Bordetella with benzopyrene degrading capability and application of Bordetella
By providing the Bordeaux GDJH02 strain and its biochar compound bacteria agent, the problems of low removal efficiency and poor environmental adaptability in the prior art are solved, and efficient and economical benzopyrene degradation effect is achieved.
Patent Information
- Application Number
- CN202510289270.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-12
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art has problems such as high energy consumption, high cost and high secondary pollution risk in removing polycyclic aromatic hydrocarbons, especially benzopyrene, and bacteria generally have poor degradation effects on benzopyrene.
A strain of Bordetella sp. GDJH02 is provided, which can efficiently degrade benzopyrene and prepare a complex bacteria agent for soil repair through complexing treatment with biochar.
The degradation rate in water can reach more than 75% in 7 days, and in soil can reach more than 70% in 14 days, significantly improving the degradation efficiency of benzopyrene and showing efficient degradation ability in complex environments.
Smart Images
Figure CN120060061A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of environmental remediation microorganisms and their applications, and particularly relates to a Bordetella bacterium with the ability to degrade benzo[a]pyrene and its applications. Background Art
[0002] Polycyclic Aromatic Hydrocarbons (PAHs) are widely distributed, have multiple sources and are carcinogenic. Currently, they have become a class of persistent organic pollutants restricted by concentration in the standards formulated in multiple fields such as industry, food, and the environment. Among them, Benzo[a]pyrene (BaP), as a representative strong carcinogenic substance in PAHs, is widely present in automobile exhaust, petrochemical refining exhaust, and the flue gas generated by the combustion of various carbon blacks, coals, oils, etc. It has three carcinogenic effects, namely strong carcinogenicity, mutagenicity, and teratogenicity, and also produces a photo-toxic effect. Moreover, it has the characteristics of large concealment, long latency, wide coverage, and difficult treatment in the soil.
[0003] Current research shows that PAHs can be removed by physical, chemical, and biological methods. Among them, physical methods (adsorption method, membrane separation method, extraction method, etc.) and chemical methods (advanced oxidation technology, chemical oxidation-reduction, etc.) have disadvantages such as high energy consumption, high cost, and high risk of secondary pollution in removing benzo[a]pyrene, which limits their application in actual environmental remediation. The biological method, compared with the other two methods, mainly relies on microbial metabolism and is significantly prominent due to its low cost and environmental friendliness. The strains reported to degrade benzo[a]pyrene currently mainly include Alcanivorax xenomutans, Rhodococcus, Pseudomonas sp., Mycobacterium sp., Acinetobacter sp., etc. Based on the persistence, toxicity of benzo[a]pyrene and its potential harm to the ecological environment and human health, the research on its efficient degradation technology has become an important topic in the field of environmental remediation.
[0004] Although bacteria capable of degrading benzo[a]pyrene have been isolated and screened from the environment, the degradation effect of bacteria on benzo[a]pyrene is generally poor, and the degradation application system is incomplete. Therefore, there is an urgent need to further develop bacteria with high benzo[a]pyrene degradation efficiency and improve their adaptability and efficiency in the soil medium. In summary, seeking functional microorganisms with high degradation effects and making them adaptable to benzo[a]pyrene in different polluted environments through immobilization has become an important way for the treatment of PAH pollution. Summary of the Invention
[0005] To overcome the deficiencies of the above-mentioned prior art, the present invention provides a strain of Bordetella sp. GDJH02 with the ability to degrade benzo[a]pyrene. This strain has a high degradation efficiency. After being applied at a volume concentration of 15% in the inoculated water body, the degradation rate can reach more than 75% within seven days. At the same time, after being made into a Bordetella-biochar composite bacterium agent material, the degradation effect can reach more than 70% in the soil environment within 14 days, showing important application prospects in the field of environmental remediation.
[0006] To achieve the above object, the technical solution adopted by the present invention is as follows:
[0007] The first aspect of the present invention provides a strain of Bordetella sp. GDJH02. The Bordetella sp. GDJH02 strain was deposited at the China Center for Type Culture Collection on January 14, 2025, with the deposit number CCTCC NO: M 2025124.
[0008] Preferably, the 16S DNA of the Bordetella sp. GDJH02 strain is as shown in SEQ ID NO: 1.
[0009] The second aspect of the present invention provides the application of the Bordetella sp. GDJH02 strain described in the first aspect in the degradation of environmental polycyclic aromatic hydrocarbons.
[0010] Preferably, the polycyclic aromatic hydrocarbon is benzo[a]pyrene.
[0011] A new strain of Bordetella sp. GDJH02 was isolated from the soil of a coking site in Shaanxi and deposited at the China Center for Type Culture Collection on January 14, 2025, with the deposit number CCTCC NO: M2025124. This bacterium is Gram-negative, rod-shaped, yellow and opaque, with a smooth surface, and the colony diameter is 1-2 mm. The Bordetella sp. screened by the present invention can be used for the degradation of benzo[a]pyrene in the environment, and the degradation efficiency of benzo[a]pyrene can be as high as more than 75%. And compared with the reported benzo[a]pyrene-degrading bacteria, the Bordetella sp. GDJH02 strain in the present invention can efficiently treat soil or water bodies contaminated with benzo[a]pyrene.
[0012] Preferably, the environment is water or soil.
[0013] The third aspect of the present invention provides a bacterium agent for degrading polycyclic aromatic hydrocarbons, and the bacterium agent uses the Bordetella sp. GDJH02 strain described in the first aspect as the main active ingredient.
[0014] Preferably, the bacterial agent includes the Bordetella sp. GDJH02 strain described in the first aspect and biochar immobilizing the GDJH02 strain.
[0015] The fourth aspect of the present invention provides a method for degrading polycyclic aromatic hydrocarbons in the environment, specifically: inoculating the Bordetella sp. GDJH02 strain described in the first aspect into water or soil containing polycyclic aromatic hydrocarbons, and after cultivation, the polycyclic aromatic hydrocarbons can be degraded; the cultivation time in water is more than 7 days, and the cultivation time in soil is more than 14 days.
[0016] Preferably, in terms of volume fraction, the inoculation amount of the GDJH02 strain in water is 10-20%.
[0017] Preferably, the inoculated GDJH02 strain is a live bacterium or an immobilized composite bacterial agent.
[0018] Preferably, the activation method of the GDJH02 strain is: using aseptic operation technique, streak inoculating a single colony of Bordetella sp. GDJH02 on an LB slant medium (30 °C, 16 h); after the bacterial growth is sufficient, take the bacteria in the typical growth area and stab-transfer them to a fresh same-type medium for secondary activation (30 °C, 16 h) to complete the two-stage activation culture of the strain.
[0019] Compared with the prior art, the beneficial effects of the present invention are:
[0020] A new Bordetella sp. GDJH02 strain was isolated from the soil of a coking site in Shaanxi. The screened Bordetella sp. GDJH02 strain can be used for the degradation of benzo[a]pyrene. When the benzo[a]pyrene-degrading bacteria are inoculated into a liquid medium with a benzo[a]pyrene concentration of about 5 mg / L at a ratio of 15%, after 7 days of cultivation, more than 75% of the benzo[a]pyrene in the medium can be degraded. The screened GDJH02 strain of the present invention shows more significant degradation performance advantages compared with the reported benzo[a]pyrene-degrading strains. At the same time, the composite bacterial agent prepared by biochar immobilization technology based on the GDJH02 strain also shows excellent performance in soil remediation applications. When applied to soil contaminated with benzo[a]pyrene, the degradation rate can reach more than 70% after 14 days. Description of the Drawings
[0021] Figure 1 It is the electron micrograph of the GDJH02 strain;
[0022] Figure 2 It is the phylogenetic tree of the Bordetella sp. GDJH02 strain;
[0023] Figure 3 It is the efficiency curve graph of the degradation of benzo[a]pyrene in water by GDJH02 strain on the 0th, 1st, 3rd, 5th, and 7th days;
[0024] Figure 4 It is the efficiency curve graph of the degradation of benzo[a]pyrene in soil by GDJH02 complex bacterial agent on the 0th, 1st, 3rd, 5th, 7th, and 14th days. Specific implementation manners
[0025] The specific implementation manners of the present invention will be further described below. It should be noted here that the description of these implementation manners is used to help understand the present invention, but does not constitute a limitation to the present invention. In addition, the technical features involved in the various implementation manners of the present invention described below can be combined with each other as long as they do not conflict with each other.
[0026] The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are all available through conventional commercial channels unless otherwise specified.
[0027] The present invention provides a Bordetella sp. GDJH02 strain with the ability to degrade benzo[a]pyrene. This strain can efficiently degrade benzo[a]pyrene and achieve the remediation of benzo[a]pyrene pollution in water or soil.
[0028] The acquisition of Bordetella sp. GDJH02 strain and its degradation effect on benzo[a]pyrene will be further described below in combination with Examples 1-3.
[0029] Example 1: Acquisition of Bordetella sp. GDJH02 strain
[0030] In this example, the sample for screening the strain was from the soil sample of Jinma Coking Site in Hancheng, Shaanxi Province (35.606°N, 110.550°W). The screening method was as follows:
[0031] (1) Enrichment and domestication: Weigh 10 g of soil sample, add it to 90 mL of sterile water, shake for 3 h, let it stand for 30 min, take 10 mL of the supernatant and transfer it to 90 mL of inorganic salt medium containing 1 mg / L of benzo[a]pyrene, and culture it in the dark on a shaker at 30 °C and 150 r / min. Every 7 days, transfer 10 mL of the bacterial liquid to 90 mL of sterilized inorganic salt-benzo[a]pyrene liquid medium for enrichment culture. Each time after transfer, the concentration of benzo[a]pyrene is increased by 1 mg / L. After transferring 4 times in this way, the final concentration of benzo[a]pyrene is 5 mg / L.
[0032] Among them, the formula of the benzo[a]pyrene inorganic salt medium is as follows: CuCl 2 ·2H2 O, 0.001 mg; FeSO 4 ·7H 2 O, 0.2 mg; KH 2 PO 4 , 1000 mg; Na 2 HPO 4 , 2800 mg; (NH 4 ) 2 SO 4 , 500 mg; Na 2 EDTA, 0.5 mg; H 3 BO 3 , 0.03 mg; CoCl 2 ·6H 2 O, 0.02 mg; FeSO 4 ·7H 2 O, 0.2 mg; ZnSO 4 ·7H 2 O, 0.2 mg; Na 2 MoO 4 ·2H 2 O, 0.003 mg; MnCl 2 ·4H 2 O, 0.003 mg; NiCl 2 ·6H 2 O, 0.002 mg. Dissolve the above substances in pure water, mix well and make up the volume to 1 L, and adjust the pH to 7.0.
[0033] The preparation of the benzo[a]pyrene stock solution is as follows: Dissolve the standard substance of benzo[a]pyrene monomer in acetone to prepare a benzo[a]pyrene acetone solution with a final concentration of 1000 mg / mL, store it sealed at -20 °C, and use it simultaneously for preparing benzo[a]pyrene solutions with other concentrations.
[0034] (2) Separation and purification: Take 0.1 mL of the culture solution from the last step, dilute it to different gradients (10 -1 ~10 -4 ), then spread it on a plate coated with 1 mg / L benzo[a]pyrene-solid culture medium. Invert the petri dish and place it in an incubator, and culture it in the dark at 30 °C for 1 day. After obvious colonies appear on the medium, pick the single bacteria with obvious hydrolysis zones around them respectively and inoculate them on a solid culture plate containing 2 mg / L benzo[a]pyrene. Then, transfer the bacteria to a benzo[a]pyrene-solid medium with a concentration of 5 mg / L in the same way. Then, pick the strains with different colony morphologies and repeatedly streak and purify them on the benzo[a]pyrene-solid medium until there is only one single colony in the benzo[a]pyrene-solid medium, and obtain the pure cultured strain, labeled as GDJH02( Figure 1 ).
[0035] The colonies obtained by the above purification were identified, and the identification results are as follows:
[0036] 1) The screened strain GDJH02 was Gram-negative. Observed under an electron microscope, its morphology was rod-shaped, with a smooth surface and no flagella. Cultured on LB medium at 30 °C for 24 h, the shape was round, light yellow, with a smooth and raised surface, and the colony diameter was 1-2 mm.
[0037] 2) The physiological and biochemical properties of this strain were identified, and the results are shown in Table 1.
[0038] Table 1 Physiological and biochemical characteristics of strain GDJH02
[0039]
[0040] 3) The 16S gene of strain GDJH02 was amplified and sequenced using the bacterial 16S universal primers 27F and 1492R (27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT), and the obtained 16S sequence results are shown in SEQ ID NO: 1.
[0041] The sequencing results were compared in the NCBI database. The results showed that it had the highest similarity with Bordetella muralis strain T6220-3-2b (NR 145920.1), reaching 99.79%, and a phylogenetic tree was constructed and analyzed with homologous strains ( Figure 2 ). Based on the above physiological and biochemical characteristics, 16S rRNA gene sequence results and phylogenetic tree, it was determined that the strain screened in the present invention should belong to a new variant of the genus Bordetella, named Bordetella sp. GDJH02 (hereinafter referred to as strain GDJH02).
[0042] The Bordetella sp. GDJH02 was deposited at the China Center for Type Culture Collection (CCTCC) on January 14, 2025. The deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: M 2025124.
[0043] Bordetella sp. GDJH02 16S DNA (SEQ ID NO: 1):
[0044]
[0045] Example 2: Performance Test on the Degradation of Benzo[a]pyrene in Water by Bordetella sp. GDJH02
[0046] This example is about the application of Bordetella sp. GDJH02 strain in the degradation of organic pollutants in water to achieve efficient degradation of benzo[a]pyrene. The method for experimentally verifying the benzo[a]pyrene degradation ability of Bordetella sp. GDJH02 strain is as follows:
[0047] (1) Water degradation experiment: Inoculate the GDJH02 strain into LB liquid medium, place it in a shaker, and culture it at 30 °C and 150 r / min for 16 h. After centrifuging at 8000 rpm for 5 min, discard the medium, wash the cell precipitate twice with sterilized normal saline, and then resuspend the cell precipitate with inorganic salt medium to make its OD 600 = 1.0 for standby. Transfer it to the inorganic salt medium with 5 mg / L benzo[a]pyrene as the sole carbon source at an inoculation amount of 15% (v / v), and culture it in a shaker at 30 °C and 150 r / min for 7 days. Detect the residual benzo[a]pyrene in the culture system on the 1st, 3rd, 5th, and 7th days after inoculation, so as to calculate the degradation rate of the strain to benzo[a]pyrene. All single-factor experiments calculate the degradation rate according to the formula: BaP degradation rate (%) = (1 - experimental measured value / blank measured value) × 100%. Each treatment is repeated 3 times, and at the same time, a sterile treatment is set as the blank control group.
[0048] (2) Detection method of benzo[a]pyrene: After sampling 1 mL at a fixed time point, centrifuge it at 8000 rmp and 4 °C for 5 min to separate the liquid from the bacterial liquid, pour out as much supernatant as possible, then extract it with an equal volume of dichloromethane, repeat the extraction 2 times, combine the extraction liquids, blow it to less than 1 mL with nitrogen, and then make up the volume to 1 mL with acetonitrile for high performance liquid chromatography (HPLC) analysis.
[0049] The chromatographic column uses Athena C18 (4.6×50 mm, 5 μm, ), the mobile phase uses 90% acetonitrile and 10% pure water, the column oven temperature is room temperature, the flow rate is 0.5 mL / min, the detection wavelength is 268 nm, the injection needle is washed and then injected, the injection volume is 10 μL, qualitative analysis is carried out by retention time, and quantitative analysis is carried out by peak area. The results of the degradation of benzo[a]pyrene in water by the GDJH02 strain are shown in Table 2.
[0050] Table 2 Efficiency Table of the Degradation of Benzo[a]pyrene by the GDJH02 Strain
[0051]
[0052] The degradation efficiency curve is asFigure 3 As shown, the degradation efficiency is positively correlated with the reaction time. As the reaction time progresses, the degradation rate gradually increases, and the degradation rate reaches 75% on the seventh day.
[0053] The above experimental results of the degradation of benzo[a]pyrene in water by Bordetella sp. GDJH02 strain indicate that after 7 days of continuous reaction, the system finally reaches a degradation equilibrium, and the degradation rate is above 75%, indicating that this strain can significantly improve the degradation efficiency of benzo[a]pyrene and achieve efficient degradation.
[0054] Example 3: Performance test of the composite bacterium agent of Bordetella sp. GDJH02 for the degradation of benzo[a]pyrene in soil
[0055] This example is about the application of the composite bacterium agent of Bordetella sp. GDJH02 in the degradation of organic pollutants in soil to achieve efficient degradation of benzo[a]pyrene in soil. The method for experimentally verifying the degradation ability of this new composite bacterium agent is as follows:
[0056] (1) Soil contamination: Add 2 mL of 1000 mg / L benzo[a]pyrene stock solution to 400 g of uncontaminated farmland soil located in Panyu District, Guangzhou. Subsequently, thoroughly mix the soil on a rotary shaker for 2 days, and then take out the soil and place it in a fume hood to air dry for one week. Finally, place the obtained soil in a dark room for two weeks of aging for the repair experiment. At this time, the initial concentration of the benzo[a]pyrene-contaminated soil is actually measured to be 4 - 5 mg / kg.
[0057] (2) Bacterium agent selection and preparation of the composite bacterium agent: Use Bordetella sp. GDJH02 strain as the microbial bacterium agent for this soil repair. Culture the GDJH02 strain to the logarithmic growth phase (OD 600 = 1.0), and set aside. Mix the porous biochar and the bacterium solution at a ratio of 1:100 (w / v) to load the strain onto the biochar to prepare a composite biological bacterium agent (PBCM) for the repair of benzo[a]pyrene-contaminated soil.
[0058] (3) Laboratory experiment for the degradation of benzo[a]pyrene-contaminated soil: Use this composite biological bacterium agent to conduct a degradation experiment on benzo[a]pyrene-contaminated soil. The experimental design is that the control group is not treated with anything, and the experimental group is treated with the free single bacterium and the composite biological bacterium agent of biochar. Three parallels are set for each experimental group. Each group of experiments is carried out in a system of 20 g of soil and 0.02 g of the composite biological bacterium agent (the amount of bacteria in the free single bacterium group is the same as that in the composite biological bacterium agent group). Cultivate statically in the dark under natural conditions, spray sterile water every day to make up for the lost moisture, and take samples on the 1st, 3rd, 5th, 7th, and 14th days to detect the concentration of residual benzo[a]pyrene in the soil.
[0059] (4) Detection of the BaP content in the soil: Add Na2 SO 4 Mix it with the mixed soil at a mass ratio of 1:1 and then remove the moisture. Then, treat the mixed soil (1 g) with n-hexane / dichloromethane (20 mL) at a volume ratio of 1:1 on a multi-tube vortex mixer at a speed of 2500 rmp, shake and mix evenly for 30 minutes, and finally collect the solvent. Repeat the above process three times and combine the solvents. Then, rotary evaporate the mixed solvent to less than 0.5 mL, re-add 1 mL of the mixed solution (1:1 n-hexane / dichloromethane), blow it with high-purity nitrogen (purity > 99.99%), and then redissolve BaP in acetonitrile (1 mL) for high-performance liquid chromatography (HPLC) analysis.
[0060] The results of the degradation of benzo[a]pyrene in soil by strain GDJH02 are shown in Table 3, and the degradation efficiency curve is as Figure 4 shown. The results indicate that the degradation process shows an obvious time-dependence, and its degradation rate continuously increases with the extension of the reaction time, reaching 71% at 14 days. Compared with the reported free bacteria system (Aziz, A., Agamuthu, P., Alaribe, F. O., & Fauziah, S. H. (2018). Biodegradation of benzo[a]pyrene by bacterial consortium isolated from mangrove sediment. Environmental Technology, 39(4), 527–535. https: / / doi.org / 10.1080 / 09593330.2017.1305455.), the degradation rate has been greatly improved.
[0061] The above results of the experiment on the degradation of benzo[a]pyrene in soil by strain Bordetella sp. GDJH02 show that by the 14th day, the degradation efficiency tends to be saturated, the degradation system reaches equilibrium, and the degradation efficiency can reach more than 70%. It shows that the immobilized technology is used to immobilize the degrading bacteria, enabling the efficient degradation of benzo[a]pyrene-contaminated soil.
[0062] Table 3 Data table for the remediation of benzo[a]pyrene-contaminated soil
[0063]
[0064] As can be seen from the above three embodiments, the Bordetella sp. GDJH02 strain provided by the present invention shows a significant degradation effect in the degradation of benzo[a]pyrene. Among them, the GDJH02 strain was added to a liquid medium with an initial concentration of benzo[a]pyrene of about 5 mg / L at an inoculation ratio of 15%. After 7 days of cultivation, the highest degradation rate of benzo[a]pyrene can reach 75%. Compared with the benzo[a]pyrene-degrading bacteria reported in the existing literature (Liang, C., Ye, Q., Huang, Y., Wang, Y., Zhang, Z., & Wang, H. (2022). Shifts of the new functional marker gene (pahE) of polycyclic aromatic hydrocarbons (PAHs) degrading bacterial population and its relationship with PAHs biodegradation. Journal of Hazardous Materials, 437, 129305. https: / / doi.org / 10.1016 / j.jhazmat.2022.129305.), the degradation efficiency of benzo[a]pyrene by this strain was effectively improved. In addition, after the GDJH02 strain of the present invention was constructed into a new type of composite immobilized microbial agent with biochar as the carrier, the treatment efficiency of benzo[a]pyrene-contaminated soil was significantly improved, demonstrating its wide applicability and high degradation ability in complex environmental systems.
[0065] The above has described the embodiments of the present invention in detail, but the present invention is not limited to the described embodiments. For those skilled in the art, without departing from the principle and spirit of the present invention, various changes, modifications, substitutions, and variations made to these embodiments still fall within the protection scope of the present invention.
Claims
1. A Bordetella sp. GDJH02 strain, characterized in that: The Bordetella GDJH02 strain was deposited in the China Center for Type Culture Collection on January 14, 2025, with the deposit number CCTCC NO: M2025124.
2. The Bordetella sp. GDJH02 strain according to claim 1, characterized in that: The 16S DNA of the Bordetella GDJH02 strain is shown in SEQ ID NO:
1.
3. Use of the Bordetella sp. GDJH02 strain according to claim 1 or 2 in the degradation of environmental polycyclic aromatic hydrocarbons.
4. The use according to claim 3, characterized in that: The polycyclic aromatic hydrocarbon is benzopyrene.
5. The use according to claim 3, characterized in that: The environment is water or soil.
6. A bacterial agent for degrading polycyclic aromatic hydrocarbons, characterized in that: The bacterial agent uses the Bordetella sp. GDJH02 strain described in claim 1 or 2 as a main active ingredient.
7. The bacterial agent for degrading polycyclic aromatic hydrocarbons according to claim 6, characterized in that: The bacterial agent includes the Bordetella sp. GDJH02 strain according to claim 1 or 2 and biochar for immobilizing the GDJH02 strain.
8. A method for degrading polycyclic aromatic hydrocarbons in the environment, characterized in that: The Bordetella sp. GDJH02 strain described in claim 1 or 2 is inoculated into water or soil containing polycyclic aromatic hydrocarbons, and the polycyclic aromatic hydrocarbons can be degraded after cultivation; wherein the cultivation time in water is more than 7 days, and the cultivation time in soil is more than 14 days.
9. A method for degrading polycyclic aromatic hydrocarbons in the environment according to claim 8, characterized in that: Calculated by volume fraction, the inoculation amount of GDJH02 strain in the water body is 10-20%.
10. The method for degrading polycyclic aromatic hydrocarbons in the environment according to claim 8, characterized in that: The inoculated GDJH02 strain is a live bacterium or an immobilized composite bacterial agent.