Monoclonal antibody of H protein and N protein of canine distemper virus and application of monoclonal antibody in preparation of fluorescent microsphere antigen detection test strip
By preparing fluorescent microsphere antigen detection strips, the canine distemper virus-specific monoclonal antibodies CDV-H-1G5 and CDV-N-3A11 were used to solve the problems of cumbersome operation and equipment dependence in existing detection methods, and achieve rapid and accurate canine distemper virus antigen detection, which is suitable for early diagnosis under non-laboratory conditions.
Patent Information
- Application Number
- CN202510435081.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-08
- Publication Date
- 2025-08-08
AI Technical Summary
The existing canine distemper virus detection methods are cumbersome, time-consuming, require professional equipment and technicians, and it is difficult to achieve rapid and accurate diagnosis under non-laboratory conditions.
The fluorescent microsphere antigen detection strips were prepared by using the canine distemper virus-specific monoclonal antibodies CDV-H-1G5 and CDV-N-3A11, and the antigen to be tested was detected by the double-anti-anti-sandwich method, which simplified the operation process and was suitable for rapid detection under non-laboratory conditions.
It realizes rapid and accurate canine distemper virus antigen detection under non-laboratory conditions, improves the sensitivity and specificity of the detection, and is suitable for early diagnosis in pet hospitals and families.
Smart Images

Figure CN120446489A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of canine distemper antigen detection, and particularly relates to the preparation of canine distemper virus antibodies and the preparation and application of fluorescent microsphere antigen detection test strips. Background Art
[0002] Canine distemper virus (CDV) is the causative agent of canine distemper virus disease, an acute, febrile, highly contagious disease in dogs. It belongs to the genus Morbillivirus and is an enveloped, single-stranded, non-segmented, negative-sense RNA virus. Currently, there is only one serotype of CDV. The CDV genome encodes six structural proteins. The nucleocapsid protein (N) contains B-cell and T-cell epitopes and plays an important role in the early immune response to viral infection. The hemagglutinin protein (H), a key viral envelope glycoprotein, is the antigenic determinant that elicits specific CTL responses in the host and can induce the production of large amounts of neutralizing antibodies. The two canine distemper antigens mentioned above are important targets for canine distemper antigen detection and play an important role in canine distemper antigen detection.
[0003] Canine distemper, a Category III animal disease, is one of the most important viral infections of dogs. It can infect a wide range of domestic and wild animals, posing a threat to endangered species worldwide. Clinical symptoms of canine distemper include elevated body temperature, loss of appetite, depression, watery discharge from the eyes and nose, sneezing, and diarrhea. It carries a poor prognosis, can lead to lymphopenia and prolonged immunosuppression, and is susceptible to secondary infections. Therefore, canine distemper is in the highest demand for clinical diagnosis. Currently, commonly used laboratory methods for canine distemper virus detection include virus isolation and culture, electron microscopy, PCR, and serological tests. However, while virus isolation and culture is the gold standard for laboratory pathogen diagnosis, it is time-consuming, often requiring one to two weeks to complete. Electron microscopy allows direct visualization of viral particles, but this method requires a high number of viral particles, which are often insufficient in clinical specimens. Furthermore, this method requires specialized technical expertise, making it less commonly used in clinical practice. PCR, including conventional PCR and qRT-PCR, can detect trace amounts of viral nucleic acid by testing eye, nasal, and throat swab samples for viral DNA. However, this method can be susceptible to false positives and negatives due to sample contamination, as well as to the specificity and sensitivity of the PCR reaction due to improper primer design and inappropriate target sequence selection. Commonly used methods in serological testing include enzyme-linked immunosorbent assays (ELISAs) and colloidal gold test strips. While ELISAs can detect target antigens, they require specialized laboratory equipment and specialized instruments, and can result in significant variability in the results. Compared to these aforementioned methods, which are cumbersome and time-consuming, and require expensive equipment and specialized technicians, making them difficult to perform in non-laboratory, field settings, fluorescent microsphere test strips offer a simple, rapid, and efficient method for sensitive viral / antigen diagnosis. They are not restricted by environmental or personnel constraints and do not require expensive equipment. They are crucial for the early diagnosis and control of animal infections and can be widely used in veterinary clinics and at home. Summary of the Invention
[0004] The object of the present invention is to provide a method for detecting canine distemper antigen quickly, accurately and effectively. To solve the above technical problems, the present invention adopts the following technical solutions:
[0005] The present invention provides a monoclonal antibody for detecting canine distemper virus. The monoclonal antibodies are respectively canine distemper virus-specific monoclonal antibody CDV-H-1G5 secreted by hybridoma cell CDV-H-1G5 strain and canine distemper virus-specific monoclonal antibody CDV-N-3A11 secreted by hybridoma cell CDV-N-3A11 strain.
[0006] The canine distemper virus specific monoclonal antibody CDV-N-3A11 contains a heavy chain variable region CDV-N-3A11-V H and light chain variable region CDV-N-3A11-V L ; the CDV-N-3A11-V H and the CDV-N-3A11-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the CDV-N-3A11-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 34 of SEQ ID No. 1; the CDV-N-3A11-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 1; the CDV-N-3A11-V H The amino acid sequence of CDR3 is shown in amino acids 99 to 105 of SEQ ID No. 1; the CDV-N-3A11-V L The amino acid sequence of CDR1 of the CDV-N-3A11-VL is shown as amino acids 24 to 37 of SEQ ID No.4; the amino acid sequence of CDR1 of the CDV-N-3A11-VL is shown as amino acids 24 to 40 of SEQ ID No.2; the amino acid sequence of CDR2 of the CDV-N-3A11-VL is shown as amino acids 56 to 62 of SEQ ID No.2; and the amino acid sequence of CDR3 of the CDV-N-3A11-VL is shown as amino acids 95 to 103 of SEQ ID No.2.
[0007] The canine distemper virus specific monoclonal antibody CDV-H-1G5 contains a heavy chain variable region CDV-H-1G5-V H and light chain variable region CDV-H-1G5-V L ; The CDV-H-1G5-V H and the CDV-H-1G5-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the CDV-H-1G5-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 35 of SEQ ID No. 3; the CDV-H-1G5-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 3; the CDV-H-1G5-V HThe amino acid sequence of CDR3 is shown in amino acids 99 to 103 of SEQ ID No. 3; the CDV-H-1G5-V L The amino acid sequence of CDR1 is shown in amino acids 24 to 39 of SEQ ID No. 4; the CDV-H-1G5-V L The amino acid sequence of CDR2 is shown in amino acids 55 to 61 of SEQ ID No. 4; the CDV-H-1G5-V L The amino acid sequence of CDR3 is shown in amino acids 94 to 102 of SEQ ID No. 4;
[0008] Preferably, the CDV-N-3A11-V H The amino acid sequence of CDV-N-3A11-V is shown in the 1st to 116th positions of SEQ ID No. 1 in the sequence list; L The amino acid sequence is shown in positions 1 to 113 of SEQ ID No. 2 in the sequence listing.
[0009] Preferably, the CDV-H-1G5-V H The amino acid sequence of CDV-H-1G5-V is shown in the 1st to 114th positions of SEQ ID No. 3 in the sequence list; L The amino acid sequence is shown in positions 1 to 112 of SEQ ID No. 4 in the sequence listing.
[0010] The above heavy chain variable region and light chain variable region sequences can be connected with animal-derived constant regions (such as mouse antibody heavy chain and light chain constant regions) to prepare monoclonal antibodies that can specifically bind to canine distemper virus.
[0011] The invention discloses a canine distemper virus fluorescent microsphere antigen detection test strip, comprising a backing, a sample pad, a fluorescent microsphere binding pad, a chromatography membrane and a water absorbent pad on the backing; the fluorescent microsphere binding pad is embedded with a canine distemper virus-specific monoclonal antibody CDV-N-3A11 labeled with fluorescent microspheres; the chromatography membrane is provided with a detection line and a quality control line; the quality control line on the chromatography membrane is sprayed with goat anti-mouse IgG; and the detection line on the chromatography membrane is sprayed with a canine distemper virus-specific monoclonal antibody CDV-H-1G5.
[0012] The backing is a polyethylene backing.
[0013] Also includes loading cartridges.
[0014] The absorbent pad is made of absorbent filter paper; the fluorescent microsphere binding pad is made of glass cellulose membrane;
[0015] The chromatography membrane is a nitrocellulose membrane.
[0016] The use of the above-mentioned enzyme-linked immunosorbent assay strips in the preparation of a kit for specifically detecting canine distemper virus antigens also falls within the scope of protection of the present invention.
[0017] The use of the above-mentioned monoclonal antibody that can specifically bind to canine distemper virus antigen in the preparation of a test strip for detecting canine distemper virus is also within the scope of protection of the present invention.
[0018] The concentration of CDV-H-1G5 was 1.0 mg / mL, and the C line was coated with goat anti-mouse IgG antibody at a concentration of 1.0 mg / mL, and then sprayed onto the nitrocellulose membrane using a film gold sprayer. After assembly, the large plate was cut into 4 mm bare strips using a strip cutter for later use.
[0019] Furthermore, the final concentration of the fluorescent microsphere-labeled monoclonal antibody CDV-N-3A11 mixture is 20 μg / mL.
[0020] The canine distemper virus antigen detection test strip provided by the present invention detects the antigen to be tested using a double antibody sandwich method. The dominant antigenic epitopes of canine distemper virus, H protein and N protein, are obtained through the construction, prokaryotic expression, and purification of recombinant plasmids. Subsequently, two monoclonal antibodies to canine distemper virus are obtained after immunization of mice, cell fusion, hybridoma cell line screening, and ascites preparation and purification. The double antibody sandwich method detects the antigen with high sensitivity and good specificity, and can be used for the early diagnosis of canine distemper virus infection. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 Schematic diagram of fluorescent microsphere test strip;
[0022] Figure 2 The test strips contain 5×10 CDV viruses from left to right. 3 TCID 50 , 5×10 2 TCID 50 , 5×10 1 TCID 50 , 5TCID 50 and 0.5TCID 50 The test results;
[0023] Figure 3 1-3: are the test results of the test strip for CPV, CPIV and CAV respectively. DETAILED DESCRIPTION
[0024] The methods in the following examples are all conventional methods unless otherwise specified.
[0025] Canine distemper virus H protein and N protein can be prepared by those skilled in the art according to the method of Example 1 in CN 118688453 A.
[0026] Example 1. Screening of Canine Distemper Virus H Protein and N Protein Positive Monoclonal Hybridoma Cell Lines
[0027] (1) Mouse immunization: 1 mg of H protein and N protein were emulsified as immunogens with an equal amount of Freund's adjuvant. Three SPF-grade Bal b / c female mice were immunized three times at a dose of 100 μg / mouse. Freund's complete adjuvant was used for the first immunization, and Freund's incomplete adjuvant was used for the second and third immunizations. After three immunizations, serum titers were tested, and mice with the highest serum titers were selected for cell fusion. Three days before fusion, 100 μg of H protein and N protein were used for intraperitoneal impaction (without adjuvant).
[0028] (2) Cell Fusion: The eyes of the mice to be fused were removed and bled. Blood samples were collected and serum was used as a positive control. The mice were sacrificed by cervical dislocation and the spleens were removed. Splenocytes were isolated and fused with well-growing myeloma SP2 / 0 cells under the action of PEG. The cells were cultured in HAT selective medium in a cell culture incubator at 37°C and 5% CO2. After 3-5 days of culture, the cell growth was observed under a microscope. Hybridoma cells could be detected as positive after about 7 days.
[0029] (3) Screening of positive hybridoma cell lines: After 7 days of culture in HAT complete medium, ELISA screening was performed. Cells with ELISA test results with OD values higher than 1.0 were selected for subcloning. After subcloning, 6 hybridoma cell lines that could stably secrete monoclonal antibodies were identified and expanded for culture. Among them, the two cell lines with the highest positive results were named CDV-N-3A11 and CDV-H-1G5, with supernatant ELISA OD values of 2.561 and 2.232, respectively.
[0030] Example 2. Preparation, purification and identification of monoclonal antibodies against canine distemper virus H protein and N protein
[0031] (1) Preparation and purification of monoclonal antibodies against canine distemper virus H protein
[0032] Monoclonal antibodies are primarily prepared by inducing ascites in mice. Sterile liquid paraffin is injected into the mouse peritoneal cavity one week before the initial test. One week later, the monoclonal cell lines CDV-N-3A11 and CDV-H-1G5 are injected into the mouse peritoneal cavity. After five days, abdominal changes are closely monitored. Seven to ten days later, ascites fluid is collected and purified using Protein G affinity chromatography for monoclonal antibody purification.
[0033] (2) Monoclonal antibody subtype identification: The antibody subtype was identified using a commercial monoclonal antibody subtype kit. The heavy chain subtype of monoclonal antibodies CDV-N-3A11 and CDV-H-1G5 was IgG1, and the light chain subtype was kappa.
[0034] (3) Identification of the specificity of monoclonal antibodies: CDV H and N proteins, CDV virus fluid, canine parvovirus, canine parainfluenza virus, and canine adenovirus type 1 stored by our company were used as coating antigens to determine the specificity of monoclonal antibodies. Monoclonal antibody CDV-N-3A11 only reacted positively with CDV-N protein and CDV virus fluid coating, and monoclonal antibody CDV-H-1G5 only reacted positively with CDV-N protein and CDV virus fluid coating. Both monoclonal antibodies reacted negatively with three other common viruses, indicating that monoclonal antibodies CDV-N-3A11 and CDV-H-1G5 are both CDV-specific monoclonal antibodies.
[0035] Example 3. Gene Sequencing, Expression, and Identification of Positive Monoclonal Hybridoma Cell Lines CDV-N-3A11 and CDV-H-1G5
[0036] Two positive cloned hybridoma cell lines were collected, RNA was extracted, and reverse transcribed to obtain hybridoma cell cDNA as a template. The template cDNA was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing.
[0037] The monoclonal antibody CDV-N-3A11 contains the heavy chain variable region CDV-N-3A11-V H and light chain variable region CDV-N-3A11-V L ; the CDV-N-3A11-V H The amino acid sequence of CDV-N-3A11-V is shown in the 1st to 116th positions of SEQ ID No. 1 in the sequence list; L The amino acid sequence of CDV-N-3A11-V is shown in the 1st to 113th positions of SEQ ID No. 2 in the sequence list. H and the CDV-N-3A11-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the CDV-N-3A11-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 34 of SEQ ID No. 1; the CDV-N-3A11-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 1; the CDV-N-3A11-V HThe amino acid sequence of CDR3 is shown in amino acids 99 to 105 of SEQ ID No. 1; the CDV-N-3A11-V L The amino acid sequence of CDR1 of the CDV-N-3A11-VL is shown as amino acids 24 to 37 of SEQ ID No.4; the amino acid sequence of CDR1 of the CDV-N-3A11-VL is shown as amino acids 24 to 40 of SEQ ID No.2; the amino acid sequence of CDR2 of the CDV-N-3A11-VL is shown as amino acids 56 to 62 of SEQ ID No.2; and the amino acid sequence of CDR3 of the CDV-N-3A11-VL is shown as amino acids 95 to 103 of SEQ ID No.2.
[0038] The monoclonal antibody CDV-H-1G5 contains the heavy chain variable region CDV-H-1G5-V H and light chain variable region CDV-H-1G5-V L ; The CDV-H-1G5-V H The amino acid sequence of CDV-H-1G5-V is shown in the 1st to 114th positions of SEQ ID No. 3 in the sequence list; L The amino acid sequence of CDV-H-1G5-V is shown in the 1st to 112th positions of SEQ ID No. 4 in the sequence list. H and the CDV-H-1G5-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the CDV-H-1G5-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 35 of SEQ ID No. 3; the CDV-H-1G5-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 3; the CDV-H-1G5-V H The amino acid sequence of CDR3 is shown in amino acids 99 to 103 of SEQ ID No. 3; the CDV-H-1G5-V L The amino acid sequence of CDR1 is shown in amino acids 24 to 39 of SEQ ID No. 4; the CDV-H-1G5-V L The amino acid sequence of CDR2 is shown in amino acids 55 to 61 of SEQ ID No. 4; the CDV-H-1G5-V L The amino acid sequence of CDR3 is shown in amino acids 94 to 102 of SEQ ID No. 4.
[0039] Example 4. Expression and identification of monoclonal antibodies CDV-N-3A11 and CDV-H-1G5
[0040] 4.1 Expression of monoclonal antibodies
[0041] (1) Synthesis of gene sequences: Based on the determined sequences of the heavy and light chain variable regions of the monoclonal antibodies CDV-N-3A11 and CDV-H-1G5, the sequences of the mouse antibody heavy and light chain constant regions were supplemented in the variable region portion, and then the gene sequences were synthesized and codon optimized for insect cells. The nucleotide sequences of the CDV-N-3A11 heavy and light chains are shown in SEQ ID No. 5 and SEQ ID No. 6 in the sequence listing; the nucleotide sequences of the CDV-H-1G5 heavy and light chains are shown in SEQ ID No. 7 and SEQ ID No. 8 in the sequence listing.
[0042] (2) Construction of shuttle vector: Based on the sequence information of the heavy and light chains and the sequence information of the pFastBacdual (purchased from ThermoFisher, catalog number 10712024) vector, corresponding primers were designed (sequences are shown in Table 1 below) to amplify the full-length fragments of the heavy and light chains. After gel recovery, the fragments were connected to the pFastBacdual vector by homologous recombination. The pFastBacdual vector contains two promoters, namely the PH promoter and the P10 promoter. After connection to the vector, sequence determination was performed to ensure the accuracy of the sequence.
[0043] Table 1 Primer sequence information for expression vector construction
[0044] name Sequence (5'-3') 3A11-HF TCATACATCTACGCGGCCGCTAGC GAAGTGCAGCTCCAGCAATC 3A11-HR TCCCCCATCTCCCGGTACC GGAACTCACTGTGAGGGT 3A11-LF CTGCCTTTGCGGCGGATGAATTC GATATTGTTA TGAGCCATC 3A11-LR CTAGTACTTCTCGACAAGCTT CCTGATCTCCAATTTAGTA 1G5-HF TCATACATCTACGCGGCCGCTAGC CAAGTACAGCTCCACCATC 1G5-HR TCCCCCATCTCCCGGTACC GGAGCTCACTGTCAAGGTCG 1G5-LF CTGCCTTTGCGGCGGATGAATTC GACGTAGTTATGACCCAGAC 1G5-LR CTAGTACTTCTCGACAAGCTTCTTAATCTCCAGTTTCGTGC
[0045] (3) Screening and extraction of recombinant Bacmid: The constructed shuttle vector was transformed into DH10Bac competent cells and spread on triple-antibody plates (kanamycin, gentamicin, and tetracycline). After culturing at 37°C for 48 hours, white spots were picked and identified using M13 primers. The target fragment size of the positive clone was 4600 bp, and that of the negative clone was 300 bp. The clones with no 300 bp band were selected and shaken. After 12 hours, the Bacmid was extracted using the isopropanol precipitation method, and the concentration was then measured using Nanodrop.
[0046] (4) Rescue of recombinant baculovirus: Before transfection, the density of the recombinant baculovirus was 2×10 6 SF9 cells were plated in six-well plates and transfected with 5 μg and 2.5 μg of recombinant Bacmid using 8 μl of transfection reagent. The medium was changed 4-6 hours after transfection and cultured at 28°C. After 72 hours, the P2 virus was harvested and amplified. The same method was used for amplification of the P3 virus. The P4 virus was amplified in shake flasks at a virus inoculum ratio of 1:100.
[0047] (5) Expression and purification of specific monoclonal antibodies: The P4 virus was inoculated at a density of 2×10 6 Hi5 cells were cultured at 28°C and harvested after 48 hours. The cells were centrifuged at 8000 rpm for 1 hour, and the supernatant was filtered through a 0.22 μm filter for later use. Monoclonal antibodies were then purified using Protein G affinity chromatography.
[0048] 4.2 Identification of Monoclonal Antibodies
[0049] Monoclonal antibody titer identification: Indirect ELISA was used to identify the sensitivity of monoclonal antibodies. CDV virus strains were used as coating antigens for coating. CDV-N-3A11 and CDV-H-1G5 were diluted in series to verify the sensitivity of the monoclonal antibodies. As shown in Table 2, the titers of the two monoclonal antibodies were higher than 10 6 times.
[0050] Table 2 Monoclonal antibody titer identification
[0051] Dilution multiple mAb CDV-N-3A11 mAb CDV-H-1G5 <![CDATA[10 3 ]]> 3.354 3.221 <![CDATA[10 4 ]]> 3.045 2.997 <![CDATA[10 5 ]]> 2.634 2.536 <![CDATA[10 6 ]]> 0.957 0.824 Positive control 2.814 2.621 Negative control 0.094 0.086
[0052] Monoclonal antibody specificity was determined using CDV H and N proteins, CDV viral fluid, and our company's stock of canine parvovirus, canine parainfluenza virus, and canine adenovirus type 1 as coating antigens. Monoclonal antibody CDV-N-3A11 reacted positive only with CDV-N protein and CDV viral fluid coating, while monoclonal antibody CDV-H-1G5 reacted positive only with CDV-N protein and CDV viral fluid coating. Both monoclonal antibodies were negative with three other common viruses, indicating that both monoclonal antibodies CDV-N-3A11 and CDV-H-1G5 are specific for CDV.
[0053] Example 5. Preparation of Canine Distemper Virus H Protein Fluorescent Microsphere Antigen Detection Test Strip
[0054] The preparation method of the canine distemper virus H protein fluorescent microsphere antigen detection test strip prepared by the present invention is as follows:
[0055] 1 Preparation of fluorescent microsphere-labeled monoclonal antibodies
[0056] (1) Cleaning: Take 0.1 mL of time-resolved fluorescent microspheres with a particle size of 200 nm, add them to 0.9 mL of pure water, mix well, sonicate for 1 min, centrifuge at 12000 rpm / min for 15 min, and discard the supernatant.
[0057] (2) Activation: Resuspend the microspheres in 1 mL of pure water, add 10 μL of 10 mg / mL NHS and 10 μL of EDC, sonicate for 1 min, and then transfer to a shaker for activation at 37°C, 200 rpm for 30 min. Centrifuge at 12,000 rpm for 15 min, and discard the supernatant. Subsequently, wash the microspheres once with 1 mL of pure water and once with 10 mM boric acid buffer, centrifuge at 12,000 rpm for 15 min, and discard the supernatant.
[0058] (3) Coupling: Resuspend the microspheres in 1 mL of 10 mM boric acid buffer, sonicate for 1 min, then add 20 μg of monoclonal antibody CDV-N-3A11, mix well, and couple at room temperature for 2 h.
[0059] (4) Blocking: Add 4% Casein protein to a final concentration of 0.2% and block at room temperature for 1 hour. Centrifuge at 12,000 rpm / min for 15 minutes and discard the supernatant.
[0060] (5) Resuspension: Prepare a 10 mM borate buffer solution containing 5% sucrose, 1% Casein, and 1% Tween-20, pH 8.0. Take 0.8 mL of the resuspended microspheres and sonicate for 1 min to prepare the microsphere-labeled complex. Use a gold sprayer to evenly spray the solution onto glass fiber at a rate of 2 uL / cm and dry at 37°C for 3 h.
[0061] 2. Nitrocellulose membrane coating
[0062] The quality control line (C line) and the test line (T line) were sprayed on the surface of the nitrocellulose membrane using a gold spray film sprayer. The T line was coated with the monoclonal antibody CDV-H-1G5 at a concentration of 1.0 mg / mL, and the C line was coated with 1.0 mg / mL goat anti-mouse. The spray volume for both was 1 μL / cm, and the distance between them was 0.5 cm.
[0063] 3Test strip assembly
[0064] Treat the sample pad: soak the sample pad in 10 mM boric acid buffer containing 1% Casein, 1% Tween-20 and 1% NaCl for 5 minutes, and dry it at 37°C for 3 hours.
[0065] Assembly: Using a PVC base as the test plate, attach the sample pad, fluorescent microsphere conjugate pad, nitrocellulose membrane, and absorbent pad in order from bottom to top, overlapping adjacent sections by 2 mm. Cut the assembled plate into 4 mm strips using a strip cutter for later use.
[0066] 4. Usage and judgment of test strips
[0067] Insert the sample to be tested into a sample tube containing sample treatment solution and dissolve it as much as possible in the solution. Add the treated sample vertically to the sample well of the test strip (4 drops) and let it sit horizontally at room temperature for 15 minutes before determining the result. If both the control line and the test line show color, the result is considered positive; if only the control line shows color, the result is considered negative; if the control line does not show color, the result is considered invalid and requires retesting.
[0068] Example 6. Application of Canine Distemper Virus H Protein Fluorescent Microsphere Antigen Detection Test Strip
[0069] (1) Test strip sensitivity test: dilute the CDV virus solution to 5×10 3 TCID 50 , 5×10 2 TCID 50 , 5×10 1 TCID 50 , 5TCID 50 and 0.5TCID 50 The test strips prepared by the present invention and the commercially available canine distemper virus colloidal gold test strips were used for detection. The sensitivity of the test strips of this product was 5TCID 50 ( Figure 1 ), the sensitivity of commercially available colloidal gold test strips is 50TCID 50 (Table 3) The sensitivity of the test strips of this product is about 10 times higher than that of commercially available test strips in detecting the corresponding virus solution.
[0070] Table 3 Test strip sensitivity test
[0071] Virus content (TCID50) Test strip of the present invention Commercially available colloidal gold test strips <![CDATA[5×10 3 ]]> Positive Positive <![CDATA[5×10 2 ]]> Positive Positive <![CDATA[5×10 1 ]]> Positive Negative 5 Positive Negative 0.5 Negative Negative
[0072] (2) Test strip specificity test: The test strip was used to simultaneously detect canine parvovirus, canine parainfluenza virus, and canine adenovirus type 1, and the results were all negative ( Figure 2 ), indicating that the test strip has strong specificity.
[0073] (3) Repeatability test of test strips: 24 test strips were randomly selected from each of the three batches of test strips and tested for CDV virus at a dilution of 5×10 3 TCID 50 , 5×10 2 TCID 50 , 5×10 1 TCID 50 , 5TCID 50 and 0.5TCID 50The dilutions of the test strips were tested, as well as virus samples of canine parvovirus, canine parainfluenza virus, and canine adenovirus type 1. Each sample was tested in parallel with three strips. The sensitivity of the test strips was consistent within and between batches, and the results of the tests for canine parvovirus, canine parainfluenza virus, and canine adenovirus type 1 were all negative, indicating that the test strips have good reproducibility.
[0074] (4) Test strip stability test: The test strips were stored at 45°C for 30 days for accelerated aging experiments. The sensitivity of the CDV virus solution was tested, and virus samples of canine parvovirus, canine parainfluenza virus, and canine adenovirus type 1 were also tested. The test strips showed consistent sensitivity to CDV virus solution during the storage period, and the test results for canine parvovirus, canine parainfluenza virus, and canine adenovirus type 1 were all negative. This indicates that the test strips meet the stability requirements when stored at 45°C for 30 days.
[0075] (5) Clinical testing with test strips: 101 samples collected by clinical qRT-PCR were tested using the test strips prepared by the present invention. The results are shown in Table 4 below. Compared with the qRT-PCR method, the test strips prepared by the present invention had a positive coincidence rate of 97.4% and an overall coincidence rate of 99%.
[0076] Table 4 Test strip compliance results
[0077]
[0078]
[0079] In summary, the test strips of the present invention offer a 10-fold increase in sensitivity compared to existing commercial CDV test strips, demonstrate a high concordance rate with qRT-PCR in clinical testing, and offer more accurate test results compared to existing commercial test strips, overcoming the shortcomings of existing commercial test strips. The test strips of the present invention offer advantages such as simplicity, rapidity, strong specificity, high sensitivity, and easy storage of results, enabling early detection of CDV infection in dogs.
Claims
1. A canine distemper virus fluorescent microsphere antigen detection test strip, characterized in that: The invention comprises a backing and a sample pad, a fluorescent microsphere binding pad, a chromatography membrane and a water-absorbing pad on the backing; the characteristic is that the fluorescent microsphere binding pad is embedded with a canine distemper virus-specific monoclonal antibody CDV-N-3A11 labeled with fluorescent microspheres, the chromatography membrane is provided with a detection line and a quality control line, the quality control line on the chromatography membrane is sprayed with goat anti-mouse IgG; the detection line on the chromatography membrane is sprayed with a canine distemper virus-specific monoclonal antibody CDV-H-1G5; The canine distemper virus specific monoclonal antibody CDV-N-3A11 contains a heavy chain variable region CDV-N-3A11-V H and light chain variable region CDV-N-3A11-V L ; the CDV-N-3A11-V H and the CDV-N-3A11-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the CDV-N-3A11-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 34 of SEQ ID No. 1; the CDV-N-3A11-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 1; the CDV-N-3A11-V H The amino acid sequence of CDR3 is shown in amino acids 99 to 105 of SEQ ID No. 1; the CDV-N-3A11-V L The amino acid sequence of CDR1 of the CDV-N-3A11-VL is shown as amino acids 24 to 37 of SEQ ID No. 4; the amino acid sequence of CDR1 of the CDV-N-3A11-VL is shown as amino acids 24 to 40 of SEQ ID No. 2; the amino acid sequence of CDR2 of the CDV-N-3A11-VL is shown as amino acids 56 to 62 of SEQ ID No. 2; the amino acid sequence of CDR3 of the CDV-N-3A11-VL is shown as amino acids 95 to 103 of SEQ ID No. 2; The canine distemper virus specific monoclonal antibody CDV-H-1G5 contains a heavy chain variable region CDV-H-1G5-V H and light chain variable region CDV-H-1G5-V L ; The CDV-H-1G5-V H and the CDV-H-1G5-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the CDV-H-1G5-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 35 of SEQ ID No. 3; the CDV-H-1G5-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 3; the CDV-H-1G5-V H The amino acid sequence of CDR3 is shown in amino acids 99 to 103 of SEQ ID No. 3; the CDV-H-1G5-V L The amino acid sequence of CDR1 is shown in amino acids 24 to 39 of SEQ ID No. 4; the CDV-H-1G5-V L The amino acid sequence of CDR2 is shown in amino acids 55 to 61 of SEQ ID No. 4; the CDV-H-1G5-V L The amino acid sequence of CDR3 is shown in amino acids 94 to 102 of SEQ ID No.
4.
2. The canine distemper virus fluorescent microsphere antigen detection test strip according to claim 1, characterized in that: CDV-N-3A11-V H The amino acid sequence of CDV-N-3A11-V is shown in the 1st to 116th positions of SEQ ID No. 1 in the sequence list; L The amino acid sequence is shown in positions 1 to 113 of SEQ ID No. 2 in the sequence listing; Preferably, the CDV-H-1G5-V H The amino acid sequence of CDV-H-1G5-V is shown in the 1st to 114th positions of SEQ ID No. 3 in the sequence list; L The amino acid sequence is shown in positions 1 to 112 of SEQ ID No. 4 in the sequence listing.
3. The canine distemper virus fluorescent microsphere antigen detection test strip according to claim 1, characterized in that: The backing is a polyethylene backing.
4. The canine distemper virus fluorescent microsphere antigen detection test strip according to any one of claims 1 to 3, characterized in that: Also includes loading cartridges.
5. The canine distemper virus fluorescent microsphere antigen detection test strip according to any one of claims 1 to 3, characterized in that: The absorbent pad is made of absorbent filter paper; the fluorescent microsphere binding pad is made of glass cellulose membrane; The chromatography membrane is a nitrocellulose membrane.
6. A canine distemper virus-specific monoclonal antibody, which is a monoclonal antibody described in any one of 1) to 4) below: 1) Contains the heavy chain variable region CDV-N-3A11-V H and light chain variable region CDV-N-3A11-V L ; the CDV-N-3A11-V H and the CDV-N-3A11-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the CDV-N-3A11-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 34 of SEQ ID No. 1; the CDV-N-3A11-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 1; the CDV-N-3A11-V H The amino acid sequence of CDR3 is shown in amino acids 99 to 105 of SEQ ID No. 1; the CDV-N-3A11-V L The amino acid sequence of CDR1 of the CDV-N-3A11-VL is shown as amino acids 24 to 37 of SEQ ID No. 4; the amino acid sequence of CDR1 of the CDV-N-3A11-VL is shown as amino acids 24 to 40 of SEQ ID No. 2; the amino acid sequence of CDR2 of the CDV-N-3A11-VL is shown as amino acids 56 to 62 of SEQ ID No. 2; the amino acid sequence of CDR3 of the CDV-N-3A11-VL is shown as amino acids 95 to 103 of SEQ ID No. 2; 2) Contains the heavy chain variable region CDV-H-1G5-V H and light chain variable region CDV-H-1G5-V L ; The CDV-H-1G5-V H and the CDV-H-1G5-V L The complementary regions of the determinants are composed of CDR1, CDR2 and CDR3; the CDV-H-1G5-V H The amino acid sequence of CDR1 is shown in amino acids 31 to 35 of SEQ ID No. 3; the CDV-H-1G5-V H The amino acid sequence of CDR2 is shown in amino acids 50 to 66 of SEQ ID No. 3; the CDV-H-1G5-V H The amino acid sequence of CDR3 is shown in amino acids 99 to 103 of SEQ ID No. 3; the CDV-H-1G5-V L The amino acid sequence of CDR1 is shown in amino acids 24 to 39 of SEQ ID No. 4; the CDV-H-1G5-V L The amino acid sequence of CDR2 is shown in amino acids 55 to 61 of SEQ ID No. 4; the CDV-H-1G5-V L The amino acid sequence of CDR3 is shown in amino acids 94 to 102 of SEQ ID No. 4; 3) Contains the heavy chain variable region CDV-N-3A11-V H and light chain variable region CDV-N-3A11-V L ; the CDV-N-3A11-V H The amino acid sequence of CDV-N-3A11-V is shown in the 1st to 116th positions of SEQ ID No. 1 in the sequence list; L The amino acid sequence is shown in positions 1 to 113 of SEQ ID No. 2 in the sequence listing; 4) Contains the heavy chain variable region CDV-H-1G5-V H and light chain variable region CDV-H-1G5-V L ; The CDV-H-1G5-V H The amino acid sequence of CDV-H-1G5-V is shown in the 1st to 114th positions of SEQ ID No. 3 in the sequence list; L The amino acid sequence is shown in positions 1 to 112 of SEQ ID No. 4 in the sequence listing.
7. Use of the canine distemper virus-specific monoclonal antibody according to claim 6 in the preparation of a kit for specifically detecting canine distemper antigens.
8. Use of the antigen detection test strip according to any one of claims 1 to 5 in preparing a kit for specifically detecting canine distemper virus antigen.
9. The use according to claim 8, characterized in that The samples to be tested in the kit for specific detection of canine distemper virus antigen include eye and nose swabs and virus culture.
10. The preparation method of the canine distemper virus fluorescent microsphere antigen detection test strip according to claim 1, wherein a PVC base plate is used as the detection plate, and a sample pad, a fluorescent microsphere binding pad, a nitrocellulose membrane, and a water-absorbing pad are sequentially attached from bottom to top, with adjacent parts overlapping by 2 mm; wherein, The fluorescent microsphere conjugate pad is glass fiber, and the prepared fluorescent microsphere-labeled canine distemper virus-specific monoclonal antibody CDV-N-3A11 is evenly coated on the fluorescent microsphere conjugate pad and dried at 37°C for 3 hours. Two lines are coated on the nitrocellulose membrane: a quality control line and a test line. The test line is coated with canine distemper virus-specific monoclonal antibody CDV-H-1G5 at a concentration of 1.0 mg / mL, and the quality control line is coated with goat anti-mouse IgG antibody at a concentration of 1.0 mg / mL. The membrane is then sprayed on the nitrocellulose membrane using a film spraying instrument. After assembly, the large plate is cut into 4 mm bare strips using a strip cutter. The final concentration of the mixture of canine distemper virus-specific monoclonal antibody CDV-N-3A11 labeled with fluorescent microspheres is 20 μg / mL.
Citation Information
Cited By
Monoclonal antibody combination for resisting canine distemper virus nucleocapsid protein and application
CN122145620A
A monoclonal antibody combination against the nucleocapsid protein of canine distemper virus and application thereof
CN122145620B