bp (shown as the sequence of the ΔNCgl1050-NCgll051 homologous DNA fragment sequence (1716 bp)) were positive strains with the coding region of the NCgl1050-NCgll051 gene knocked out. The gene fragment of the positive strain (knocking out the coding region of the NCgl1050-NCgll051 gene) was amplified again by primers P9 / P12 for sequencing, and the strain with correct sequencing was named YPL-ΔNCgl1050-NCgll051.
[0149] The recombinant bacterium YPL-ΔNCgl1050-NCgll051 is a recombinant Corynebacterium glutamicum obtained by replacing the 1,140,507th to 1,143,897th bases of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014) with the homologous DNA fragment sequence (1,716 bp) of ΔNCgl1050-NCgll051, while keeping other nucleotide sequences unchanged. That is, the coding regions of the NCgl1050 gene (the sequence is shown as the ORF (CDS) sequence of the NCgl1050 gene (1,203 bp), encoding the amino acid sequence shown in SEQ ID No. 4, i.e., the 1,141,341st to 1,142,475th positions of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) and the NCgl1051 gene (the sequence is shown as the ORF (CDS) sequence of the NCgl1051 gene (540 bp), encoding the amino acid sequence shown in SEQ ID No. 5, i.e., the 1,142,476th to 1,143,015th positions of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) in the genome of Corynebacterium glutamicum YP097158 were knocked out, and other nucleotides in the genome of Corynebacterium glutamicum YP097158 were kept unchanged to obtain the recombinant bacterium.
[0150] III. RT-qPCR Detection of Recombinant Strains
[0151] After culturing the recombinant bacterium YPL-ΔNCgl1050-NCgll051 and Corynebacterium glutamicum YP097158 for 24 h respectively, the cells were collected by centrifugation at 4°C. RNA was extracted using an RNA extraction kit (purchased from Takara, Code No.: 9108), and the RNA was reverse transcribed into cDNA using a Premix reverse transcription kit (purchased from Takara, Code No.: RR036Q). The transcriptional levels of the genes NCgl1050 and NCgll051 were detected using a qPCR kit (purchased from Takara, Code No.: RR42LR). The internal reference gene was selected as 16S RNA, and the primers were designed as follows:
[0152] NCgll050-F: 5'-ACACGGCACTGGGTATGTTC-3';
[0153] NCgll050-R: 5'-CGTTCGGATTCCTTGTAGATG-3';
[0154] NCgll051-F: 5'-CAGAACTTGGATTGCGTG-3';
[0155] NCgll051-R: 5'-GGGTGATTCCTTCAACAGC-3'.
[0156] From Figure 3 It can be seen that, compared with Corynebacterium glutamicum YP097158, the expression levels of NCgl1050 and NCgl1051 genes in the recombinant strain YPL-ΔNCgl1050-NCgl l051 decreased significantly, demonstrating that the NCgl1050 and NCgl1051 genes were successfully knocked out.
[0157] Example 4: Construction of an engineered strain with NCgl1706-NCgll707 and NCgl2777 genes deleted from the genome
[0158] According to the sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, the NCgl1706-NCgll707 genes and NCgl2777 genes in the genome of L-lysine producing strain YP097158 (derived from Corynebacterium glutamicum ATCC13032) were knocked out using the pk18mobsacB plasmid (it was confirmed by sequencing that the complete NCgl1706-NCgll707 genes and NCgl2777 genes were retained on the chromosome of YP097158 strain), so as to more deeply study the effects of these genes on L-lysine synthesis.
[0159] The correctly constructed knockout plasmid pK18-ΔNCgl2777 in Example 2 was electrotransformed into the recombinant strain YPL-ΔNCgl1706-NCgll707 constructed in Example 1, and cultured according to the culture medium components and culture conditions shown in Table 1. The single colonies produced by the culture were identified by PCR using primers P5 / P8: The strain that could simultaneously amplify bands of 1480bp and 3201bp was the positive strain, and the strain that only amplified the 3201bp band was the original strain. After culturing the positive strain on a 15% sucrose solid medium (shown in Table 1) for 30h, single colonies were selected and screened on solid medium plates containing kanamycin and without kanamycin. The monoclonal strain that grew on the medium without kanamycin but did not grow on the medium with kanamycin was further identified by PCR using primers P5 / P8. The strain that could amplify a band of 1480bp (shown by the sequence of the ΔNCgl2777 homologous DNA fragment sequence (1480bp)) was the positive strain with the NCgl2777 gene coding region knocked out. The gene fragment of the positive strain was amplified again by primers P5 / P8 for sequencing, and the strain with correct sequencing was named YPL-ΔNCgl1706-NCgll707-ΔNCgl2777.
[0160] The recombinant strain YPL-ΔNCgl1706-NCgll707-ΔNCgl2777 is obtained by replacing the 1,881,670th to 1,885,600th bases of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014) with the ΔNCgl1706-NCgll707 homologous DNA fragment sequence (1,490 bp), and replacing the 3,071,113th to 3,074,313th bases of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014) with the ΔNCgl2777 homologous DNA fragment sequence (1,480 bp), while keeping other nucleotide sequences unchanged, that is, knocking out the coding region of the NCgl1706 gene in the genome of Corynebacterium glutamicum YP097158 (the sequence is shown as the ORF (CDS) sequence of the NCgl1706 gene (1,524 bp), encoding the amino acid sequence shown in SEQ ID No.1, that is, the 1,882,467th to 1,883,990th of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)); knocking out the coding region of the NCgl1707 gene (the sequence is shown as the ORF (CDS) sequence of the NCgll707 gene (672 bp), encoding the amino acid sequence shown in SEQID No.2, that is, the 1,884,217th to 1,884,888th of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)); knocking out the coding region of the NCgl2777 gene (the sequence is shown as the ORF (CDS) sequence of the NCg l2777 gene (1,974 bp), encoding the amino acid sequence shown in SEQ ID No.3, that is, the 3,071,901st to 3,073,621st of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)), and keeping other nucleotides in the genome of Corynebacterium glutamicum YP097158 unchanged to obtain the recombinant strain.
[0161] III. RT-qPCR Detection of Recombinant Strains
[0162] After culturing the recombinant bacterium YPL-ΔNCgl1706-NCgll707-ΔNCgl2777 and Corynebacterium glutamicum YP097158 for 24 h respectively, the cells were collected by centrifugation at 4°C. RNA was extracted using an RNA extraction kit (purchased from Takara, Code No.: 9108), and the RNA was reverse-transcribed into cDNA using a Premix reverse transcription kit (purchased from Takara, Code No.: RR036Q). The transcriptional levels of the genes NCgl1706, NCgll707, and NCgl2777 were detected using a qPCR kit (purchased from Takara, Code No.: RR42LR). The internal reference gene was 16S RNA, and the primers were referred to Example 1 and Example 2.
[0163] It can be seen from Figure 4 that, compared with Corynebacterium glutamicum YP097158, the expression levels of the genes NCgl1706, NCgll707, and NCgl2777 in the recombinant bacterium YPL-ΔNCgl1706-NCgl l707-ΔNCgl2777 decreased significantly, proving that the genes NCgl1706, NCgll707, and NCgl2777 were successfully knocked out.
[0164] Example 5: Construction of an engineered strain with deletions of NCgl1706-NCgll707 and NCgl1050-NCgll051 genes on the genome
[0165] Based on the sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, the NCgl1706-NCgll707 genes and NCgl1050-NCgll051 genes in the genome of the L-lysine producing strain YP097158 (derived from Corynebacterium glutamicum ATCC13032) were knocked out using the pk18mobsacB plasmid (it was confirmed by sequencing that the complete NCgl1706-NCgll707 genes and NCgl1050-NCgll051 genes were retained on the chromosome of the YP097158 strain), so as to more deeply study the effects of these genes on the synthesis of L-lysine.
[0166] The correctly constructed knockout plasmid pK18-ΔNCgl1050-NCgll051 in Example 3 was electrotransformed into the recombinant bacterium YPL-ΔNCgl1706-NCgll707 constructed in Example 1, and cultured according to the culture medium components and culture conditions shown in Table 1. The single colonies produced by the culture were identified by PCR with primers P9 / P12: the strain that could simultaneously amplify bands of 1716 bp and 3391 bp was the positive strain, and the strain that only amplified the 3391 bp band was the original bacterium. After culturing the positive strain on a 15% sucrose solid medium (shown in Table 1) for 30 h, single colonies were selected and screened on solid medium plates containing kanamycin and without kanamycin. The monoclonal strain that grew on the medium without kanamycin but did not grow on the medium with kanamycin was further identified by PCR with primers P9 / P12. The strain that could amplify a band of 1716 bp (shown by the sequence of the ΔNCgl1050-NCgll051 homologous DNA fragment sequence (1716 bp)) was the positive strain with the coding region of the NCgl1050-NCgll051 gene knocked out. The gene fragment of the positive strain was amplified again by primers P9 / P12 for sequencing, and the strain with correct sequencing was named YPL-ΔNCgl1706-NCgll707-ΔNCgl1050-NCgll051.
[0167] The recombinant bacterium YPL-ΔNCgl1706-NCgll707-ΔNCgl1050-NCgll051 is obtained by replacing the 1,881,670th to 1,885,600th bases of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014) with the homologous DNA fragment sequence (1,490 bp) of ΔNCgl1706-NCgll707, and replacing the 1,140,507th to 1,143,897th bases of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014) with the homologous DNA fragment sequence (1,716 bp) of ΔNCgl1050-NCgll051, while keeping other nucleotide sequences unchanged. That is, the coding region of the NCgl1706 gene in the genome of Corynebacterium glutamicum YP097158 (the sequence is shown as the ORF (CDS) sequence (1,524 bp) of the NCgl1706 gene, encoding the amino acid sequence shown in SEQ ID No.1, i.e., the 1,882,467th to 1,883,990th of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) is knocked out; the coding region of the NCgl1707 gene (the sequence is shown as the ORF (CDS) sequence (672 bp) of the NCgll707 gene, encoding the amino acid sequence shown in SEQ ID No.2, i.e., the 1,884,217th to 1,884,888th of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) is knocked out; the coding region of the NCgl1050 gene (the sequence is shown as the ORF (CDS) sequence (1,203 bp) of the NCgl1050 gene, encoding the amino acid sequence shown in SEQ ID No.4, i.e., the 1,141,341st to 1,142,475th of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) is knocked out; the coding region of the NCgl1051 gene (the sequence is shown as the ORF (CDS) sequence (540 bp) of the NCgl1051 gene, encoding the amino acid sequence shown in SEQ ID No.5, i.e., the 1,142,476th to 1,143,015th of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) is knocked out, and other nucleotides in the genome of Corynebacterium glutamicum YP097158 are kept unchanged to obtain the recombinant bacterium.
[0168] III. RT-qPCR Detection of Recombinant Strains
[0169] The recombinant bacterium YPL-ΔNCgl1706-NCgll707-ΔNCgl1050-NCgll051 and Corynebacterium glutamicum YP097158 were cultured separately for 24 h, and then the cells were collected by centrifugation at 4°C. RNA was extracted using an RNA extraction kit (purchased from Takara, Code No.: 9108), and reverse transcribed into cDNA using a Premix reverse transcription kit (purchased from Takara, Code No.: RR036Q). The transcriptional levels of genes NCgl1706, NCgll707, NCgl1050, and NCgl1051 were detected using a qPCR kit (purchased from Takara, Code No.: RR42LR). The internal reference gene was 16S RNA, and the primers were referenced from Example 1 and Example 3.
[0170] As can be seen from Figure 5 , compared with Corynebacterium glutamicum YP097158, the expression levels of genes NCgl1706, NCgll707, NCgl1050, and NCgl1051 in the recombinant bacterium YPL-ΔNCgl1706-NCgl l707-ΔNCgl1050-NCgll051 decreased significantly, proving that the genes NCgl1706, NCgll707, NCgl1050, and NCgl1051 were successfully knocked out.
[0171] Example 6. Construction of an engineered strain with deletion of genes NCgl2777, NCgl1050-NCgll051 on the genome
[0172] Based on the sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, the NCgl2777 gene and the NCgl1050-NCgll051 gene in the genome of the L-lysine producing strain YP097158 (derived from Corynebacterium glutamicum ATCC13032) were knocked out using the pk18mobsacB plasmid (it was confirmed by sequencing that the complete NCgl2777 gene and NCgl1050-NCgll051 gene were retained on the chromosome of the YP097158 strain), so as to more deeply study the effects of these genes on the synthesis of L-lysine.
[0173] The correctly constructed knockout plasmid pK18-ΔNCgl1050-NCgll051 in Example 3 was electrotransformed into the recombinant bacterium YPL-ΔNCgl2777 constructed in Example 2, and cultured according to the culture medium components and culture conditions shown in Table 1. The single colonies produced by the culture were identified by PCR with primers P9 / P12: the strain that could simultaneously amplify bands of 1716 bp and 3391 bp was the positive strain, and the strain that only amplified the 3391 bp band was the original bacterium. After culturing the positive strain on a 15% sucrose solid medium (shown in Table 1) for 30 h, single colonies were selected and screened on solid medium plates containing kanamycin and without kanamycin. The monoclonal strain that grew on the medium without kanamycin but did not grow on the medium with kanamycin was further identified by PCR with primers P9 / P12. The strain that could amplify a band of 1716 bp (shown by the ΔNCgl1050-NCgll051 homologous DNA fragment sequence (1716 bp)) was the positive strain with the coding region of the NCgl1050-NCgll051 gene knocked out. The gene fragment of the positive strain was amplified again by primers P9 / P12 for sequencing, and the strain with correct sequencing was named YPL-ΔNCgl2777-ΔNCgl1050-NCgll051.
[0174] The recombinant strain YPL-ΔNCgl2777-ΔNCgl1050-NCgll051 is a recombinant Corynebacterium glutamicum obtained by replacing the 3,071,113th to 3,074,313th bases of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014) with the ΔNCgl2777 homologous DNA fragment sequence (1,480 bp), and replacing the 1,140,507th to 1,143,897th bases of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014) with the ΔNCgl1050-NCgll051 homologous DNA fragment sequence (1,716 bp), while keeping other nucleotide sequences unchanged. That is, the coding region of the NCgl2777 gene in the genome of Corynebacterium glutamicum YP097158 (the sequence is shown as the ORF (CDS) sequence of the NCgl2777 gene (1,974 bp), encoding the amino acid sequence shown in SEQ ID No. 3, that is, the 3,071,901st to 3,073,621st positions of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) was knocked out; the coding region of the NCgl1050 gene (the sequence is shown as the ORF (CDS) sequence of the NCgl1050 gene (1,203 bp), encoding the amino acid sequence shown in SEQ ID No. 4, that is, the 1,141,341st to 1,142,475th positions of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) was knocked out; the coding region of the NCgl1051 gene (the sequence is shown as the ORF (CDS) sequence of the NCg l1051 gene (540 bp), encoding the amino acid sequence shown in SEQ ID No. 5, that is, the 1,142,476th to 1,143,015th positions of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) was knocked out, and other nucleotides in the genome of Corynebacterium glutamicum YP097158 were kept unchanged to obtain the recombinant strain.
[0175] III. RT-qPCR Detection of Recombinant Strains
[0176] After culturing the recombinant bacterium YPL-ΔNCgl2777-ΔNCgl1050-NCgll051 and Corynebacterium glutamicum YP097158 for 24 h respectively, the cells were collected by centrifugation at 4°C. RNA was extracted using an RNA extraction kit (purchased from Takara, Code No.: 9108), and the RNA was reverse-transcribed into cDNA using a Premix reverse transcription kit (purchased from Takara, Code No.: RR036Q). The transcriptional levels of genes NCgl2777, NCgl1050, and NCgl1051 were detected using a qPCR kit (purchased from Takara, Code No.: RR42LR). The internal reference gene was 16S RNA, and the primers were referred to Example 2 and Example 3.
[0177] As can be seen from Figure 6 it, compared with Corynebacterium glutamicum YP097158, the expression levels of genes NCgl2777, NCgl1050, and NCgl1051 in the recombinant bacterium YPL-ΔNCgl2777-ΔNCgl1050-NCgll051 decreased significantly, proving that the genes NCgl2777, NCgl1050, and NCgl1051 were successfully knocked out.
[0178] Example 7. Construction of an engineered strain with deletion of genes NCgl1706-NCgll707, NCgl2777, and NCgl1050-NCgll051 on the genome
[0179] According to the sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, the genes NCgl1706-NCgll707, NCgl2777, and NCgl1050-NCgll051 in the genome of the L-lysine producing strain YP097158 (derived from Corynebacterium glutamicum ATCC13032) were knocked out using the pk18mobsacB plasmid (it was confirmed by sequencing that the complete genes NCgl1706-NCgll707, NCgl2777, and NCgl1050-NCgll051 were retained on the chromosome of the YP097158 strain), so as to study the effects of these genes on the synthesis of L-lysine more deeply.
[0180] The correctly constructed knockout plasmid pK18-ΔNCgl1050-NCgll051 in Example 3 was electrotransformed into the recombinant bacterium YPL-ΔNCgl1706-NCgll707-ΔNCgl2777 constructed in Example 4, and cultured according to the culture medium components and culture conditions shown in Table 1. The single colonies produced by the culture were identified by PCR with primers P9 / P12: the strain that could simultaneously amplify bands of 1716 bp and 3391 bp was the positive strain, and the strain that only amplified the 3391 bp band was the original bacterium. After culturing the positive strain on a 15% sucrose solid medium (shown in Table 1) for 30 h, single colonies were selected and screened on solid medium plates containing kanamycin and without kanamycin. The monoclonal strain that grew on the medium without kanamycin but did not grow on the medium with kanamycin was further identified by PCR with primers P9 / P12. The strain that could amplify a band of 1716 bp (shown by the sequence of the ΔNCgl1050-NCgll051 homologous DNA fragment sequence (1716 bp)) was the positive strain with the coding region of the NCgl1050-NCgll051 gene knocked out. The gene fragment of the positive strain was amplified again by primers P9 / P12 for sequencing, and the strain with correct sequencing was named YPL-ΔNCgl1706-NCgll707-ΔNCgl2777-ΔNCgl1050-NCgll051.
[0181] The recombinant bacterium YPL-ΔNCgl1706-NCgll707-NCgl2777-NCgl1050-NCgll051 is a recombinant Corynebacterium glutamicum obtained by replacing the 1,881,670th to 1,885,600th bases of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014) with the ΔNCgl1706-NCgll707 homologous DNA fragment sequence (1,490 bp), replacing the 3,071,113th to 3,074,313th bases of the ATC C13032 genome (GenBank: NC_03450, 22-DEC-2014) with the ΔNCgl2777 homologous DNA fragment sequence (1,480 bp), and replacing the 1,140,507th to 1,143,897th bases of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014) with the ΔNCgl1050-NCgll051 homologous DNA fragment sequence (1,716 bp), while keeping other nucleotide sequences unchanged. That is, the coding region of the NCgl1706 gene in the Corynebacterium glutamicum YP097158 genome (the sequence is shown as the ORF (CDS) sequence of the NCgl1706 gene (1,524 bp), encoding the amino acid sequence shown in SEQ ID No.1, that is, the 1,882,467th to 1,883,990th of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) was knocked out; the coding region of the NCgl1707 gene (the sequence is shown as the ORF (CDS) sequence of the NCgll707 gene (672 bp), encoding the amino acid sequence shown in SEQ IDNo.2, that is, the 1,884,217th to 1,884,888th of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) was knocked out; the coding region of the NCgl2777 gene (the sequence is shown as the ORF (CDS) sequence of the NCgl2777 gene (1,974 bp), encoding the amino acid sequence shown in SEQ ID No.3, that is, the 3,071,901st to 3,073,621st of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) was knocked out; the coding region of the NCgl1050 gene (the sequence is shown as the ORF (CDS) sequence of the NCgl1050 gene (1,203 bp), encoding the amino acid sequence shown in SEQ ID No.4, that is, the 1,141,341st to 1,142,475th of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014)) was knocked out; the coding region of the NCgl1051 gene (the sequence is shown as the ORF (CDS) sequence of the NCgl1051 gene (540 bp), encoding the amino acid sequence shown in SEQ IDNo.The amino acid sequence shown in Figure 5, i.e., positions 1142476 to 1143015 of the ATCC13032 genome (GenBank: NC_03450, 22-DEC-2014), was knocked out, and other nucleotides in the genome of Corynebacterium glutamicum YP097158 were kept unchanged to obtain the recombinant bacterium.
[0182] III. RT-qPCR Detection of Recombinant Strains
[0183] The recombinant bacterium YPL-ΔNCgl1706-NCgll707-NCgl2777-NCgl1050-NCgll051 and Corynebacterium glutamicum YP097158 were cultured for 24 h respectively, and the cells were collected by centrifugation at 4°C. RNA was extracted using an RNA extraction kit (purchased from Takara, CodeNo.: 9108), and the RNA was reverse transcribed into cDNA using a Premix reverse transcription kit (purchased from Takara, Code No.: RR036Q). The transcriptional levels of genes NCgl1706, NCgll707, NCgl2777, NCgl1050, and NCgll051 were detected using a qPCR kit (purchased from Takara, Code No.: RR42LR). The internal reference gene was selected as 16S RNA, and the primers were referred to in Examples 1-3.
[0184] From Figure 7 it can be seen that compared with Corynebacterium glutamicum YP097158, the expression levels of genes NCgl1706, NCgll707, NCgl2777, NCgl1050, and NCgl1051 in the recombinant bacterium YPL-ΔNCgl1706-NCgl l707-NCgl2777-NCgl1050-NCgll051 decreased significantly, proving that the genes NCgl1706, NCgll707, NCgl2777, NCgl1050, and NCgl1051 were successfully knocked out.
[0185] Example 8. L-Lysine Fermentation Experiment
[0186] The strains constructed in Examples 1-7 and the L-lysine producing bacterium YP097158 were used for fermentation experiments in a fermenter of model BLBIO-5GC-4-H (Shanghai Bailun Biotechnology Co., Ltd.) with the culture medium shown in Table 2 and the control process shown in Table 3. After fermentation, the L-lysine yield was detected by the ninhydrin colorimetric method, and each strain was repeated three times. The results are shown in Table 4.
[0187] Table 2 Fermentation Medium Formula (the rest is water)
[0188] Component Formula Hydrolyzed starch sugar 30 g / L Ammonium sulfate 12 g / L Magnesium sulfate 0.87 g / L Molasses 20 g / L Acidified corn steep liquor 3 mL / L Phosphoric acid 0.4 mL / L Potassium chloride 0.53 g / L Antifoaming agent (2% antifoam) 4 mL / L Ferrous sulfate 120 mg / L Manganese sulfate 120 mg / L Nicotinamide 42 mg / L Calcium pantothenate 6.3 mg / L Vitamin B1 6.3 mg / L Copper and zinc salt solution 0.6 g / L Biotin 0.88 mg / L
[0189] Table 3 Fermentation Control Process
[0190]
[0191]
[0192] Note: In the table, "F12h" means fermentation for 12 hours, "F12 - F32h" means fermentation for 12 - 32 hours, and "F32h" means fermentation for 32 hours.
[0193] Table 4 L-Lysine Yield and Significance Analysis
[0194]
[0195] The results are shown in Table 4. Deletion of the coding regions of the NCgl1706 - NCgl1707 genes, or deletion of the coding region of the NCgl2777 gene, or deletion of the coding regions of the NCgl1050 - NCgl1051 genes in Corynebacterium glutamicum all contribute to the increase in L-lysine yield.
[0196] NCgl1706 gene ORF (CDS) sequence (1524bp)
[0197]
[0198] NCgll707 gene ORF (CDS) sequence (672bp)
[0199] GTGACTAATACCAATAGAATTGAAGACCACTACCTCAAGGGCGGACGTGGCAGGGGCACAGACGATCCTAGCAATATGCAAATTGCAGGAAGTATGTTGCGCACATTATTCGTCCGCAAGATTAGAGCGCTGCTGCTGGTTTTGATGATTGCGCCAACTCCATTGGTCGAAGGGCTAACTTCGACTGCAATGATTGTATCCGTAGTAATCCTGGCGATCTACATGGCGATAACAATGTATAGAGTAGTGCACGGTCGCCATGAGTTCGCGCATATCGCACGTCGCATGGCGCTTTACGTCAACAAGACTTCTTCTAGGTTCAGTGTTGTTATTGCTTATGTAGTATTAATTGCTATTTATGCGCTACTAATTCCCGGACTTGTCTACTCTGTTACATTTGGATTCATCGTCCCAAGCACACCTAATACGTTTAGTGATGCACCTGCATGGATTATGTGCGTATCGCTGCTGCTCATTGCAGTCGCCAGTTTCATCACATCAATCATGGATGACTTTATTGATGGCATACTCACTGATTTTTATGACGAAGATAATGCTGATAGCCCCGATAGTCCTGCCGAGGATATAGCCACCCGTCCTGTCGAGAGCGCAACAACAAGTGCTCTTGCTGGATTTGCTGTTGGTTATATTTGTGGGCGCTTTAATCGCTAA
[0200] ΔNCgl1706 - NCgll707 homologous DNA fragment sequence (1490bp)
[0201]
[0202] NCgl2777 gene ORF (CDS) sequence (1974bp)
[0203]
[0204] ΔNCgl2777 homologous DNA fragment sequence (1480bp)
[0205]
[0206] NCgl1050 gene ORF (CDS) sequence (1203bp)
[0207]
[0208] NCgl1051 gene ORF (CDS) sequence (540bp)
[0209] ATGACTGATCTTCATCCCGTAAAGCAGGAAATTTTCAACACTGCTGAATCCATAAACACAGATCCCAAGGGGTTTCTCCGCGAGGTAGACACCTTCAAAGTAACCGACTTCGGCCTGTACATGGCTCGTGGTGCAAACCACCCCAAGTTCGGATACTTGGAAAGCTGGCTCCTCCCAGAACTTGGATTGCGTGCCAACATTTTCCACTTCCGCAAAGGCGTGGATGAACGTCAGGATTACTACATCGATGTCGCTGAAATTCGCGTCGAAGACAACATCTGGACCACCCGCGACCTCTACGTGGATCTCATCTCTGTCTGCGGAGAACCAGTAACAGTCATGGACATCGACGAACTAGCTGCAGCAACCTCAGCAGGGCTTATCACTGCAGATGACGCTGAGCGCGCAATTGATGCCACCTTGAATGCTGTTGAAGGAATCACCCGCCACGGCGACGATCCTATGCAGTGGCTGCGCTCCAAGGGAATCGAACTCACCTGGGCTGACGCCAGCCAGGTAGAGCTCGTCCCTGCAGAGTAA
[0210] ΔNCgl1050 - NCgll051 homologous DNA fragment sequence (1716bp)
[0211]
[0212] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modifications, uses or improvements of the present invention, including those that depart from the scope disclosed in this application and are made by conventional techniques known in the art.
Claims
1. Application Characterized in that the application includes the application of a protein or a substance that regulates the expression of the gene encoding the protein or a substance that regulates the activity or content of the protein in the preparation of L-lysine or increasing the yield of L-lysine, and the protein is any one of the following: G1) including the protein encoded by the NCgl1706 gene and the protein encoded by the NCgl1707 gene; G2) including the protein encoded by the NCgl2777 gene; G3) including the protein encoded by the NCgl1050 gene and the protein encoded by the NCgl1051 gene; G4) including the protein encoded by the NCgl1706 gene, the protein encoded by the NCgl1707 gene and the protein encoded by the NCgl2777 gene; G5) including the protein encoded by the NCgl1706 gene, the protein encoded by the NCgl1707 gene, the protein encoded by the NCgl1050 gene and the protein encoded by the NCgl1051 gene; G6) including the protein encoded by the NCgl1050 gene, the protein encoded by the NCgl1051 gene, the protein encoded by the NCgl2777 gene, the protein encoded by the NCgl1706 gene and the protein encoded by the NCgl1707 gene; G7) including the protein encoded by the NCgl1050 gene, the protein encoded by the NCgl1051 gene and the protein encoded by the NCgl2777 gene; wherein A1) the protein encoded by the NCgl1050 gene includes any one of the following: A1-1) a protein with an amino acid sequence of SEQ ID No. 4; A1-2) a protein derived from A1-1) or having more than 80% identity with the protein shown in A1-1) obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in SEQ ID No. 4 and having the same function as the protein encoded by the NCgl1050 gene; A1-3) a fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of A1-1) or A1-2); A2) the protein encoded by the NCgl1051 gene includes any one of the following: A2-1) a protein with an amino acid sequence of SEQ ID No. 5; A2-2) a protein derived from A2-1) or having more than 80% identity with the protein shown in A2-1) obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in SEQ ID No. 5 and having the same function as the protein encoded by the NCgl1051 gene; A2-3) a fusion protein with the same function obtained by connecting a tag to the N-terminus and / or C-terminus of A2-1) or A2-2); A3) the protein encoded by the NCgl2777 gene includes any one of the following: A3-1) a protein with an amino acid sequence of SEQ ID No. 3; A3-2) A protein derived from A3-1) or having an identity of more than 80% with the protein shown in A3-1), which is obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in SEQ ID No. 3 and has the same function as the protein encoded by the NCgl2777 gene; A3-3) A fusion protein having the same function, which is obtained by linking a tag to the N-terminus and / or C-terminus of A3-1) or A3-2); A4) The protein encoded by the NCgl1706 gene includes any of the following: A4-1) A protein having the amino acid sequence of SEQ ID No. 1; A4-2) A protein derived from A4-1) or having an identity of more than 80% with the protein shown in A4-1), which is obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in SEQ ID No. 1 and has the same function as the protein encoded by the NCgl1706 gene; A4-3) A fusion protein having the same function, which is obtained by linking a tag to the N-terminus and / or C-terminus of A4-1) or A4-2); A5) The protein encoded by the NCgl1707 gene includes any of the following: A5-1) A protein having the amino acid sequence of SEQ ID No. 2; A5-2) A protein derived from A5-1) or having an identity of more than 80% with the protein shown in A5-1), which is obtained by substituting and / or deleting and / or adding amino acid residues to the amino acid sequence shown in SEQ ID No. 2 and has the same function as the protein encoded by the NCgl1707 gene; A5-3) A fusion protein having the same function, which is obtained by linking a tag to the N-terminus and / or C-terminus of A5-1) or A5-2).
2. The application according to claim 1, wherein, the regulation is inhibition or reduction or down-regulation.
3. The application according to claim 2, wherein, the substance includes a reagent for knocking out the protein-coding gene.
4. A recombinant bacterium, wherein, the recombinant bacterium does not contain or lacks the protein described in claim 1.
5. The recombinant bacterium according to claim 4, wherein, the recombinant bacterium does not contain or lacks the coding gene of the protein described in claim 1.
6. The recombinant bacterium according to any one of claims 4-5, wherein, the recombinant bacterium includes bacteria.
7. The recombinant bacterium according to any one of claims 4-6, wherein, the recombinant bacterium includes Corynebacterium glutamicum.
8. The application of a biological material related to the protein described in claim 1 or 2 in the preparation of L-lysine or the improvement of L-lysine production, wherein, the biological material is any of the following: B1) A nucleic acid molecule that inhibits or reduces or down-regulates the expression of the protein-coding gene or a nucleic acid molecule that inhibits or reduces or down-regulates the activity or content of the protein; the nucleic acid molecule includes a DNA molecule or an RNA molecule, B2) A coding gene that expresses the RNA molecule described in B1); B3), an expression cassette containing the gene described in B2); B4), a recombinant vector containing the gene described in B2), or a recombinant vector containing the expression cassette described in B3); B5), a recombinant microorganism containing the gene described in B2), or a recombinant microorganism containing the expression cassette described in B3), or a recombinant microorganism containing the recombinant vector described in B4).
9. A whole-cell catalyst, characterized in that, the whole-cell catalyst comprises the recombinant bacterium according to any one of claims 4-7 or the biological material according to claim 8.
10. A method for preparing L-lysine, comprising fermenting to prepare L-lysine by using the recombinant bacterium according to any one of claims 4-7 or the biological material according to claim 8 or the whole-cell catalyst according to claim 9.
Citation Information
Patent Citations
A recombinant strain producing high levels of L-lysine, its construction method, and its applications.
CN110607313B
Cited By
Microorganism with enhanced l-branched-chain amino acid producing ability and method for producing l-branched-chain amino acid using same
US20230063145A1