Monoclonal antibody for resisting rift valley fever virus Gn protein and application of monoclonal antibody in virus detection
By developing a dual-antibody sandwich ELISA method based on high binding activity monoclonal antibodies A1 and C1, the problem of difficult to achieve fast, simple and high specific early diagnosis of rift valley fever virus infection in the prior art is solved, and high sensitivity detection of rift valley fever virus Gn antigen is achieved.
Patent Information
- Application Number
- CN202510556661.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-29
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2045-04-29
AI Technical Summary
The prior art is difficult to achieve rapid, simple and highly specific early diagnosis of rift valley fever virus infection, especially in scenarios where nucleic acid detection methods with high equipment and personnel requirements cannot be met.
A diabodyne sandwich ELISA method based on high binding activity monoclonal antibodies A1 and C1 was developed to detect Rift Valley Thermal Virus Gn antigen. This method achieves high sensitivity detection of rift valley heat virus Gn antigen by specifically binding antibodies A1 and C1.
The specific detection of Rift Valley Fever Virus Gn antigen is achieved, with high sensitivity and specificity, and can provide a fast and easy solution in the early diagnosis of Rift Valley Fever Virus infection.
Smart Images

Figure CN120058919A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to a monoclonal antibody against Rift Valley fever virus Gn protein and its application in virus detection. Background Art
[0002] Rift Valley fever is a zoonotic mosquito-borne infectious disease. Clinically, Rift Valley fever is manifested as fever, headache, and muscle and joint pain. Severe cases can involve multiple organs and have a high fatality rate. Currently, there are no marketed human vaccines or specific therapeutic drugs.
[0003] The pathogen of Rift Valley fever is Rift Valley fever virus (RVFV). The RVFV genome is a single-stranded negative-sense RNA virus, which consists of three segments, namely L, M, and S. The L segment encodes RNA polymerase. The M segment encodes envelope glycoproteins Gn and Gc. Gn is mainly responsible for the binding of the virus to host cells, while Gc plays a key role in membrane fusion. After the virus enters the body, it first replicates in the invaded local tissues, transfers to local lymph nodes through the lymphatic system for further replication, and then enters the bloodstream to form viremia, which generally lasts for 4-7 days. Subsequently, symptoms of infection and intoxication such as fever may appear, and focal infections in multiple organs can be caused.
[0004] Currently, laboratory diagnostic methods for virus infection mainly include virus isolation, nucleic acid detection, antigen detection, and serological detection, etc. Among them, virus isolation is the gold standard for virus infection diagnosis, but this method has high requirements for laboratory conditions and requires a long time for cultivation. Although the virus nucleic acid detection method is more sensitive and rapid than the traditional virus isolation and culture method, it has high requirements for equipment and personnel. Serum IgM detection starts to appear 5-6 days after virus infection, and IgG appears 14 days after virus infection, so rapid detection cannot be achieved. It is imperative to establish a simple and easy-to-implement diagnostic reagent that can specifically detect early Rift Valley fever virus infection, which is of significance for the rapid detection of suspected infected people.
[0005] The Gn protein of Rift Valley fever virus is a relatively conserved envelope glycoprotein, which is mainly highly expressed in infected cells, has strong antigenicity, and exists in the early peripheral blood of virus-infected patients or animals. Therefore, detecting Gn antigen in the serum of acute-phase patients can be used for the early diagnosis of Rift Valley fever virus infection.
[0006] The Gn protein of Rift Valley fever virus is encoded by the M gene of Rift Valley fever virus and mediates the receptor recognition process of the virus. The Gn protein is a type I transmembrane protein and is anchored to the membrane surface of the virus particle through a helical structure at the C-terminus. The extracellular region of the Gn protein can be divided into a head region (154-469 aa) and a stem region (470-582 aa). Research reports show that the neutralizing epitopes of the Gn protein are mainly concentrated in the head region, and the head region is composed of three regions, namely domain I, domain II, and domain III. Currently, the main binding regions of known Rift Valley fever virus neutralizing antibodies are domain I and domain III.
[0007] The methods for detecting viruses by antigen capture ELISA can be divided into two categories. One category uses polyclonal antibodies as capture antibodies or detection antibodies. There are significant differences in these methods among different batches of antiserum, making it difficult to repeat and achieve laboratory standardization. The other category uses monoclonal antibodies to detect viruses. Currently, there is no commercial kit for detecting Rift Valley fever virus using monoclonal antibodies against Gn.
[0008] The invention application with the publication number CN114409770A discloses a human monoclonal antibody against Rift Valley fever virus and its application, which discloses 8 human monoclonal antibodies that can effectively treat mice infected with RVFV and prevent the infection of mice by RVFV. However, when used for treatment, it is not disclosed that it can be used for ELISA detection. Summary of the Invention
[0009] The present invention provides a double-antibody sandwich ELISA method for detecting Rift Valley fever virus Gn antigen based on two highly binding monoclonal antibodies A1 and C1. In the kit of the present invention, monoclonal antibody A1 and monoclonal antibody C1 are both immunoglobulins of the human IgG1 subclass, and both monoclonal antibodies can specifically bind to Rift Valley fever virus Gn antigen. The monoclonal antibodies are obtained by immunizing rhesus monkeys with an adenovirus vector Rift Valley fever candidate vaccine and recombinant Gn antigen, screening for the variable region genes of highly binding monoclonal antibodies from peripheral blood using flow sorting-single cell PCR technology, and obtaining two recombinant monoclonal antibodies A1 and C1 of the human IgG1 subclass through genetic engineering technology.
[0010] The present invention first provides monoclonal antibodies against the Gn protein of Rift Valley fever virus, which are monoclonal antibody A1 and / or monoclonal antibody C1. Among them, the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the heavy chain variable region of monoclonal antibody A1 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-115 of the sequence shown in SEQ ID NO:1; the amino acid sequences of the CDR1, CDR2, and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-37, 55-57, and 94-102 of the sequence shown in SEQ ID NO:2. The amino acid sequences of CDR1, CDR2 and CDR3 regions of the heavy chain variable region of monoclonal antibody C1 are shown as the amino acid sequences at positions 26 - 33, 51 - 58, and 97 - 101 of the sequence shown in SEQ ID NO:3; the amino acid sequences of CDR1, CDR2 and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27 - 38, 56 - 58, and 95 - 103 of the sequence shown in SEQ ID NO:4.
[0011] Among them, monoclonal antibody A1 and / or monoclonal antibody C1 refers to one or a combination of both of monoclonal antibody A1 and monoclonal antibody C1.
[0012] Preferably, the amino acid sequence of the heavy chain of monoclonal antibody A1 is shown in SEQ ID NO:1, and the amino acid sequence of the light chain is shown in SEQ ID NO:2.
[0013] Preferably, the amino acid sequence of the heavy chain of monoclonal antibody C1 is shown in SEQ ID NO:3, and the amino acid sequence of the light chain is shown in SEQ ID NO:4.
[0014] The present invention also provides a coding gene encoding the monoclonal antibody against the Gn protein of Rift Valley fever virus. The gene sequence encoding the heavy chain of monoclonal antibody A1 is shown in SEQ ID NO:5, and the gene sequence encoding the light chain of monoclonal antibody A1 is shown in SEQ ID NO:6; The gene sequence encoding the heavy chain of monoclonal antibody C1 is shown in SEQ ID NO:7, and the gene sequence encoding the light chain of monoclonal antibody C1 is shown in SEQ ID NO:8.
[0015] The present invention also provides the application of the monoclonal antibody against the Gn protein of Rift Valley fever virus in the preparation of a detection kit for detecting the Gn antigen of Rift Valley fever virus.
[0016] The present invention also provides a detection kit for detecting the Gn antigen of Rift Valley fever virus, including the monoclonal antibody against the Gn protein of Rift Valley fever virus. When the monoclonal antibody is one of monoclonal antibody A1 or monoclonal antibody C1, detection methods such as Western Blotting can be directly used for detection, or a secondary antibody that specifically binds to the constant region of the antibody can be additionally used for detection methods such as ELISA. When the monoclonal antibody is a combination of monoclonal antibody A1 and monoclonal antibody C1, a double - antibody sandwich ELISA detection method can be used for detection.
[0017] Preferably, the detection kit is a double - antibody sandwich ELISA detection kit, where monoclonal antibody A1 and monoclonal antibody C1 are used. One of monoclonal antibody A1 and monoclonal antibody C1 serves as a capture antibody, and the other serves as a detection antibody, and the detection antibody is labeled.
[0018] The capture antibody is used to bind to the antigen to capture the antigen to be detected; the detection antibody is used to capture the antigen with the capture antigen, and then bind to the antigen and detect it by color development or fluorescence. Monoclonal antibody A1 can be used as the capture antibody and monoclonal antibody C1 as the detection antibody, or vice versa.
[0019] Preferably, the marker used to label the monoclonal antibody in the detection antibody is peroxidase, phosphatase or luciferase.
[0020] More preferably, the peroxidase is horseradish peroxidase.
[0021] The present invention also provides the use of the detection kit in detecting Rift Valley fever virus Gn antigen for non-diagnostic purposes.
[0022] The present invention also provides a double antibody sandwich ELISA detection method for detecting Rift Valley fever virus Gn antigen for non-diagnostic purposes, using the detection kit, the double antibody sandwich ELISA detection method comprises the following steps: S1, coating the ELISA plate with capture antibody; S2, blocking with blocking solution; S3, discard the blocking solution, wash with buffer, then add the sample to be tested and incubate; S4, wash with buffer, then add detection antibody and incubate; S5, color development and detection.
[0023] Preferably, the double antibody sandwich ELISA detection method comprises the following steps: (1) Coating: Monoclonal antibody A1 was diluted to 2 μg / mL with coating buffer and then coated on the ELISA plate at 100 μL / well at 4°C overnight. (2) Blocking: Wash the plate 4 times with PBST, add 5% skim milk powder prepared in PBS, 100 μL / well, and block at 37°C for 2 h. (3) Sample addition: discard the blocking solution, wash the plate four times with PBST, add the sample to be tested, and incubate at 37°C for 60 min; (4) Add enzyme-labeled antibody: Wash the plate four times with PBST, add horseradish peroxidase-labeled monoclonal antibody C1 (0.5 μg / mL) diluted in 1% BSA, 100 μL / well, and react at 37°C for 60 min. (5) Color development: Wash the plate four times with PBST, add single-component TMB color development solution, 100 µL / well, and develop at 37°C in the dark for 10 min. (6) Termination: Add 2 MH 2 SO 4Terminate the reaction, 50 µL / well; (7)Reading: Measure OD with an ELISA reader 450-630nm .
[0024] Result judgment criterion: Use the ratio of the OD 450-630nm (S) of the sample to be tested and the OD 450-630nm (N) of the negative control as the criterion for judging positive. When S / N ≥ 2.1, it is judged as positive, that is, the sample to be tested contains Rift Valley fever virus; otherwise, it is judged as negative, that is, the sample to be tested does not contain Rift Valley fever virus.
[0025] The capture antibody A1 and detection antibody C1 described in the present invention are screened from a group of monoclonal antibodies against the Gn protein of Rift Valley fever virus, can specifically bind to Rift Valley fever virus, have no cross-reaction with other viruses of the Bunyaviridae family such as severe fever with thrombocytopenia syndrome virus, and have a high sensitivity to Rift Valley fever virus, which is beneficial to the early diagnosis of Rift Valley fever virus. At the same time, the monoclonal antibody sequences in this method are clear, can be obtained through large-scale fermentation, do not require animal breeding and ascites extraction processes, and have low costs.
[0026] Compared with the prior art, the present invention has the following advantages and beneficial effects: The present invention provides a double-antibody sandwich ELISA detection kit for detecting the Gn antigen of Rift Valley fever virus. When using this kit for double-antibody sandwich ELISA detection, it can specifically detect the Gn antigen of Rift Valley fever virus, has no cross-reaction with the Gn antigens of other viruses of the Bunyaviridae family such as severe fever with thrombocytopenia syndrome virus, the monoclonal antibody sequences are clear, the monoclonal antibodies used can be prepared by large-scale culture, have high sensitivity, and the detection limit is 781 pg / mL. Description of the Drawings
[0027] Figure 1 It is the SDS-PAGE result of the truncated RVFV-Gn protein.
[0028] Figure 2 It is the SDS-PAGE result of the RVFV-Gn specific binding antibodies A1 and C1.
[0029] Figure 3 It is the ELISA result curve (EC 50 measurement) of the specific binding activity of A1 and C1 to RVFV-Gn.
[0030] Figure 4 It is the ELISA result curve of the A1-C1 antibody pair for detecting the RVFV-Gn protein.
[0031] Figure 5ELISA binding diagrams of two monoclonal antibodies with recombinant Rift Valley fever virus Gn antigen (RVFV-Gn) and severe fever with thrombocytopenia syndrome virus Gn antigen (SFTSV-Gn), respectively.
[0032] Figure 6 Detection calibration curves of the two antibodies at their optimal concentrations in the present invention. Detailed implementation manners
[0033] Example 1: Obtaining of truncated RVFV-Gn protein In this study, the head region (154-469aa) of the Gn protein was intercepted for eukaryotic expression and purification, laying a foundation for subsequent booster immunization of rhesus monkeys, sorting of Gn protein-specific memory B cells, and screening of Gn protein-binding antibodies.
[0034] The open reading frame (MORF) corresponding to the M gene (GenBank: DQ380208.1) of Rift Valley fever virus MP-12 strain was codon-synthesized by Shanghai Sangon Biotech Co., Ltd., and primers were designed based on this as a template to amplify the gene of truncated Gn protein. At the same time, the tPA signal peptide (ATGGACGCCATGAAGCGGGGCCTCTGCTGTGTTCTGCTGCTCTGCGGCGCCGTGTTCGTGAGTAACTCG) and Strep II tag (TTACTTTTCGAACTGCGGGTGGCTCCAGGCAGATCCTCCAGATCCTCCTCCAGATCCTCCTCCCTTTTCGAACTGCGGGTGGCTCCAAGCGGA) were respectively added to the N-terminus and C-terminus of the truncated Gn protein by PCR. Restriction enzyme cleavage sites Eco R I and Not I and the homologous arms of the pCAGGs vector were added at both ends of the upstream and downstream primers, and then the target gene was ligated to the linear pCAGGs vector digested with double enzymes ( Eco R I and Not I) by homologous recombination method. After obtaining the recombinant plasmid containing the truncated Gn protein, it was transfected into Expi293F cells, and the truncated Gn protein was purified using an affinity chromatography column (Strep Trap XT). Its expression and purity were identified by SDS-PAGE. The purified Gn protein is as Figure 1 shown, with a size of about 40 kDa.
[0035] Example 2: Obtaining of monoclonal antibodies binding to RVFV-Gn protein Obtaining of RVFV-Gn-binding monoclonal antibodies: First, a recombinant human adenovirus type 4 expressing RVFV-Gn protein was constructed. The specific method was as follows: The open reading frame (MORF) of the M gene of Rift Valley fever virus MP-12 strain (GenBank: DQ380208.1) synthesized after codon optimization was cloned into plasmid pUC57 to obtain pUC57-opMORF. Using this as a template, restriction enzyme cleavage sites Swa I and homologous arms of pAd4 vector were added to both ends of the target gene by PCR. Then, the plasmid pAd4 digested with restriction enzyme Swa I alone was homologously recombined with the target gene to obtain a recombinant human adenovirus type 4 expressing Rift Valley fever virus Gn protein.
[0036] The truncated Gn protein obtained by purification was used to immunize rhesus monkeys twice. The immunization protocol was as follows: At the first immunization, 1×10 8 IFUs of the recombinant human adenovirus type 4 expressing Rift Valley fever virus Gn protein were used to immunize rhesus monkeys by intramuscular injection; at 28 days after immunization, the rhesus monkeys were immunized again in the same way and with the same dose. Finally, at 56 days and 182 days after the first immunization, 0.25 mg of Gn protein was fully mixed with 0.25 mg of aluminum adjuvant (purchased from Invivogen, vac-alu-50), and the rhesus monkeys were boost-immunized by intramuscular injection.
[0037] Blood was collected from the vein at 210 days after the first immunization. The antibody titer in the serum was detected by ELISA. Peripheral blood was collected, and Gn-specific B cells were sorted by flow cytometry. The antibody genes were cloned by single-cell PCR technology, and a linear expression cassette was constructed. The heavy and light chains were co-transfected into 293T cells. After culturing for 48 h, the supernatant was collected. Then, ELISA was used to detect whether the supernatant contained binding antibodies against Gn protein. The full-length genes of the heavy and light chains of the screened positive antibodies were cloned into the eukaryotic expression plasmid pCDNA3.4 by homologous recombination respectively, transfected into the suspension cell Expi293F for large-scale expression, and purified by Protein A affinity column (HiTrapTM Protein A HP). Finally, 2 monoclonal antibodies A1 and C1 with good binding activity against Gn protein were obtained. Their expression and purity were identified by SDS-PAGE, and the results were as Figure 2 shown.
[0038] The amino acid sequence of the heavy chain of monoclonal antibody A1 is shown in SEQ ID NO:1, and the amino acid sequence of the light chain is shown in SEQ ID NO:2. The gene sequence encoding the heavy chain of monoclonal antibody A1 is shown in SEQ ID NO:5, and the gene sequence encoding the light chain of monoclonal antibody A1 is shown in SEQ ID NO:6. The amino acid sequences of CDR1, CDR2, and CDR3 regions of the heavy chain variable region of monoclonal antibody A1 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-115 of the sequence shown in SEQ ID NO:1, and the amino acid sequences of FR1, FR2, FR3, and FR4 regions are shown as the amino acid sequences at positions 1-25, 34-50, 59-96, and 116-126 of the sequence shown in SEQ ID NO:1; the amino acid sequences of CDR1, CDR2, and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-37, 55-57, and 94-102 of the sequence shown in SEQ ID NO:2, and the amino acid sequences of FR1, FR2, FR3, and FR4 regions are shown as the amino acid sequences at positions 1-26, 38-54, 58-93, and 103-112 of the sequence shown in SEQ ID NO:2; The amino acid sequence of the heavy chain of monoclonal antibody C1 is shown in SEQ ID NO:3, and the amino acid sequence of the light chain is shown in SEQ ID NO:4. The gene sequence encoding the heavy chain of monoclonal antibody C1 is shown in SEQ ID NO:7, and the gene sequence encoding the light chain of monoclonal antibody C1 is shown in SEQ ID NO:8. The amino acid sequences of CDR1, CDR2, and CDR3 regions of the heavy chain variable region of monoclonal antibody C1 are shown as the amino acid sequences at positions 26-33, 51-58, and 97-101 of the sequence shown in SEQ ID NO:3, and the amino acid sequences of FR1, FR2, FR3, and FR4 regions are shown as the amino acid sequences at positions 1-25, 34-50, 59-96, and 102-112 of the sequence shown in SEQ ID NO:3; the amino acid sequences of CDR1, CDR2, and CDR3 regions of the light chain variable region are shown as the amino acid sequences at positions 27-38, 56-58, and 95-103 of the sequence shown in SEQ ID NO:4, and the amino acid sequences of FR1, FR2, FR3, and FR4 regions are shown as the amino acid sequences at positions 1-26, 39-55, 59-94, and 104-113 of the sequence shown in SEQ ID NO:4.
[0039] Example 3: Determination of the binding activity of monoclonal antibodies A1 and C1 1. Coat an ELISA plate with purified RVFV-Gn protein (2 μg / mL, 100 μL / well) overnight at 4 °C. After washing 4 times with PBST, block it with 5% skim milk powder at 37 °C for 2 h; 2. After washing 4 times with PBST, monoclonal antibodies A1 and C1 against Gn protein antigen with an initial concentration of 9 μg / mL were added respectively, diluted in a gradient ratio of 1:3, and incubated at 37 °C for 1 h; 3. After washing 4 times with PBST, HRP-labeled goat anti-human IgG antibody (Sigma, AP113P) was added. The antibody dilution ratio was 1:5000, 100 μL / well, and incubated at 37 °C for 1 h; 4. After washing 4 times with PBST, 100 μL of single-component TMB chromogenic solution was added, developed at 37 °C for 10 min, 50 μL of ELISA stop solution was added, and finally the OD 450-630nm value was read with an enzyme-linked immunosorbent assay reader.
[0040] With the monoclonal antibody concentration on the X-axis and OD 450-630nm on the Y-axis, the binding curves of monoclonal antibodies A1, C1 and RVFV-Gn were obtained as Figure 3 .
[0041] Table 1 ELISA binding EC of monoclonal antibodies A1, C1 to RVFV-Gn antigen 50
[0042] Table 1 shows the EC 50 values.
[0043] Example 4: Detection sensitivity experiment of antibody pair A1-C1 To establish a double-antibody sandwich ELISA method for the detection of Gn antigen, a detection sensitivity experiment needs to be carried out on the screened antibody pair. Monoclonal antibody A1 is used as the capture antibody, and monoclonal antibody C1 is used as the detection antibody (in this application, the detection monoclonal antibody is obtained by the HRP direct labeling method).
[0044] Experimental method: 1. Coat the capture antibody A1 at a concentration of 2 μg / mL on a 96-well ELISA plate, set two duplicate wells. Incubate overnight at 4 °C. The next day, wash the plate 4 times with PBST and block it with 5% skim milk powder at 37 °C for 2 hours.
[0045] 2. After blocking, wash the plate 4 times with PBST, add RVFV-Gn protein (concentration gradients are 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.125 ng / mL, 1.562 ng / mL, 0.781 ng / mL, 0 ng / mL) as the primary antibody, 100 μL / well, and incubate at 37 °C for 1 hour.
[0046] 3. After the incubation with the primary antibody, wash the plate 4 times with PBST, add HRP-labeled C1 as the secondary antibody (at a concentration of 2 μg / mL), and incubate at 37 °C for 1 hour.
[0047] 4. After the incubation with the secondary antibody, wash the plate 4 times with PBST, add 100 μL of the single-component TMB chromogenic solution, develop the color at 37 °C for 10 minutes, add 50 μL of the stop solution, and measure the absorbance at OD 450-630nm to determine the binding activity.
[0048] Table 2 shows the OD of the antibody pair A1-C1 for detecting RVFV-Gn 450-630nm values. Using the ratio of the OD 450-630nm value S of the sample to be tested and the OD 450-630nm value N of the negative control as the criterion for determining a positive test, when S / N ≥ 2.1, it is determined as positive, that is, the sample to be tested contains RVFV-Gn, otherwise it is determined as negative, that is, the sample to be tested does not contain RVFV-Gn.
[0049] Table 2 OD of the antibody pair A1-C1 for detecting RVFV-Gn 450-630nm values
[0050] Taking the RVFV-Gn concentration as the X-axis and OD 450-630nm as the Y-axis, the binding curve of A1-C1 and RVFV-Gn is Figure 4 (The scale interval of the X-axis is shown in the form of a Log10 increase, so the data when the RVFV-Gn concentration is 0 is not shown in the figure).
[0051] Example 5: Specificity of antibody pair detection Two monoclonal antibodies A1 and C1 were respectively subjected to a binding test with the recombinant Rift Valley fever virus Gn antigen and the Severe fever with thrombocytopenia syndrome virus (SFTSV) Gn antigen. The OD 450-630nm value was detected to determine whether A1 and C1 have detection specificity.
[0052] Experimental method: 1. Coat the enzyme-linked immunosorbent assay (ELISA) plate (2 μg / mL, 100 μL / well) with SFTSV-Gn protein (the Gn antigen of SFTSV, purchased from ACROBiosystems, GNN-S52H3) overnight at 4 °C. After washing 4 times with PBST, block it with 5% skim milk powder at 37 °C for 2 h; 2. After washing 4 times with PBST, monoclonal antibodies A1 and C1 against RVFV-Gn protein antigen with an initial concentration of 200 ng / mL were added respectively, diluted in a gradient of 1:2, and incubated at 37 °C for 1 h; 3. After washing 4 times with PBST, HRP-labeled goat anti-human IgG antibody (Sigma, AP113P) was added, the antibody dilution ratio was 1:5000, 100 μL / well, and incubated at 37 °C for 1 h; 4. After washing 4 times with PBST, 100 μL of single-component TMB chromogenic solution was added, developed at 37 °C for 10 min, then 50 μL of ELISA stop solution was added, and finally the OD 450-630nm value was read with an enzyme-linked immunosorbent assay reader.
[0053] The binding experiments of the two monoclonal antibodies A1 and C1 with RVFV-Gn antigen were the same as those in Example 3. The results of Example 3 and the results of this example were integrated and compared. With the monoclonal antibody concentration as the X-axis and OD 450-630nm as the Y-axis, the binding curves of monoclonal antibodies A1 and C1 with RVFV-Gn and SFTSV-Gn were obtained as Figure 5 .
[0054] Figure 5 The binding curves of monoclonal antibodies A1 and C1 with RVFV-Gn antigen and SFTSV-Gn antigen were shown respectively. The results showed that monoclonal antibodies A1 and C1 could specifically bind to RVFV-Gn antigen and did not bind to SFTSV-Gn antigen, indicating detection specificity.
[0055] Example 6: Optimization of the double-antibody sandwich ELISA detection protocol When the antibody pair A1-C1 was used to detect RVFV-Gn, the OD 450-630nm value of the blank well was relatively large, which was related to the concentration of the HRP-labeled antibody added. To establish a double-antibody sandwich ELISA method for the detection of RVFV-Gn antigen, it was necessary to optimize the addition amount of the monoclonal antibody during the detection process.
[0056] The specific optimization plan was to reduce the addition amount of the HRP-labeled antibody C1.
[0057] Experimental operation: 1. Antibody A1 was coated at a concentration of 2 μg / mL on a 96-well ELISA plate, and two replicate wells were set. Incubated overnight at 4 °C. The next day, the plate was washed 4 times with PBST and blocked with 5% skim milk powder at 37 °C for 2 hours.
[0058] 2. After sealing, wash the plate 4 times with PBST, add RVFV-Gn protein, dilute it with 1% BSA, 100 μL / well, and incubate at 37 °C for 1 hour. The initial concentration of the RVFV-Gn protein after dilution is 50 ng / mL, and it is serially diluted 2-fold to 50 ng / mL, 25 ng / mL, 12.5 ng / mL, 6.25 ng / mL, 3.125 ng / mL, 1.562 ng / mL, 0.781 ng / mL, 0.390 ng / mL, 0.195 ng / mL, 97.5 pg / mL, 48.75 pg / mL, and 0 ng / mL.
[0059] 3. After incubation, wash the plate 4 times with PBST, add HRP-labeled antibody C1 as the secondary antibody, 100 μL / well, and incubate at 37 °C for 1 hour. The concentrations of the secondary antibody are 1 μg / mL, 0.5 μg / mL, 0.25 μg / mL, and 0.125 μg / mL, respectively.
[0060] 4. After incubation with the secondary antibody, wash the plate 4 times with PBST, add single-component TMB chromogenic solution, 100 μL / well, develop color at 37 °C for 10 min, add 50 μL of stop solution, and measure the absorbance value at OD 450-630nm at the corresponding wavelength.
[0061] Table 3 shows the OD 450-630nm values for detecting RVFV-Gn with different concentrations of HRP-C1. As the concentration of the HRP-labeled antibody decreases, the OD 450-630nm value of the blank well (without adding RVFV-Gn protein) gradually decreases. Generally, it is required that the OD 450-630nm value of the blank well < 0.10.
[0062] It can be seen from Table 3 that when the concentration of HRP-C1 is between 1 μg / mL and 0.5 μg / mL, the sensitivity for detecting Gn protein is 0.39 ng / mL, while when the concentration of HRP-C1 is between 0.25 μg / mL and 0.125 μg / mL, the sensitivity for detecting Gn protein is 0.781 ng / mL. Therefore, select the HRP-labeled antibody concentration under the condition that the blank OD 450-630nm value is less than 0.10 and the detection sensitivity is 0.39 ng / mL for the kit, that is, the coating antibody A1 is 2 μg / mL and the detection antibody HRP-C1 is 0.5 μg / mL.
[0063] Table 3 OD 450-630nm values for detecting RVFV-Gn with different HRP-C1 concentrations
[0064] Figure 6Under the condition that the detection antibody HRP-C1 is 0.5 μg / mL, with the RVFV-Gn concentration as the X value and the OD 450-630nm value as the Y value, use ELISA calc for calculation, and the fitting model selects a logistic curve (four parameters) to obtain the fitting curve.
[0065] Example 7: Sensitivity of double-antibody sandwich ELISA for detecting RVFV-Gn in serum The purpose of the present invention is to detect whether Rift Valley fever virus is present in human serum. Therefore, it is necessary to determine the detection sensitivity of this double-antibody sandwich ELISA for RVFV-Gn in human serum.
[0066] The specific implementation method is to dilute the RVFV-Gn protein with single-person serum (serum of healthy volunteers) stored in the laboratory and detect the detection range of this double-antibody sandwich ELISA under this condition.
[0067] Table 4 OD of double-antibody sandwich ELISA for detecting RVFV-Gn in serum 450-630nm value
[0068] Table 4 shows the OD of double-antibody sandwich ELISA for detecting RVFV-Gn in serum 450-630nm value. It can be seen from Table 4 that the detection sensitivity of this double-antibody sandwich ELISA for detecting RVFV-Gn in human serum decreases compared with that in 1% BSA, but it can still reach 781 pg / mL.
Claims
1. A monoclonal antibody against Rift Valley fever virus Gn protein, characterized in that: is monoclonal antibody A1 and / or monoclonal antibody C1, The amino acid sequences of CDR1, CDR2 and CDR3 of the heavy chain variable region of monoclonal antibody A1 are shown in the amino acid sequences at positions 26-33, 51-58 and 97-115 of SEQ ID NO:1; the amino acid sequences of CDR1, CDR2 and CDR3 of the light chain variable region are shown in the amino acid sequences at positions 27-37, 55-57 and 94-102 of SEQ ID NO:2; The amino acid sequences of CDR1, CDR2 and CDR3 regions of the heavy chain variable region of monoclonal antibody C1 are shown in the amino acid sequences at positions 26-33, 51-58, and 97-101 of SEQ ID NO:3; the amino acid sequences of CDR1, CDR2 and CDR3 regions of the light chain variable region are shown in the amino acid sequences at positions 27-38, 56-58, and 95-103 of SEQ ID NO:
4.
2. The monoclonal antibody against Rift Valley fever virus Gn protein according to claim 1, characterized in that: The amino acid sequence of the heavy chain of monoclonal antibody A1 is shown in SEQ ID NO: 1, and the amino acid sequence of the light chain is shown in SEQ ID NO: 2; The amino acid sequence of the heavy chain of monoclonal antibody C1 is shown in SEQ ID NO:3, and the amino acid sequence of the light chain is shown in SEQ ID NO:
4.
3. The gene encoding the monoclonal antibody against the Rift Valley fever virus Gn protein according to claim 2, characterized in that: The gene sequence encoding the heavy chain of monoclonal antibody A1 is shown in SEQ ID NO:5, and the gene sequence encoding the light chain of monoclonal antibody A1 is shown in SEQ ID NO:6; The gene sequence encoding the heavy chain of monoclonal antibody C1 is shown in SEQ ID NO:7, and the gene sequence encoding the light chain of monoclonal antibody C1 is shown in SEQ ID NO:
8.
4. Use of the monoclonal antibody against Rift Valley fever virus Gn protein according to any one of claims 1 to 3 in the preparation of a detection kit for detecting Rift Valley fever virus Gn antigen.
5. A detection kit for detecting Rift Valley fever virus Gn antigen, characterized in that: The invention comprises a monoclonal antibody against the Gn protein of the Rift Valley fever virus as described in any one of claims 1 to 3.
6. The detection kit according to claim 5, characterized in that: The detection kit is a double antibody sandwich ELISA detection kit, wherein the monoclonal antibodies are monoclonal antibody A1 and monoclonal antibody C1, one of monoclonal antibody A1 and monoclonal antibody C1 is used as a capture antibody, and the other is used as a detection antibody, and the detection antibody is labeled.
7. The detection kit according to claim 6, characterized in that: The markers used to label the monoclonal antibody in the detection antibody are peroxidase, phosphatase or luciferase.
8. The detection kit according to claim 7, characterized in that: The peroxidase is horseradish peroxidase.
9. Use of the detection kit according to any one of claims 6 to 8 for non-diagnostic purposes in detecting Rift Valley fever virus Gn antigen.
10. A double antibody sandwich ELISA detection method for detecting Rift Valley fever virus Gn antigen for non-diagnostic purposes, characterized in that: Using the detection kit according to any one of claims 6 to 8, the double antibody sandwich ELISA detection method comprises the following steps: S1, coating the ELISA plate with capture antibody; S2, blocking with blocking solution; S3, discard the blocking solution, wash with buffer, then add the sample to be tested and incubate; S4, wash with buffer, then add detection antibody and incubate; S5, color development and detection.
Citation Information
Patent Citations
Humanized monoclonal antibody of rift valley fever virus and application thereof
CN114409770A
Anti-vista (B7H5) antibodies
CN109069626A
Anti-pvrig / Anti-tigit bispecific antibodies and methods of use
CN113039202A
Anti-pvrig antibodies and methods of use
US20160244521A1
Ex vivo gamma delta t cell populations
US20220290101A1