Preparation method and application of protein switch-based explosive molecule detection biosensor
Through a biosensor based on protein switches, the "protein switch" sensing element is constructed using the recombination of YhaJ and cpEGFP, which solves the problems of high risk and low sensitivity of remote detection in the prior art, and achieves rapid, high sensitivity and high specificity detection of explosive molecules.
Patent Information
- Application Number
- CN202510237364.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-02
- Publication Date
- 2025-05-30
AI Technical Summary
Existing explosive detection technology cannot achieve remote detection, and there are problems of high risk and low sensitivity, especially when detecting residual mines.
Using a biosensor based on a protein switch, the transcriptional regulatory protein YhaJ and the circular arrangement green fluorescent protein cpEGFP are recombined to form a "protein switch" sensing element. When an explosive molecule is detected, the YhaJ undergoes conformational changes, causing the fluorescence state of cpEGFP to change, thereby achieving rapid and sensitive detection.
Fast, high sensitivity and high specificity detection of explosive molecule 2,4-DNT, with a response time of 15 minutes, a minimum detection limit of 10 μg/L, and can still work effectively under high salt conditions.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular biology, and particularly relates to a preparation method and application of a biosensor for detecting explosive molecules based on a protein switch. Background Art
[0002] In recent years, with the rapid development of synthetic biology technology, biosensing technology has received extensive attention. A biosensor is composed of a biological sensing element and a reporting element. The sensing element can sense subtle changes in various factors in the environment and output a signal that is easy to detect to the outside world through the reporting element. Due to the advantages of high detection sensitivity, high accuracy, and strong specificity of biosensing technology, it has been widely used in the fields of medicine, environment, food detection, etc.
[0003] Residual explosives in the war zone (such as landmines) can cause irreparable damage to life safety and the ecological environment. Therefore, it is of great strategic and ecological significance to detect landmines safely and effectively. 2,4-Dinitrotoluene (DNT) is the main component in the gas phase produced by the explosive TNT. Due to its high volatility, it is often used as a characteristic chemical substance for detecting the presence of explosives. Previous explosive detection technologies could not achieve remote detection, and there would be great danger and low sensitivity during the detection process. Detecting residual landmines through biosensing detection technology is an effective means.
[0004] Compared with ordinary fluorescent protein reporting elements, cpEGFP has the advantages of high sensitivity, strong signal, and fast response. Currently, biosensors developed based on circularly permuted green fluorescent protein technology have been widely used in the fields of bioimaging, drug screening, cell metabolite detection, etc. This biosensing system uses cpEGFP as the reporting element and a "protein switch" recombined with the transcriptional regulatory protein YhaJ. When explosive molecules exist in the environment, YhaJ can specifically bind to them, resulting in a conformational change of the protein, changing from the "open" state to the "closed" state, and then causing a change in the microenvironment where the chromophore of the connected cpEGFP fluorescent protein is located, changing from the non-fluorescent state to the fluorescent state. Currently, there is no report on the research of preparing a "protein switch" biosensor based on the transcriptional regulatory protein YhaJ and applying it to the military field. Summary of the Invention
[0005] The present invention provides a preparation method and application of a biosensor for detecting explosive molecules based on a protein switch.
[0006] To achieve the above invention purpose, the present invention adopts the following technical solutions to achieve: The present invention provides a preparation method and application of a biosensor for detecting explosive molecules based on a protein switch, and the sensor is a "protein switch" recombined by a sensing element and a reporting element.
[0007] Furthermore, the preparation method of the explosive molecule detection biosensor is as follows: (1) Obtain the pET-28a-INP plasmid according to the literature (Construction of xylose dehydrogenase displayed on the surface of bacteria using ice nucleation protein for sensitive D-xylose detection. Analytical chemistry, 84(1), 275–282.). This plasmid contains the N-terminal domain of ice nucleation protein derived from Pseudomonas borealis which can be used as an anchor protein to fuse with the target protein to achieve its display on the surface of bacteria; (2) Using the Escherichia coli genome as a template, PCR amplify the coding gene fragment of YhaJ. After purification and recovery, ligate it to the pTInaPb-N plasmid, and transform the product into Escherichia coli competent cells to obtain the recombinant plasmid pET-28a-INP-YhaJ; (3) Compare the naked protein structure of YhaJ (PDB: 8H58) with the complex protein structure of methylhydroquinone-binding (PDB: 8H5A), and select the Loop region where the conformation of the ligand-binding domain changes significantly as the insertion site of circularly permuted green fluorescent protein cpEGFP; Chemically synthesize the cpEGFP gene fragment by Sangon Biotech Co., Ltd., insert it into the corresponding site of the pET-28a-INP-YhaJ plasmid, and transform the product into Escherichia coli competent cells to obtain the recombinant plasmid pET-28a-INP-YhaJ-cpEGFP; (4) Cultivate the Escherichia coli carrying the pET-28a-INP-YhaJ-cpEGFP plasmid in liquid to OD 600 = 0.2 - 0.8, then add 0.4 - 1.0 mmol / L isopropyl-β-D-thiogalactoside (IPTG), and culture overnight at 16 - 30 °C. Centrifuge to collect the bacteria, and resuspend the bacteria with 50 mmol / L Tris-HCl (pH 8.5) buffer to obtain cells with the "protein switch" of cpEGFP and YhaJ recombinantly displayed on the surface. This cell is an explosive molecule detection biosensor based on the protein switch; (5) Cultivate the Escherichia coli carrying the pET-28a-INP-YhaJ-cpEGFP plasmid in liquid to OD 600When = 0.2 - 0.8, add 0.4 - 1.0 mmol / L isopropyl-β-D-thiogalactoside (IPTG), and culture overnight at 16 - 30 °C. Centrifuge to collect the cells, resuspend the cells with 50 mmol / L Tris-HCl (pH 8.5) buffer, and perform affinity chromatography purification using a Ni-IDA affinity column (manufacturer TaKaRa, product number 635659) according to the instructions to obtain the pure protein of the "protein switch" recombinant of cpEGFP and YhaJ. This protein is also an explosive molecule detection biosensor based on the protein switch.
[0008] Furthermore, the explosive molecule detection biosensor comprises an expression cassette of the coding gene of the "protein switch", a recombinant vector, a recombinant microorganism or a transgenic cell line.
[0009] Furthermore, for the constructed explosive molecule detection biosensor based on the protein switch, the preferred expression plasmid is pET-28a(+).
[0010] Furthermore, for the constructed explosive molecule detection biosensor based on the protein switch, the preferred expression strain is E. coli C43(DE3).
[0011] Furthermore, the "protein switch" contained in the explosive molecule detection biosensor has one of the following nucleotide sequences: (1) The nucleotide sequence shown in SEQ ID No.1; (2) The nucleotide sequence shown in SEQ ID No.2; (3) The nucleotide sequence shown in SEQ ID No.3; (4) The nucleotide sequence shown in SEQ ID No.4;
[0012] (5) The nucleotide sequence shown in SEQ ID No.5; (6) The nucleotide sequence shown in SEQ ID No.6; (7) The nucleotide sequence shown in SEQ ID No.7; (8) The nucleotide sequence shown in SEQ ID No.8; (9) The nucleotide sequence shown in SEQ ID No.9.
[0013] Furthermore, the "protein switch" contained in the explosive molecule detection biosensor has one of the following amino acid sequences: (1) The amino acid sequence shown in SEQ ID No.10; (2) The amino acid sequence shown in SEQ ID No.11; (3) The amino acid sequence shown in SEQ ID No. 12; (4) The amino acid sequence shown in SEQ ID No. 13.
[0014] (5) The amino acid sequence shown in SEQ ID No. 14; (6) The amino acid sequence shown in SEQ ID No. 15; (7) The amino acid sequence shown in SEQ ID No. 16; (8) The amino acid sequence shown in SEQ ID No. 17; (9) The amino acid sequence shown in SEQ ID No. 18.
[0015] The present invention also provides the application of the described explosive molecule detection biosensor based on a protein switch in the detection of explosive molecules.
[0016] Furthermore, the described explosive molecule detection biosensor based on a protein switch is applied to the rapid, highly sensitive, and highly specific detection of explosive molecules on the ocean shore.
[0017] Furthermore, the usage method of the biosensor is as follows: Mix the "protein switch" with 2,4-DNT and Tris-HCl (pH = 8.2) so that the final concentration of the "protein switch" is 1 μM and the final concentration of 2,4-DNT is 10 mg / L. After adding to a black microplate, use a microplate reader to continuously monitor the fluorescence intensity at a constant temperature of 37 °C.
[0018] Furthermore, the concentration range of the explosive molecule 2,4-dinitrotoluene (2,4-DNT) detected by the biosensor is: 10 μg / L - 1 mg / L.
[0019] Furthermore, the biosensor is applicable to the detection of explosive molecules (such as: 2,4-DNT) under high-salt conditions.
[0020] Furthermore, the biosensor has no response to benzene ring substances such as methyl benzoquinone, p-aminophenol, phloroglucinol, p-aminobenzoic acid, 4-methyl-3-nitroaniline, catechol, and hydroquinone.
[0021] Furthermore, the biosensor can rapidly respond to the explosive molecule (2,4-DNT), and the detection time is 15 min.
[0022] Compared with the prior art, the present invention has the following advantages and beneficial effects: This invention is the first to use "protein switch" as the core element to build a biosensor, which can directly sense the luminescence of explosive molecules through protein to achieve rapid detection. This new sensor subverts the traditional detection principle and has the advantages of fast response, high sensitivity, strong safety, etc. It is extremely innovative in terms of detection principle. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 The figure is the plasmid map of the expression vector pET-28a-INP-YhaJ in the present invention.
[0024] Figure 2 This is the plasmid map of the constructed vector pET-28a-INP-YhaJ-cpEGFP.
[0025] Figure 3 To verify cpEGFP Results of fluorescence assays at different insertion sites.
[0026] Figure 4 This is the result of the “protein switch” ELISA instrument test.
[0027] Figure 5 This is the fluorescence result diagram of the biosensor detecting 2,4-DNT under different salt concentration conditions.
[0028] Figure 6 This is the fluorescence detection result diagram of the biosensor in response to different substrates. DETAILED DESCRIPTION
[0029] The present invention is further described in detail below by specific examples in conjunction with the accompanying drawings. In the following examples, unless otherwise specified, the reagents and instruments used are all conventional reagents and instruments in the art and can be obtained through commercial channels. The methods used are all conventional methods in the art.
[0030] According to the literature (Construction of xylose dehydrogenase displayed on the surface of bacteria using ice nucleation protein for sensitive D-xylose detection. Analytical chemistry, 84(1), 275–282.), the pET-28a-INP plasmid was obtained. The plasmid contains the Pseudomonas borealis The N-terminal domain of the ice nuclease protein can be used as an anchor protein and fused with the target protein to display it on the bacterial surface; Based on the literature (Rapid construction of metabolite biosensors using domain-insertion profiling. Nature communications, 7, 12266.), the gene sequence of the circularly permuted green fluorescent protein gene was determined. cpEGFP Its amino acid sequence is shown in SEQ ID NO.19, and its nucleotide sequence is shown in SEQ ID NO.20, which was chemically synthesized by Sangon Biotech Co., Ltd.
[0031] Based on the literature (Structural basis of transcription factor YhaJ for DNT detection. iScience, 26(10), 107984.), the gene sequence of the transcriptional regulatory factor gene was determined. YhaJ Its amino acid sequence is shown in SEQ ID NO.21, and its nucleotide sequence is shown in SEQ ID NO.22, which was obtained by amplification from the Escherichia coli genome.
[0032] (1) Using pET-28a-INP as a template, primer pET-28a-INP-F and primer pET-28a-INP-R, polymerase chain reaction (PCR) was carried out to amplify the pET-28a-INP fragment. The PCR amplification system is as follows: The PCR program was: 95 °C for 3 min; 30 cycles × (95 °C for 15 s, 58 °C for 15 s, 72 °C for 6 min); 72 °C for 5 min; 16 °C ∞.
[0033] The primer sequences are as follows: pET-28a-INP-F: 5’-TAACGGAAAACACCACCACCACCACCACTAAGCTAGCATGACTGGTGGAC-3’ (SEQ ID NO.23); pET-28a-INP-R: 5’-TTTCCCACATGGTATATCTCCTTCTTAAAGTTAAAC-3’ (SEQ ID NO.24).
[0034] The PCR product was purified by liquid recovery using a liquid recovery purification kit (Vazyme, product number DC301-01).
[0035] (2) Using the Escherichia coli genome as a template, the following was amplified YhaJTranscription regulatory factor sequence, and the PCR amplification system is as follows: The PCR program is as follows: 95 °C for 3 min; 30 cycles × (95 °C for 15 s, 58 °C for 15 s, 72 °C for 30 s); 72 °C for 5 min; 16 °C ∞. The primer sequences are as follows: YhaJ-F: 5’- GACAGCGGTGATGGCCAAAGAAAGGGCATT -3’ (SEQ ID NO.25); YhaJ-R: 5’- GTGGTGGTGGTGTTTTCCGTTAAAAAGTTTGGGAATTTCC -3’ (SEQ ID NO.26).
[0036] The PCR product was recovered and purified using a liquid recovery and purification kit (Vazyme, product number DC301-01).
[0037] Using seamless cloning, YhaJ was cloned into the pET-28a-INP plasmid, and the system is as follows: The ligation system was incubated at 50 °C for 30 min. The ligation product was transformed into E.coli C43(DE3)Δ yhaJ competent cells, spread on an LB solid plate containing 50 mg / L kanamycin, and positive clones were screened by PCR. The recombinant plasmid pET-28a-INP-YhaJ ( Figure 1 ) was extracted from the positive clones, and then identified by restriction enzyme digestion and sequencing.
[0038] Example 2: cpEGFP Verification experiment on the fluorescence effect of different insertion sites
[0039] Using pET-28a-INP-YhaJ as a template, primer pET-28a-INP-YhaJ-F and primer pET-28a-INP-YhaJ-R, polymerase chain reaction (PCR) was carried out to amplify the pET-28a-INP-YhaJ vector fragment, and the PCR amplification system is as follows: The PCR program is as follows: 95 °C for 3 min; 30 cycles × (95 °C for 15 s, 61 °C for 15 s, 72 °C for 3 min 22 s); 72 °C for 5 min; 16 °C ∞.
[0040] The primer sequences are as follows: pET-28a-INP-YhaJ-F: 5’-TAACTTCAACGGTACCCCGGTGTTGACCGTACAGCT-3’(SEQ ID NO.27); pET-28a-INP-YhaJ -R: 5’-AGACGTTATACGGGCGCTCACGAGCGGTATCCG-3’(SEQ ID NO.28).
[0041] The PCR products were purified by liquid recovery using a liquid recovery purification kit (Vazyme, product number DC301-01).
[0042] Using seamless cloning, cpEGFP the gene fragment was cloned into the pET-28a-INP-YhaJ plasmid, and the system is shown below: The ligation system was incubated at 50 °C for 30 min. The ligation products were transformed E.coli into C43(DE3)Δ yhaJ competent cells, spread on an LB solid plate containing 50 mg / L kanamycin, and positive clones were screened by PCR. The recombinant plasmid pET-28a-INP-YhaJ-cpEGFP ( Figure 2 ) was extracted from the positive clones and then identified by restriction enzyme digestion and sequencing.
[0043] The above-mentioned engineered Escherichia coli after activation was inoculated into an LB liquid culture medium containing kanamycin at an inoculation amount of 1%, and cultured with shaking at 37 °C and 200 rpm. When the OD 600 reached 0.6 - 0.8, the inducer isopropyl-β-D-thiogalactoside (IPTG) was added to the bacterial solution, and then the culture was continued at 16 °C and 200 rpm. After overnight induction of the engineered strain, the cells were harvested, washed with 50 mM PBS, resuspended in PBS, and subjected to subsequent fluorescence detection with a microplate reader.
[0044] The OD 600 of the bacterial solution after harvesting the bacteria was diluted to 10.
[0045] Take 200 μL of the bacterial solution + 12 μL of the 2,4-DNT stock solution with a concentration of 250 mg / L + 88 μL of H2O, and pipette 200 μL into a 96-well pure white microplate to make the final concentration of 2,4-DNT 10 mg / L. Three biological replicates were made for each sample.
[0046] The fluorescence intensity of the strain was monitored in real-time at a constant temperature of 37 °C using a microplate reader (manufacturer: Biotek, model: Cytation). Wavelength parameters: excitation wavelength 485 nm, emission wavelength 528 nm.
[0047] The results are as Figure 3 shown. The biosensors constructed by inserting cpEGFP at the five sites of V211, V214, Q215, E208, and L217 of YhaJ did not respond to the detection of 2,4-DNT. The biosensors constructed by inserting cpEGFP at the four sites of P210, T213, L216, and R209 of YhaJ showed different degrees of response to the detection of 2,4-DNT. Among them, the response value at the P210 site was the highest, and the response time was 15 min.
[0048] 1. Preparation of YhaJ-cpEGFP protein mutants (1) Transfer the strain with YhaJ inserted at the P210 site of cpEGFP to an LB liquid medium containing 50 mg / L kanamycin, and activate the strain overnight at 37 °C to obtain a bacterial solution. Add 1 mL of the bacterial solution to 100 mL (×5 bottles) of LB liquid medium with kanamycin resistance, and culture until OD 600 = 0.6.
[0049] (2) Add 40 μL of IPTG with a mother liquor concentration of 1 M to the medium and induce at 16 °C for 20 h.
[0050] (3) Centrifuge all the bacterial solution at 6000 rpm and 4 °C for 3 min, wash it twice with Tris-HCl (pH 8.5) buffer, and finally resuspend the precipitate with 50 mL of Tris-HCl (pH 8.5) buffer.
[0051] (4) Ultrasonically disrupt the bacterial solution, centrifuge at 12000 rpm and 4 °C for 5 min, and collect the supernatant.
[0052] (5) Use a Ni-IDA affinity column (manufacturer TaKaRa, product number 635659) for affinity chromatography purification according to the instructions to obtain pure protein.
[0053] 2. Fluorescence detection by microplate reader First, prepare a mother liquor of 2,4-DNT with a concentration of 5 mg / mL (dissolved in DMSO). According to C 1 V 1 =C 2 V 2 , prepare 2,4-DNT with different concentration gradients to obtain final concentrations of 0 mg / L, 0.001 mg / L, 0.01 mg / L, and 0.1 mg / L respectively.
[0054] Take 2 μL of the protein mutant (final concentration 1 μΜ) + 2 μL of 2,4-DNT at concentrations of 0 mg / L, 0.001 mg / L, 0.01 mg / L, and 0.1 mg / L + 196 μL of Tris-HCl (pH 8.5) and add them to a 96-well pure white microplate so that the final concentrations of 2,4-DNT are 0 μg / L, 10 μg / L, 100 μg / L, and 1000 μg / L respectively.
[0055] Use a microplate reader (manufacturer: Biotek, model: Cytation) to continuously monitor the fluorescence intensity of the strain at a constant temperature of 37 °C. Wavelength parameters: excitation wavelength 485 nm, emission wavelength 528 nm.
[0056] The results are as Figure 4 shown. The YhaJ-cpEGFP protein mutant reacts with 2,4-DNT. As the concentration of added 2,4-DNT increases, the response value increases. The lowest detection limit is 10 μg / L, and the Ratio value is the largest at about 15 min. This indicates that the present invention combines the sensing element YhaJ that can sense 2,4-DNT with the reporter element circularly permuted enhanced green fluorescent protein cpEGFP to form a protein mutant, and uses the protein mutant to directly sense the luminescence of explosive molecules for rapid detection.
[0057] Transfer the above-mentioned strain to an LB liquid medium containing 50 mg / L kanamycin and culture it overnight at 37 °C to obtain a bacterial solution.
[0058] Inoculate the above-mentioned engineered Escherichia coli after activation into an LB liquid culture medium containing kanamycin at an inoculation amount of 1% and culture it with shaking at 37 °C and 200 rpm. When the OD 600 is 0.6 - 0.8, add the inducer isopropyl-β-D-thiogalactoside (IPTG) to the bacterial solution, and then continue to culture it at 16 °C and 200 rpm. After overnight induction of the engineered strain, harvest the cells, wash them with 50 mM PBS, resuspend the cells with PBS at different NaCl concentrations, and perform subsequent fluorescence detection with a microplate reader.
[0059] Dilute the OD 600 of the bacterial solution after harvesting the bacteria to 10.
[0060] Take 200 μL of the bacterial solution + 12 μL of the 2,4-DNT stock solution at a concentration of 250 mg / L + 88 μL of PBS, and pipette 200 μL and add it to a 96-well pure white microplate so that the final concentration of 2,4-DNT is 10 mg / L. Make 3 biological replicates for each sample.
[0061] The fluorescence intensity of the strain was monitored in real time at a constant temperature of 37 °C using a microplate reader (manufacturer: Biotek, model: Cytation). Wavelength parameters: excitation wavelength 485 nm, emission wavelength 528 nm.
[0062] The protein-switch biosensor was used to detect 2,4-DNT at a concentration of 10 mg / L under the conditions of 1%, 2%, 3%, and 4% sodium chloride (NaCl) respectively. The results are as Figure 5 shown. As the NaCl concentration increased, the fluorescence value showed an increasing trend, indicating that high salt does not affect the detection effect of the protein-switch biosensor on 2,4-DNT.
[0063] The above-mentioned strain was transferred to LB liquid medium containing 50 mg / L kanamycin and cultured overnight at 37 °C to obtain bacterial liquid.
[0064] 3.3 mL of 60% glucose, 100 μL of 1 M magnesium sulfate stock solution, and 2 mL of bacterial liquid were added to 100 mL of M9 liquid medium containing 50 mg / L kanamycin, and cultured in a shaker at 37 °C until the OD 600 reached about 0.6. Then, the inducer isopropyl-β-D-thiogalactoside (IPTG) was added to the bacterial liquid, and then cultured at 37 °C and 200 rpm for another 4 h. After the engineering strain was induced, the cells were harvested, washed with 50 mM PBS, resuspended with PBS, and subjected to subsequent fluorescence detection using a microplate reader.
[0065] The OD 600 of the bacterial liquid after harvesting the bacteria was diluted to 10.
[0066] Take 200 μL of bacterial liquid + 12 μL of aromatic reagent stock solution with a concentration of 250 mg / L (p-aminophenol, phloroglucinol, p-aminobenzoic acid, 4-methyl-3-nitroaniline, catechol, hydroquinone) + 88 μL of H 2 O, and pipette 200 μL into a 96-well pure white microplate to make the final concentration of 2,4-DNT 10 mg / L. Three biological replicates were performed for each sample.
[0067] The fluorescence intensity of the strain was monitored in real time at a constant temperature of 37 °C using a microplate reader (manufacturer: Biotek, model: Cytation). Wavelength parameters: excitation wavelength 485 nm, emission wavelength 528 nm The results are as Figure 6As shown, the bacterial solution has no response to aromatic compounds such as methylbenzoquinone, p-aminophenol, phloroglucinol, p-aminobenzoic acid, 4-methyl-3-nitroaniline, catechol, and hydroquinone, but has an obvious response to 2,4-DNT, further indicating that the protein switch biosensor can specifically respond to 2,4-DNT.
[0068] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions required to be protected by the present invention.
Claims
1. A biosensor for detecting explosive molecules based on a protein switch, characterized in that: The protein switch-based explosive molecule detection biosensor is a "protein switch" based on the recombination of the reporter element circularly arranged green fluorescent protein cpEGFP and the sensing element transcriptional regulatory protein YhaJ.
2. The method for preparing the explosive molecule detection biosensor based on protein switch according to claim 1, characterized in that: The following steps are involved: (1) According to the literature (Construction of xylose dehydrogenase displayed on the surface of bacteria using ice nucleation protein for sensitive D-xylose detection. Analytical chemistry, 84(1), 275–282.), the pET-28a-INP plasmid was obtained. The plasmid contains the N-terminal domain of ice nucleation protein from Pseudomonas borealis, which can be used as an anchor protein and fused with the target protein to achieve its bacterial surface display; (2) Using the E. coli genome as a template, PCR amplification was performed to obtain the coding gene fragment of YhaJ, which was purified and recovered, and then connected to the pTInaPb-N plasmid. The product was transformed into E. coli competent cells to obtain the recombinant plasmid pET-28a-INP-YhaJ; (3) The naked protein structure of YhaJ (PDB: 8H58) was compared with the protein structure of the complex bound to methyl hydroquinone (PDB: 8H5A), and the Loop region where the conformation of the ligand binding domain changed significantly was selected as the insertion site of the circularly arranged green fluorescent protein cpEGFP; the cpEGFP gene fragment was chemically synthesized by Sangon Biotechnology Co., Ltd. and inserted into the corresponding site of the pET-28a-INP-YhaJ plasmid. The product was transformed into Escherichia coli competent cells to obtain the recombinant plasmid pET-28a-INP-YhaJ-cpEGFP; (4) Escherichia coli carrying the pET-28a-INP-YhaJ-cpEGFP plasmid was cultured in liquid culture until OD 600 =0.2-0.8, add 0.4-1.0mmol / L isopropyl-β-D-thiogalactoside (IPTG), culture overnight at 16-30°C, collect the cells by centrifugation, resuspend the cells with 50mmol / L Tris-HCl (pH 8.5) buffer, and obtain cells with "protein switch" recombined with cpEGFP and YhaJ displayed on the surface, which is a biosensor for explosive molecule detection based on the protein switch; (5) E. coli carrying the pET-28a-INP-YhaJ-cpEGFP plasmid was cultured in liquid culture until OD 600 =0.2-0.8, add 0.4-1.0mmol / L isopropyl-β-D-thiogalactoside (IPTG), culture overnight at 16-30°C, collect the bacteria by centrifugation, resuspend the bacteria with 50mmol / L Tris-HCl (pH 8.5) buffer, and perform affinity chromatography purification using a Ni-IDA affinity column (manufacturer TaKaRa, product number 635659) according to the instructions to obtain a pure protein of the "protein switch" recombined with cpEGFP and YhaJ, which is also a biosensor for explosive molecule detection based on the protein switch.
3. The explosive molecule detection biosensor based on a protein switch constructed according to claims 1-2, characterized in that: The explosive molecule detection biosensor comprises an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line of a gene encoding a "protein switch".
4. The explosive molecule detection biosensor based on a protein switch constructed according to claim 3, characterized in that: The preferred expression plasmid is pET-28a(+).
5. The explosive molecule detection biosensor based on a protein switch constructed according to claim 3, characterized in that: The preferred expression strain is E. coli C43(DE3).
6. The explosive molecule detection biosensor based on a protein switch constructed according to claims 1-2, characterized in that: The explosive molecule detection biosensor comprises a "protein switch" whose encoding gene has one of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID No. 1; (2) the nucleotide sequence shown in SEQ ID No. 2; (3) the nucleotide sequence shown in SEQ ID No. 3; (4) The nucleotide sequence shown in SEQ ID No.
4. (5) the nucleotide sequence shown in SEQ ID No. 5; (6) the nucleotide sequence shown in SEQ ID No.6; (7) the nucleotide sequence shown in SEQ ID No.7; (8) the nucleotide sequence shown in SEQ ID No. 8; (9) The nucleotide sequence shown in SEQ ID No.
9.
7. The explosive molecule detection biosensor based on a protein switch constructed according to claims 1-2, characterized in that: The explosive molecule detection biosensor comprises a "protein switch" having one of the following amino acid sequences: (1) the amino acid sequence shown in SEQ ID No. 10; (2) the amino acid sequence shown in SEQ ID No. 11; (3) the amino acid sequence shown in SEQ ID No.12; (4) The amino acid sequence shown in SEQ ID No.
13. (5) the amino acid sequence shown in SEQ ID No.14; (6) the amino acid sequence shown in SEQ ID No.15; (7) the amino acid sequence shown in SEQ ID No.16; (8) the amino acid sequence shown in SEQ ID No.17; (9) The amino acid sequence shown in SEQ ID No.
18.
8. The explosive molecule detection biosensor based on protein switch according to claims 1-7, characterized in that: Applied to the detection of explosive molecules.
9. The explosive molecule detection biosensor based on protein switch according to claim 8, characterized in that: Used for rapid, highly sensitive and highly specific detection of explosive molecules on ocean beaches.
10. The protein switch-based explosive molecule detection biosensor according to claim 9 is applied to the rapid, high-sensitivity, and high-specificity detection of explosives on ocean beaches, characterized in that: The concentration range of the explosive molecule 2,4-dinitrotoluene (2,4-DNT) detected by the biosensor is 10 μg / L-1 mg / L.
11. The protein switch-based explosive molecule detection biosensor according to claim 9 is applied to the rapid, high-sensitivity, and high-specificity detection of explosives on ocean shores, characterized in that: The biosensor is suitable for detecting explosive molecules (such as 2,4-DNT) under high-salt conditions.
12. The protein switch-based explosive molecule detection biosensor according to claim 9 is applied to the rapid, high-sensitivity, and high-specificity detection of explosives on ocean beaches, characterized in that: The biosensor has no response to benzene ring substances such as methyl benzoquinone, p-aminophenol, phloroglucinol, p-aminobenzoic acid, 4-methyl-3-nitroaniline, catechol, and hydroquinone.
13. The protein switch-based explosive molecule detection biosensor according to claim 9 is applied to the rapid, high-sensitivity, and high-specificity detection of explosives on ocean shores, characterized in that: The biosensor can respond quickly to explosive molecules (2,4-DNT) with a detection time of 15 minutes.
Citation Information
Cited By
Fluorescent fusion protein and application thereof
CN120424229A
Fluorescent fusion protein and application thereof
CN120424229B