Endophyte YN-2-6S for increasing alkaloid content in aconite and application of endophyte YN-2-6S

Abstract

The invention discloses endophyte YN-2-6S for increasing alkaloid content in aconite and application of the endophyte YN-2-6S, and belongs to the technical field of microorganisms. The endophyte YN-2-6S is preserved in Guangdong Microbial Culture Collection Center on December 2, 2024, and the preservation number of the endophyte YN-2-6S is GDMCC No: 65573, the number of the Guangdong Microbial Culture Collection Center is Fifth Building, No. 59 Building, No. 100 Courtyard, Xianlie Middle Road, Guangzhou City. The endophytic bacterium YN-2-6S obtained by screening comes from a healthy aconite plant, is colonized in the plant body, does not influence the quality of medicinal materials, does not pollute the environment, and is harmless to human and livestock. The research also finds that the strain has an obvious promoting effect on the accumulation of the total alkaloids of the aconite, the yield of the aconite and the accumulation of the total alkaloids of sub-roots can be obviously improved by taking the strain as a growth-promoting strain, and the strain is further proved to have an important application prospect in the aspects of promoting the growth of the aconite and the accumulation of the total alkaloids.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology, and particularly relates to an endophyte YN-2-6S for increasing the alkaloid content in aconite and its use. Background Art

[0002] Aconitum carmichaelii Debx is a perennial herbaceous medicinal plant of the genus Aconitum in the family Ranunculaceae. The processed product of its daughter roots, called aconite root tuber, is one of the 40 famous large-scale Chinese medicinal materials in China. Aconite root tuber is rich in diester-type and monoester-type alkaloids, and has pharmacological effects such as reinforcing fire and assisting yang, restoring yang and rescuing from collapse, dispelling cold and relieving pain, and is known as the first product for restoring yang and rescuing from collapse. The alkaloid content is an important index for measuring the quality of aconite. Its synthesis is not only closely related to its own genetic characteristics, but also closely related to the internal and external environmental characteristics of aconite. At present, efforts are mainly made from aspects such as cultivation measures, harvesting time, processing and preparation, etc. to promote the quality improvement of aconite. However, due to the constraints of climatic conditions and production costs in different production areas, there is a lack of a set of widely applicable measures to increase the alkaloid content in aconite. And the excessive application of chemical fertilizers and pesticides will lead to a series of environmental problems. There is an urgent need for a green, safe and efficient method for improving the quality of aconite.

[0003] Microbial fertilizers do not pollute the environment, have no residues, and are harmless to humans and livestock, and have important application prospects in promoting plant growth. Among them, plant endophytes, because all or part of their life cycles are colonized in plants, co-evolve with plants and select each other, forming complex and diverse symbiotic relationships, are an important resource library for biological fertilizers. Plant endophytes refer to microorganisms that inhabit all or part of their life history in plants without causing obvious diseases, and can be isolated from strictly surface-sterilized plant tissues. Many plant endophytes have the ability to promote plant growth and their absorption and utilization of mineral nutrients. Growth-promoting bacteria can not only promote plant growth and induce the synthesis of specific secondary metabolites by secreting degrading enzyme substances and plant hormones such as indole acetic acid (IAA), but some endophytes can also synthesize secondary metabolites identical to those of the host. Screening plant endophytes closely related to the accumulation of secondary metabolites of the host plant can promote the accumulation of plant secondary metabolites. However, at present, the strain resources of aconite endophytic bacteria used as growth-promoting and biocontrol materials to promote the growth of aconite and the accumulation of total alkaloids are relatively scarce. Therefore, it has important theoretical and practical significance to isolate endophytic bacteria from healthy aconite plants and screen efficient growth-promoting bacteria for promoting the biomass and total alkaloid accumulation of aconite. Summary of the Invention

[0004] In view of the above deficiencies in the prior art, the present invention provides an endophyte YN-2-6S for increasing the alkaloid content in aconite and its use, which can effectively solve the problem of fewer growth-promoting microorganisms for promoting the accumulation of total alkaloids in aconite in the prior art, and enriches the strain resources for promoting the accumulation of total alkaloids in aconite.

[0005] To achieve the above purpose, the technical solution adopted by the present invention to solve the technical problem is:

[0006] The purpose of the present invention is to provide an endophytic bacterium YN-2-6S (Bacillus velezensis) for increasing the alkaloid content in Aconitum. The endophytic bacterium YN-2-6S was deposited in the Guangdong Provincial Microbiological Culture Collection Center on December 2, 2024, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with a deposit number of GDMCC No: 65573.

[0007] Further, the 16S rRNA gene sequence of the endophytic bacterium YN-2-6S is as follows:

[0008] CGGGGGGGGGTGCTATAATGCAGTCGAGCGGACAGATGGGAGCTTGC

[0009] TCCCTGATGTTAGCGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCTGT

[0010] AAGACTGGGATAACTCCGGGAAACCGGGGCTAATACCGGATGGTTGTTTG

[0011] AACCGCATGGTTCAGACATAAAAGGTGGCTTCGGCTACCACTTACAGATGG

[0012] ACCCGCGGCGCATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCGACG

[0013] ATGCGTAGCCGACCTGAGAGGGTGATCGGCCACACTGGGACTGAGACACG

[0014] GCCCAGACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGA

[0015] AAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTTTTCGGATCGTAA

[0016] AGCTCTGTTGTTAGGGAAGAACAAGTGCCGTTCAAATAGGGCGGCACCTT

[0017] GACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGG

[0018] TAATACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCG

[0019] CAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGG

[0020] GTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCC

[0021] ACGTGTAGCGGTGAAATGCGTAGAGATGTGGAGGAACACCAGTGGCGAA

[0022] GGCGACTCTCTGGTCTGTAACTGACGCTGAGGAGCGAAAGCGTGGGGAG

[0023] CGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAGTGCTAA

[0024] GTGTTAGGGGGTTTCCGCCCCTTAGTGCTGCAGCTAACGCATTAAGCACTC

[0025] CGCCTGGGGAGTACGGTCGCAAGACTGAAACTCAAAGGAATTGACGGGG

[0026] GCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAAGAA

[0027] CCTTACCAGGTCTTGACATCCTCTGACAATCCTAGAGATAGGACGTCCCCT

[0028] TCGGGGGCAGAGTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTG

[0029] AGATGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGCCA

[0030] GCATTCAGTTGGGCACTCTAAGGTGACTGCCGGTGACAAACCGGAGGAAG

[0031] GTGGGGATGACGTCAAATCATCATGCCCCTTATGACCTGGGCTACACACGT

[0032] GCTACAATGGACAGAACAAAGGGCAGCGAAACCGCGAGGTTAAGCCAAT

[0033] CCCACAAATCTGTTCTCAGTTCGGATCGCAGTCTGCAACTCGACTGCGTGA

[0034] AGCTGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCC

[0035] CGGGCCTTGTACACACCGCCCGTCACACCACGAGAGTTTGTAACACCCGA

[0036] AGTCGGTGAGGTAACCTTTATGGAGCCAGCCGCCGAAGTATAGAGGG。

[0037] Another object of the present invention is to provide a bacterial suspension, which comprises the above-mentioned endophyte YN-2-6S.

[0038] Another object of the present invention is to provide a fermentation broth, which is obtained by culturing the above-mentioned endophyte YN-2-6S.

[0039] Further, its preparation method is as follows:

[0040] Inoculate a single colony of YN-2-6S into LB medium and culture at 25-30 °C and 100-120 rpm / min until the bacterial content in the solution is greater than 4.5×10 8 CFU / mL, and then separate to obtain the fermentation broth.

[0041] Another object of the present invention is to provide a bacterial agent, which comprises the above-mentioned endophyte YN-2-6S, the bacterial suspension, or the fermentation broth.

[0042] Another object of the present invention is to provide the use of the above-mentioned endophyte YN-2-6S, the bacterial suspension, the fermentation broth or the bacterial agent in increasing the alkaloid content in aconite.

[0043] Another object of the present invention is to provide a preparation for enhancing the alkaloid content in aconite, which uses the above-mentioned endophytic bacterium YN-2-6S, bacterial suspension, fermentation broth or bacterial agent as an active ingredient.

[0044] Advantages of the present invention:

[0045] The endophytic bacterium YN-2-6S screened in the present invention is derived from healthy aconite plants. Since the endophyte colonizes in the plant body, it will not affect the quality of the medicinal material, does not pollute the environment, has no residue, and is harmless to humans and livestock. In addition, the present invention has found through research that it has an obvious promoting effect on the accumulation of total alkaloids in aconite. As a growth-promoting strain, it can significantly increase the yield of aconite and the accumulation of total alkaloids in the daughter roots, further proving its important application prospects in promoting the growth of aconite and the accumulation of total alkaloids. Description of the drawings

[0046] Figure 1 It is a colony morphology diagram of strain YN-2-6S on LB medium;

[0047] Figure 2 It is a phylogenetic tree constructed by strain YN-2-6S based on the 16S rRNA gene;

[0048] Figure 3 It is an effect diagram of the ability of strain YN-2-6S to produce degrading enzymes; among them, A-C are the transparent circles produced by strain YN-2-6S in the culture media containing dextran, cellulose, and protein in sequence;

[0049] Figure 4 It is the field application effect of the fermentation broth of strain YN-2-6S; among them, A is the growth-promoting effect of strain YN-2-6S on the fresh weight of the above-ground and underground parts of aconite plants, and B is the promoting effect of strain YN-2-6S on the accumulation of total alkaloids in the daughter roots of aconite. Detailed implementation manners

[0050] The following describes the specific implementation manners of the present invention to facilitate those skilled in the art of the present technology to understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific implementation manners. For those of ordinary skill in the art of the present technology, as long as various changes are within the spirit and scope of the present invention defined and determined by the appended claims, these changes are obvious, and all inventions and creations using the concept of the present invention are within the scope of protection.

[0051] Example 1: Isolation of strain YN-2-6S

[0052] Healthy Aconitum plants for the experiment were collected from Machang Township, Heqing County, Dali Bai Autonomous Prefecture, Yunnan Province (26°28'37”N, 100°03'17”E, altitude 3090m), the Aconitum production area. Five healthy Aconitum plants were randomly collected using the five-point sampling method. During the sampling process, care was taken not to cause mechanical damage. The specific process is as follows:

[0053] After removing the soil from the plants, they were placed in a sterile bag and taken back to the laboratory for processing. The collected Aconitum plants were washed with sterile water and then surface-sterilized. The sterilization steps are as follows:

[0054] The Aconitum plants were cut into small pieces and placed in a sterilized beaker. 75% alcohol was added and they were soaked for 2 min. After 2 min, the alcohol was poured out and they were washed once with ddH 2 O. Then 2% NaClO was poured in and they were soaked for 10 min. After 10 min, the NaClO was poured out. Finally, they were soaked in ddH 2 O for 1 min, and this step was repeated 5 times.

[0055] The surface-sterilized plant samples were inoculated onto LB agar medium, and 100 μL of the ddH 2 O used in the last soaking was pipetted onto the LB agar medium as a control. After culturing at 28°C for 7 d, if no colonies grew on the control, it indicated that the sterilization was thorough and the samples could be used for the isolation of endophytic bacteria. Finally, a strain that was white, opaque, and had an irregular edge was selected and named YN-2-6S (attached Figure 1 ). After 3 times of purification, the purity of the strain was detected and it was preserved in a -80°C refrigerator with 25% glycerol.

[0056] Example 2: Identification of the 16S rRNA gene of strain YN-2-6S

[0057] The total DNA of strain YN-2-6S isolated and screened in Example 1 was extracted using the GUTC method, and the concentration of the DNA was checked by 1% agarose gel electrophoresis. After checking the DNA concentration, universal primers 27F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACCTTGTTACGACTT-3’) were used for 16S rDNA

[0058] PCR amplification. The PCR amplification system was 2×mix 12.5 μL, 1 μL of 10 μmoL / mL 27F, 1 μL of 10 μmoL / mL 1492R, 1 μL of DNA, and ddH 2 O 9.5 μL.

[0059] The PCR amplification conditions were pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 2 min, for 30 cycles; and final extension at 72°C for 10 min.

[0060] The amplified products were detected by 1% agarose gel electrophoresis at a voltage of 80 V for 80 min. The PCR products were sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing. The obtained sequences were aligned in the NCBI database. According to the alignment results, reference strains were selected, and a phylogenetic tree was constructed using MEGA7.0 software ( Figure 2 ), to clarify their taxonomic status. The 16S rRNA gene sequence of strain YN-2-6S is shown in SEQ ID NO:1.

[0061] As Figure 2 shown by the phylogenetic tree results, YN-2-6S clustered with Bacillus velezensis CR-502 into a branch with a similarity of 99.69%, and was determined to be Bacillus velezensis. Then it was deposited in the Guangdong Microbial Culture Collection Center, 5th Floor, Building 59, No. 100 Yard, Xianlie Middle Road, Guangzhou on December 2, 2024, with the deposit number GDMCC No: 65573 and the taxonomic name Bacillus velezensis.YN-2-6S.

[0062] Example 3: Detection of the ability of strain YN-2-6S to produce degrading enzymes

[0063] The following media were prepared: Cellulose medium: sodium carboxymethylcellulose 10 g / L, peptone 10 g / L, NaCl 10 g / L, yeast powder 5 g / L, agar 15 g / L, pH = 7.0; Protein medium: tryptone 5 g / L, yeast powder 2.5 g / L, glucose 1 g / L, skim milk 7%, agar 15 g / L, pH = 7.0; Dextran medium: K 2 HPO 4 1 g / L, yeast powder 5 g / L, peptone 10 g / L, dextran 5 g / L, MgSO 4 ·7H 2 O 0.1 g / L, congo red 0.4 g / L, agar 15 g / L, pH = 7.0.

[0064] The strain YN-2-6S was made into a bacterial suspension, and the bacterial suspension was inoculated onto the degrading enzyme medium with a bamboo stick. After culturing at 28 °C for 5 d, the cellulose medium was stained. The staining method was to pour 10 mL of 0.1% congo red into the plate and let it stand for half an hour, then pour it out, and then add 10 mL of 5% NaCl and shake gently on a shaker for 15 min and then pour it out to complete the staining. The dextran medium and the protein medium did not need to be stained. Observe whether a clear zone was produced around the colonies, and measure the diameters of the colonies and the clear zones respectively. The results are as Figure 3 shown, Figure 3 in which A - C in turn are the clear zones produced by strain YN-2-6S in the medium containing dextran, cellulose, and protein.

[0065] Example 4: Field Application Effect of Fermentation Broth of Strain YN-2-6S

[0066] The strain preserved on the slant was inoculated into the LB solid medium and cultured at a constant temperature of 28 °C for 3 d. Single colonies were picked and inoculated into the LB liquid medium, and cultured at 28 °C and 150 rpm / min until the bacterial concentration in the solution reached 4.5×10 8 CFU / mL. When the aconite was first root-pruned, 10 mL of the YN-2-6S fermentation broth was injected into the roots of the aconite. When the aconite was root-pruned for the second time one month later, repeated inoculation was carried out (the same as the inoculation during the first root-pruning). The control group was not injected with the fermentation broth, and the water and fertilizer management method was the same as that of the experimental group. Three replicates were set, with 50 healthy aconite plants in each replicate.

[0067] At harvest, the fresh weight of the above-ground part and the fresh weight of the underground part of the plants were recorded. After harvest, the fresh aconite roots were removed from the mud, washed with distilled water, and then cut into uniform thin slices with a thickness of 2-3 mm. The cut aconite thin slices were separately spread on a breathable wire mesh plate and placed in an oven. After blanching at 90 °C for 30 min, they were further dried at 60 °C for 24 h to make raw aconite slices. The total alkaloid content in the raw aconite slices was determined by spectrophotometry. The specific process was as follows:

[0068] First, 10.5 mg of aconitine was dissolved in acetate buffer solution and made up to 50 mL. 0.15, 0.4, 0.6, 1.0, 1.3, 1.5, 1.8, and 2.0 mL of the aconitine reference solution were respectively placed in a separatory funnel, and made up to 10 mL with acetate buffer solution, with 10 mL of chloroform as the blank control. 10 mL of bromocresol green indicator solution was added, shaken for 5 min, and then left to stand for 10 min. They were respectively extracted 3 times with 10, 10, and 5 mL of chloroform. After extraction, the chloroform layer was filtered into a 25 mL volumetric flask and diluted to 25 mL with chloroform. The absorbance value was measured at a wavelength of 413 nm with a UV spectrophotometer. With the mass concentration of the aconitine reference solution as the ordinate and the absorbance value as the abscissa, a standard curve was plotted to obtain a linear regression equation.

[0069] The raw aconite slices were crushed with a pulverizer, and 0.2 g of the raw aconite powder was taken and placed in 20 mL of acetate buffer solution. After soaking overnight, it was filtered with a dry filter paper. 10 mL of the filtrate was taken and 10 mL of bromocresol green indicator solution was added. After shaking, it was left to stand for 10 min. They were respectively extracted 3 times with 10, 10, and 5 mL of chloroform. After extraction, the chloroform layer was filtered into a 100 mL volumetric flask and diluted to 100 mL with chloroform. The absorbance value A was measured at a wavelength of 413 nm with a UV spectrophotometer. According to the absorbance value A of the raw aconite solution, the corresponding aconitine mass concentration C was calculated by substituting it into the standard curve. According to the mass of the raw aconite added in the experiment, the aconitine content (mg / g) in the raw aconite slices was calculated. The calculation formula was:

[0070] Aconitine content = (mass concentration of prepared solution of Aconiti Lateralis Radix Praeparata × 2 × volume of constant volume) / weighed sample amount of Aconiti Lateralis Radix Praeparata powder.

[0071] The test results are shown in Figure 4 , Figure 4 where A is the promoting effect of strain YN-2-6S on the fresh weight of the aboveground and underground parts of Aconitum plants, and B is the promoting effect of strain YN-2-6S on the accumulation of total alkaloids in the secondary roots of Aconitum.

[0072] As Figure 4 shown, the fresh weight of the aboveground part and the underground part of the Aconitum plants treated with strain YN-2-6S increased by 56.57% and 50.59% respectively, both reaching a significant level. The treatment with strain YN-2-6S increased the total alkaloid content in Aconiti Lateralis Radix Praeparata by 1.09 mg / g, reaching a significant level. This indicates that the endophytic bacterium YN-2-6S (Bacillus velezensis) isolated in the present invention can not only secrete dextranase, cellulase and protease, but also significantly promote the growth of Aconitum plants and increase the yield of commercial Aconiti Lateralis Radix Praeparata, and has a very good promoting effect on the accumulation of total alkaloids in the secondary roots of Aconitum.

[0073] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present invention rather than to limit them. Although the present invention has been described in detail with reference to the examples, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered by the scope of the claims of the present invention.

Claims

1. An endophyte YN-2-6S (Bacillus velezensis) for increasing the alkaloid content in Aconitum, characterized in that: The endophyte YN-2-6S was deposited on December 2, 2024 at the Guangdong Provincial Microbiological Culture Collection Center, Building 59, 5th Floor, No. 100 Xianlie Middle Road, Guangzhou, with the deposit number GDMCC No: 65573.

2. A bacterial suspension, characterized in that: Including the endophyte YN-2-6S described in claim 1.

3. A fermentation broth, characterized in that: The endophyte YN-2-6S is cultivated according to claim 1.

4. The fermentation broth according to claim 3, characterized in that Its preparation method is: Inoculate a single colony of YN-2-6S into LB medium and culture at 25-30°C and 100-120 rpm / min until the bacterial count in the solution is greater than 4.5×10 8 CFU / mL, the fermentation broth was separated and obtained.

5. A bacterial agent, characterized in that It comprises the endophyte YN-2-6S according to claim 1, the bacterial suspension according to claim 2, or the fermentation broth according to claim 3 or 4.

6. Use of the endophytic bacterium YN-2-6S according to claim 1, the bacterial suspension according to claim 2, the fermentation broth according to claim 3 or 4, or the bacterial agent according to claim 5 in increasing the alkaloid content in Aconitum.

7. A preparation for increasing the alkaloid content in Aconitum, characterized in that: The endophytic bacteria YN-2-6S according to claim 1, the bacterial suspension according to claim 2, the fermentation broth according to claim 3 or 4, or the bacterial agent according to claim 5 is used as the active ingredient.

Images