Deep sea desert bacillus yw6 with carbon sequestration function and application of deep sea desert bacillus yw6

Abstract

The invention discloses abyssal desert bacillus yw6 with a carbon sequestration function and application of the abyssal desert bacillus yw6, and belongs to the technical field of biology. According to the invention, the bacillus safensis yw6 is screened from sediments of a Mariina sea ditch, and the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.32498. The bacillus safensis yw6 is gram-positive bacteria and can mineralize a CaCl2 solution to form white mineral precipitates, the action mechanism of the carbon sequestration function of the bacillus safensis yw6 is to produce extracellular carbonic anhydrase, and the carbonic anhydrase can convert CO2 into CO32 and combine the CO32 into insoluble carbonate to achieve the purpose of carbon sequestration. Carbonic anhydrase heterologous expression engineering bacteria are constructed by using the carbonic anhydrase gene of the yw6 strain and adopting escherichia coli, carbonic anhydrase with higher activity is obtained, and basis and method reference are provided for large-scale preparation of carbonic anhydrase.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a deep-sea Bacillus safensis yw6 with carbon fixation function and its application. Background Art

[0002] Common CO 2 fixation methods include physical method, chemical method and biological method, etc. Physical method and chemical method consume a large amount of energy and are not environmentally friendly. Biological method for fixing CO 2 is green and environment-friendly, mainly through the action of plants and microorganisms. From the perspective of the entire biosphere, microbial fixation of CO 2 is of great significance for environmental protection and resource and energy conservation. Microbial carbon fixation pathways include heterotrophic microbial pathways: Microorganisms secreting extracellular carbonic anhydrase catalyze the reversible hydration and dehydration of CO 2 and HCO 3 − respectively through secreting extracellular carbonic anhydrase (CA), and generate stable minerals in the presence of Ca 2+ . Representative organisms include Bacillus safensis, Pseudomonas fluorescens, etc. Carbonic anhydrase provides a better and environmentally friendly enzymatic pathway for CO 2 solidification.

[0003] Carbonic anhydrase is a class of metal co-ion containing enzymes, and its main function is to reversibly catalyze the carbon dioxide hydration reaction. The chemical reaction it catalyzes is efficient and reversible. Different types of carbonic anhydrases play the same role in different organisms, and all have CO 2 hydratase activity, and can reversibly catalyze the hydration reaction of CO 2 . Therefore, screening a new strain containing carbonic anhydrase gene is of great significance for carbon fixation. Summary of the Invention

[0004] The purpose of the present invention is to provide a deep-sea Bacillus safensis yw6 with carbon fixation function and its application. The present invention screened a Bacillus safensis yw6 with carbon fixation function from the sediments of the Mariana Trench, determined the carbonic anhydrase candidate gene through whole genome data analysis and bioinformatics analysis, and achieved the heterologous expression of this carbonic anhydrase through DNA recombination technology.

[0005] To achieve the above-mentioned invention purpose, the present invention is implemented by adopting the following technical solutions: The present invention provides a deep-sea Bacillus safensis yw6 with carbon fixation function, whose taxonomic name is Bacillus safensis , and it is deposited in the General Microbiological Center of the China Committee for Culture Collection of Microorganisms, with the deposit number of CGMCC No. 32498.

[0006] The present invention also provides a carbonic anhydrase produced by Bacillus safensis yw6 as described above.

[0007] Furthermore, the carbonic anhydrase is β - type carbonic anhydrase β - CA1 as shown in SEQ ID No.4, or β - type carbonic anhydrase β - CA2 as shown in SEQ ID No.5, or γ - type carbonic anhydrase γ - CA as shown in SEQ ID No.6.

[0008] Furthermore, the nucleotide sequences of the encoding genes of the carbonic anhydrase are respectively as shown in SEQ ID No.1, or as shown in SEQ ID No.2, or as shown in SEQ ID No.3.

[0009] The present invention also provides a recombinant vector which contains the carbonic anhydrase gene as shown in SEQ ID No.1, or as shown in SEQ ID No.2, or as shown in SEQ ID No.3.

[0010] The present invention also provides a genetically engineered bacterium which contains the recombinant vector as described above.

[0011] The present invention also provides the application of the Bacillus safensis yw6 as described above or the genetically engineered bacterium in the production of carbonic anhydrase.

[0012] Furthermore, the induction production conditions of the carbonic anhydrase are: induction production for 29 h - 35 h under the conditions of 15℃ - 18℃ and 0.6 mM - 0.8 mM IPTG.

[0013] Furthermore, the optimal induction production conditions for the carbonic anhydrase β - CA1 are induction for 35 h under the conditions of 16℃ and 0.6 mM IPTG; the optimal induction production conditions for the carbonic anhydrase β - CA2 are induction for 29 h under the conditions of 16℃ and 0.8 mM; the optimal induction production conditions for the carbonic anhydrase γ - CA are induction for 35 h under the conditions of 15℃ and 0.7 mM.

[0014] Compared with the prior art, the advantages and beneficial effects of the present invention are as follows: 1. The present invention uses the 2 water - combining method to screen out a Bacillus safensis yw6 with the highest carbonic anhydrase activity from deep - sea strains of Mariana Trench sediments. Cultivate this bacterium on a solid medium containing CaCl Bacillus safensis and test the calcification ability of the strain, proving that Bacillus safensis yw6 can be effectively used for carbon fixation. 2 2. The present invention uses

[0015] 2. The present invention uses Bacillus safensisConstruct a heterologous expression engineering bacterium with the carbonic anhydrase gene of yw6 strain, and its extracellular enzyme activity is stronger than that of the wild strain. The heterologous expression of carbonic anhydrase provides the possibility for the industrial preparation of carbonic anhydrase and a new solution for carbon sequestration. Description of the Drawings

[0016] Figure 1 shows the morphology of the yw6 strain, where A is the plate morphology of the yw6 strain and B is the Gram staining morphology of the yw6 strain (400×); Figure 2 shows the carbon fixation by calcification of the yw6 strain, where A is the white precipitate formed by calcification of the yw6 strain and B is the scanning electron micrograph of the white precipitate; Figure 3 shows the phylogenetic tree of the yw6 strain; Figure 4 shows the optimal growth conditions of the yw6 strain, where A is the growth curve at the optimal temperature, B is the growth curve at the optimal pH, and C is the growth curve at the optimal salinity; Figure 5 shows the tertiary structure of the carbonic anhydrase protein, where A is the prediction of the tertiary structure of the β-CA1 protein, B is the prediction of the tertiary structure of the β-CA2 protein, and C is the prediction of the tertiary structure of the γ-CA protein; Figure 6 shows the SDS-PAGE electrophoresis of the induced carbonic anhydrase protein, where M: protein Marker; N1: blank supernatant; N2: blank inclusion body; 1: β-CA2 supernatant; 2: β-CA2 inclusion body; 3: γ-CA supernatant; 4: γ-CA inclusion body; 5: β-CA1 inclusion body; 6: β-CA1 supernatant; Figure 7 shows the SDS-PAGE electrophoresis of the purified protein, where A is the SDS-PAGE electrophoresis of the purified β-CA1 protein, B is the SDS-PAGE electrophoresis of the purified β-CA2 protein, and C is the SDS-PAGE electrophoresis of the purified γ-CA protein; Figure 8 shows the optimized conditions for the heterologous expression of carbonic anhydrase, where A is the change trend of the enzyme activity of β-CA1 at different induction times, B is the change trend of the enzyme activity of β-CA1 at different inducer concentrations, C is the change trend of the enzyme activity of β-CA1 at different induction temperatures, D is the change trend of the enzyme activity of β-CA2 at different induction times, E is the change trend of the enzyme activity of β-CA2 at different inducer concentrations, F is the change trend of the enzyme activity of β-CA2 at different induction temperatures, G is the change trend of the enzyme activity of γ-CA at different induction times, H is the change trend of the enzyme activity of γ-CA at different inducer concentrations, and I is the change trend of the enzyme activity of γ-CA at different induction temperatures. Detailed Description of the Invention

[0017] The technical solutions of the present invention will be further described in detail in combination with the following specific examples.

[0018] In the following examples, unless otherwise specified, the experimental methods used are all conventional methods, and the materials, reagents, etc. used can be purchased from biological or chemical reagent companies.

[0019] LB medium liquid: Tryptone 10 g·L -1 , NaCl 10 g·L -1 , Yeast extract 5 g·L -1 , For solid medium, add agar 15 g·L -1 .

[0020] M1 medium: Yeast extract 10 g·L -1 , Tryptone 5 g·L -1 , Glucose 1 g·L -1 , NaCl 30 g·L -1 , For solid medium, add agar 15 g·L -1 .

[0021] Tris-HCl buffer solution: Prepare 20 mM Tris-HCl buffer solution and adjust the pH to 8.0.

[0022] The bacterial genomic DNA purification kit, 2×TransStart FastPfu Fly PCR SuperMix, pEASY-Blunt E1 Expression Kit, Escherichia coli cloning competent cell Trans-T1, and Escherichia coli expression competent cell BL21 (DE3) are all from TransGen Biotech (Beijing).

[0023] Example 1: Screening of carbon-fixing strains (1) Use LB medium for purification and cultivation of test strains. Take an appropriate amount of deep-sea sediment mud sample and place it in LB liquid medium for enrichment culture for 1 - 2 days. After standing, take the supernatant for streak culture, and obtain pure strains after multiple streak separations.

[0024] In the early stage of the present invention, 13 deep-sea strains were screened from the sediments of the Mariana Trench (location: 142°30'22.4664″E, 10°38'5.3374″N; water depth: 5150 m).

[0025] (2) Use CO 2The carbonic anhydrase activity of bacteria was detected by the hydration method. Colonies purified on the LB solid medium were picked and inoculated into 100.0 mL of sterilized LB liquid medium for activation. When the bacterial liquid grew to the logarithmic growth phase, 1.0 mL of the bacterial liquid was taken and inoculated into 100.0 mL of LB medium at an inoculation ratio of 1%. The culture was carried out in a constant temperature incubator at a culture temperature of 26 °C and a rotation speed of 180 r / min until OD 600 = 1.000, and the extracellular carbonic anhydrase activity was determined according to the following steps.

[0026] ① Preparation of saturated carbon dioxide water: Take 500.0 mL of ultrapure water in a screw-capped bottle and pre-cool it in advance until it is completely cool. Place the pre-cooled ultrapure water in an ice bath and introduce CO 2 with a purity of 99.99%. After aeration for 1 h, it was used for the experiment.

[0027] ② Blank determination: Use a pipette to add 4.0 mL of pre-cooled Tris-HCl buffer solution and 2.0 mL of deionized water to a 10.0 mL beaker in sequence, mix well, measure the initial pH value, add 4.0 mL of pre-cooled saturated CO 2 aqueous solution and simultaneously press the start switch of the pH meter and the stopwatch to record the time t0 required for the pH to drop from 8.3 to 6.3. The whole process was carried out in an ice-water bath, and the average value was taken for three parallels.

[0028] ③ Determination of carbonic anhydrase activity: Take 5.0 mL of the bacterial liquid, centrifuge it at 4 °C and 6500 r / min for 5 min, collect the supernatant, mix 2.0 mL of the supernatant and 4.0 mL of pre-cooled 20 mM, pH 8.0 Tris-HCl buffer solution in a 10 mL beaker, measure the pH value, and quickly add 4.0 mL of pre-cooled saturated CO 2 aqueous solution to the beaker with a pipette. At the same time, press the start switch of the pH meter and the stopwatch to record the time t for the pH to drop from 8.3 to 6.3. The whole process was carried out in an ice-water bath, and the average value was taken after repeating three times.

[0029] ④ The formula for calculating the total enzyme activity is U = (t0 - t) / t.

[0030] Among the 13 deep-sea strains, the strain numbered yw6 had the highest carbonic anhydrase activity, which was 0.115 U. This strain was used as the research strain. Observed under an optical microscope, the colony shape of yw6 was round, slightly raised, with a smooth surface, and the color was semi-transparent yellowish-white ( Figure 1 in A). yw6 was stained purple by Gram staining and was a Gram-positive bacterium with a short rod shape ( Figure 1 in B).

[0031] (3) Test the calcification ability on M1 medium: Culture the strain on M1 solid medium coated with 34 mM CaCl 2 solution, and observe the mineral precipitation on the surface of bacterial colonies through a stereomicroscope. Under the stereomicroscope, obvious white calcification precipitation can be seen at the edge of the yw6 colony ( Figure 2 A in).

[0032] (4) Observe the morphology of mineral precipitation under the electron microscope: Collect the mineral-like precipitation on the colony surface, slowly wash the surface bacteria with pure water, dry it and then coat it with gold spraying, and observe the surface morphology of the mineral with a field emission scanning electron microscope (FE-SEM). The working distance is 0.8 nm, the acceleration voltage is 15 kV, and the maximum beam current is 2 μA. By observing the sample, it is speculated that it is carbonate mineral precipitation, with a shape of scattered stones and a tendency to become calcite-like ( Figure 2 B in).

[0033] Through 16S rRNA gene phylogenetic tree analysis ( Figure 3 ), the yw6 strain is Bacillus safensis. The growth curve of Bacillus safensis yw6 is as Figure 4 shown. This bacterium has strong adaptability in the range of 30 - 38 °C, pH 5 - 9, and salinity of 0 - 48.

[0034] The screened strain yw6 was preserved. The preservation unit of Bacillus safensis yw6: China General Microbiological Culture Collection Center (CGMCC); Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences; Preservation date: November 4, 2024; The preservation number of Bacillus safensis Bacillus safensis is CGMCC No. 32498.

[0035] Example 2: Screening of carbonic anhydrase gene of Bacillus safensis yw6 The purified yw6 strain was activated and cultured to the logarithmic phase with LB medium. Take 2 μL for 16S rDNA sequencing to determine that the strain is free of contaminating bacteria. The remaining part was centrifuged at 4,000×g for 10 min (4 °C), and the bacterial cells were collected in 2 sterile 1.5 mL EP tubes. After washing twice with sterile water, they were quickly placed in liquid nitrogen for temporary freezing storage, and then sent by dry ice insulation after ensuring no contaminating bacteria. The whole genome sequencing of yw6 was carried out using the third-generation real-time sequencing system, and after quality control filtering, assembly, alignment, and annotation were performed.

[0036] The original sequencing sequences were filtered to obtain valid data. The number of reads was 73,744, the average sequence read length was 15,761 bp, with a total of 1,162,320,095 bp; the chromosomal genome size was 3,732,752 bp, and the GC content accounted for 41.68% of all bases; the chromosomal genome contained 3,891 protein-coding sequences, with a length of 3,319,392 bp, accounting for 88.93% of the chromosomal genome. 81 tRNAs and 24 rRNAs were predicted as non-coding genes.

[0037] After whole-genome sequencing and mining of yw6, it was found that the genome contained two β-type carbonic anhydrases and one γ-type carbonic anhydrase, and the metal co-ions bound to them were all Zn. 2+ The protein sequences of the three carbonic anhydrases had a distant genetic relationship with the known protein sequences and had a novel structure.

[0038] The β-type carbonic anhydrase β-CA1 was 579 bp in length, and its nucleotide sequence was as shown in SEQ ID No.1. It encoded a total of 192 amino acids, and its amino acid sequence was as shown in SEQ ID No.4. The theoretically relative molecular mass was 22.99 kDa, and the molecular formula was C 1035 H 1666 N 266 O 304 S 9 It contained 20 phosphorylation sites. The β-type carbonic anhydrase β-CA2 was 597 bp in length, and its nucleotide sequence was as shown in SEQID No.2. It encoded a total of 198 amino acids, and its amino acid sequence was as shown in SEQ ID No.5. The theoretically relative molecular mass was 21.67 kDa, and the molecular formula was C 965 H 1572 N 260 O 281 S 11 It contained 12 phosphorylation sites. The γ-type carbonic anhydrase γ-CA was 576 bp in length, and its nucleotide sequence was as shown in SEQ ID No.3. It encoded a total of 191 amino acids, and its amino acid sequence was as shown in SEQ ID No.6. The theoretically relative molecular mass was 20.99 kDa, and the molecular formula was C 936 H 1507 N 261 O 278 S 4 It contained 15 phosphorylation sites. Tertiary structure ( Figure 5 ) prediction found that all three carbonic anhydrases were composed of α-helices, random coils, and extended strands. Among them, the tertiary structure of β-CA was mainly composed of α-helices and random coils, and the proportion of extended strands was small. The proportion of random coils and extended strands in γ-CA was more than that of α-helices.

[0039] SEQ ID No.1: Carbonic anhydrase β-CA1 encoding gene ATGGACAAACGTATGAAACTTTTAGATGAAATCATCGAATATAATCAACAATTTATTGAAGAAAAGAAATACGAAGAATTTACAACAACAAAGTTTCCACAGAAAAAAGCTGTCATTCTATCGTGTATGGATACAAGACTTGTTGAACTGCTTCCGCGTGCAATGAACATGAAAAATGGCGATATTAAGATTGTCAAAAGTGCTGGAGCGCTTGTTTCTCATCCATTTGGAAGTATTATGCGAAGCATTTTAGTTGCTGTGTATGAATTAAATGCTGACGAGGTATATGTCATTGGGCATCATGATTGCGGGATGAGCAAAATTGACAGCCAGACACTTTTAAATAAAGCTGTTGAGCGTGGTATTCCAGAAAAGCGTATTGAAGTACTGGAATACTCAGGAATTGATTTTAAACAGTGGCTCAAAAGCTTTAGTTCAGTTGAAGAGAGCGTGAAGGACAGTGTGTCCGTAGTAAAAAATCACCCGCTTCTTCCATCAGATGTACCTGTACATGGGCTTGTCATTGACCCTGGAACAGGGAAGCTTGACTTAGTTGTCAACGGATATGAAGAAAAGTAA SEQ ID No.2: Carbonic anhydrase β-CA2 encoding gene ATGGGAGATGGCAAAATGGGATCAAAATTAGAACAGATTCTTCAGCACAATTCAGAGTTTGTGAATCAGAGACATTATGAGCCTTACAAAGCGGGGAAATTCCCTGAGAAGAAATTGGTTATTTTAACGTGCATGGATACCCGTCTTTTGGAATTATTGCCGCAATCTATGGGGCTGCGCAATGGGGATGCAAAAATCATTAAGAATGCGGGCGCTATCGTGACACATCCGTTTGGCAGTGTGATGCGGAGTATCCTGCTAGCTATCTATGAGCTAAAGGCAGAGGAAGTATGCATTGTAGGTCATCATGAATGCGGAATGGCAGGTCTTGCGGCGGATCCTTTACTTGAAAAGGCGAAAGCACGCGGAATCGAAGAGAAATGCTTAAGCATTGTGAAAAACTCAGGAGTCGATTTAAAGGGCTGGCTGACAGGCTTTGATTCAGTTGAAGAGAGCGTGGCTCAAAGTGTGAAATTAGTGAAAGAGCATCCACTGATGCCAAGTGATGTGGCTGTTCATGGACTGGTGATTCATCCAGCAACAGGAAAGCTGGATGTCGTTGTGAAAGATAAACTGATTGACCCGCAGTATACCTAA SEQ ID No.3: Carbonic anhydrase γ-CA encoding gene ATGCCAAGTCCACAAAGTAAACACCTCACAAATGTTGTATTAAGAAAGGAAGTCGAAAAAGTGATTTATCCATATCATCAGTTTACACCTGAGATTCATGAATCGGTCTTTGTCGCAGATAACGCCACCATTACCGGTGATGTCTCAATTGGAGAATATTCGAGCGTGTGGTTCCAAACTGTCATCAGAGGCGATGTCGCACCTGTGAGAATTGGAAAGAACGTCAACATTCAAGATTTATCGTGCCTGCATCAAAGTCCTGGAAAAACACTTCTTATTGAAGATGGTGCTACCATTGGACACCAAGTCACATTACATAGCTCAATCATTCGAAAAAATGCCCTCATTGGCATGGGGTCCATCATTCTCGATGGTGCGGAGATCGGCGAAGGCGCCTTTATCGGTGCAGGAAGTCTTGTCCCTCAAGGAAAGGTCATCCCAAAAGGATCACTCGCTTTTGGCCGTCCAGCCAAAGTCGTTCGGCTCTTAACAGATGAAGATATTCAAGACATGGACCGAATCCGCAGAGAATATGTAGAAAAAGGACAATACTATCGTTCCCTTTTATCTCGTTAA。

[0040] Example 3: Heterologous Expression of Carbonic Anhydrase Using the extracted DNA of yw6 as a template, three carbonic anhydrase genes were cloned. The three carbonic anhydrase genes were separately introduced into the cloning competent cell Trans-T1 using the pEASY-Blunt E1 Expression Kit. The plasmids of the positive cloned competent cells were extracted and separately introduced into the expression competent cell BL21(DE3). Heterologous expression of the three carbonic anhydrase genes was carried out by the method of IPTG low-temperature induction. After extracting the proteins heterologously expressed by the engineered bacteria, the heterologous expression of the genes was verified by SDS-PAGE. Specifically as follows: 1. Genomic DNA Extraction The preserved yw6 strain was activated to the logarithmic growth phase with LB liquid medium, and DNA was extracted according to the kit instructions. The extracted DNA was stored in a -80 °C refrigerator.

[0041] 2. Primer Design According to the CA gene sequence of whole-genome sequencing, three primers for the CA gene were designed using the primer premier5 software, and the primer design list is shown in Table 1.

[0042] Table 1 Primers used for CA gene cloning

[0043] 3. CA gene cloning Using the extracted yw6 whole-genome DNA as a template, and using the primers in the primer list of Table 1, according to the reagent dosage and program setting requirements of the 2×TransStart FastPfu Fly PCR SuperMix instruction manual, a 3-CA gene amplification reaction was carried out under the following conditions in a 200 μL PCR tube according to a 20 μL PCR system.

[0044] (1)Reaction system Table 2 Reaction system

[0045] (2)Reaction conditions: Table 3 Reaction conditions

[0046] After the reaction, place the PCR tube on ice. Take 2 μL of the PCR amplification product and electrophorese it on a pre-prepared 1% agarose gel with DNA loading Buffer. Set the electrophoresis voltage to 120 V and run for 20 min. Use a gel imager to detect whether the electrophoresis band conforms to the size of the target gene. The remaining PCR products were sent to the sequencing department of Sangon Biotech Co., Ltd. in Qingdao for purification and sequencing.

[0047] 4. Introduction of the CA gene ligated to the vector into competent cells Use the pEASY-Blunt E1 Expression Kit to ligate the ca gene purified by Sangon Biotech with the Blunt E1 vector and then introduce it into the cloning competent cell Trans-T1. The following operations were carried out according to the instruction manual: (1)Plasmid ligation system: Table 4 Plasmid ligation system

[0048] Gently flick and mix the vector-PCR product ligation solution, let it stand at room temperature for 5 min, and then insert it into an ice bath.

[0049] (2) Pipette 5 μL of the mixed liquid of the ca gene Blunt E1 Expression Vector into 50 μL of the freshly thawed cloning competent cells Trans-T1 in a laminar flow hood, and gently invert the tube up and down to mix well, ensuring that the plasmid is in full contact with the cloning competent cells Trans-T1. Incubate on ice for 25 min.

[0050] (3) Heat shock at 42 °C for 30 s, then quickly insert into an ice bath and let stand for 2 min.

[0051] (4) Add 600 μL of LB liquid medium to the centrifuge tube containing the competent cells, and culture the cloning competent cells in a constant temperature shaker at 200 rmp and 37 °C for 1 h.

[0052] (5) Pipette 80 μL of the culture solution and spread it evenly on the LB solid medium containing Amp antibiotic, and incubate in an inverted position at 37 °C for 12 h.

[0053] 5. Screening of positive cloning competent cells Randomly pick single colonies from the inverted culture plate with a sterilized toothpick, inoculate them into the LB liquid medium containing Amp antibiotic, and culture them in a constant temperature shaker at 160 rmp and 37 °C for 4 - 6 h, followed by PCR amplification and nucleic acid gel electrophoresis detection.

[0054] (1) PCR reaction system: Table 5 PCR reaction system

[0055] (2) PCR program:

[0056] Use a gel imager to detect whether the electrophoresis bands match the size of the target gene, and send the remaining PCR products to Sangon Biotech for sequencing and purification.

[0057] 6. Introduction of the recombinant plasmid into expression competent cells The plasmid sequencing and extraction work is completed by Sangon Biotech. Pipette 5 μL of the recombinant plasmid extracted by Sangon Biotech into 50 μL of the freshly thawed expression competent cells Transetta (DE3), invert the EP tube up and down to mix the mixture well, and react in an ice bath for 25 min. After heat shock at 42 °C for 30 s, quickly insert it into an ice bath and let stand for 2 min. Add 600 μL of LB liquid medium to resuscitate the expression competent cells, then spread them on a plate and incubate in an inverted position for 12 h to screen for positive strains. Culture the positive strains in large quantities in the LB liquid medium containing Amp antibiotic, and store them in a -80 °C refrigerator with glycerol preservation.

[0058] 7. Induced expression and extraction of CA protein (1)Induced expression: After sucking the Blunt E1 Expression Vector with the ca gene and the blank control and inoculating them into the LB liquid medium containing 0.5 mmol / L Amp to activate the bacterial strain, the activated engineering strain was inoculated into 600 mL of the LB liquid medium containing Amp according to an inoculation amount of 1%, and cultured with constant shaking at 160 rmp and 37 °C until the logarithmic growth phase of the bacterial liquid. 600 μL of 0.5 mM IPTG solution was added in the ultra-clean workbench, and induced at 16 °C and 160 rmp in a constant temperature incubator for about 30 h.

[0059] (2)CA protein extraction: The induced expression culture solution was centrifuged at 4 °C and 4500 rmp for 5 min, the supernatant was discarded, and the cells were resuspended with 40 ml of PBS buffer after rinsing 3 times with 1× phosphate buffer (PBS buffer). The resuspended cells were broken by an ultrasonic cell disruptor. The breaking program was set as follows: working for 2 s, interval of 2 s, breaking for 10 min, pausing for 1 min every 4 min, and the whole process was carried out in an ice-water bath until the resuspended solution became clear and transparent. The broken mixture was centrifuged at 4 °C and 6000 rmp for 10 min, the supernatant was collected with a new EP tube, 2 ml of inclusion body dissolution solution was added to dissolve the precipitate, and the extracted protein was stored at -20 °C for subsequent analysis and detection.

[0060] 8. Detection by polyacrylamide gel electrophoresis (1)Sample preparation The protein sample extracted in 5.2.8 was diluted 5 times with 1× PBS buffer, mixed evenly with 6× Protein Loading Buffer according to a ratio of 5:1, placed in a boiling water bath for 10 min, and cooled for standby.

[0061] (2)Electrophoresis detection ① Leak detection: Insert the clean SDS-PAGE electrophoresis glass plate tightly on the electrophoresis rack, add distilled water flush with the glass plate along the edge of the glass plate with a wash bottle, and check whether there is distilled water flowing out after standing for 15 min.

[0062] ② Gel preparation: Prepare 12.5% separating gel according to the PAGE gel rapid preparation kit, slowly add the evenly mixed separating gel along the edge of the glass plate with a pipette dropper, and wait for about 15 min for the separating gel to solidify. Then add the stacking gel with a pipette dropper, insert an 11-well comb, and wait for about 15 min for the stacking gel to solidify.

[0063] ③SDS-PAGE electrophoresis: Place the electrophoresis apparatus in the electrophoresis tank, add 1×Running buffer, suck out the bubbles next to the inner comb with a dropper, pull out the comb vertically, and add Blue Plus Protein Marker and the prepared protein sample into the electrophoresis wells with a pipette. Electrophorese at 120 V for 2 h.

[0064] ④Staining: After electrophoresis, immerse the gel block in Coomassie Brilliant Blue staining solution and stain at 80 - 100 rmp for 1.5 h.

[0065] ⑤Decolorization: After rinsing the Coomassie Brilliant Blue staining solution with water, immerse the gel block in the decolorizing solution and decolorize on a shaker for 1 h to wash off the staining solution.

[0066] 9. Purification and detection of the expressed protein Purify the CA protein with 6 histidine tags at the N-terminus of the protein induced by Blunt E1 Expression Vector and CA recombinant plasmid. Perform protein purification operations according to the instructions of the HisTrap HP histidine-tagged affinity chromatography column. Detect whether the target protein is contained in the collected effluent according to the SDS-PAGE detection method.

[0067] 10. Optimization conditions for carbonic anhydrase Single-factor induction experiment: Induce the expression of three engineering strains under different induction temperatures, different induction times, and different amounts of inducer IPTG used. There are 5 gradients of induction temperature: 11°C, 16°C, 21°C, 26°C, 31°C, and 36°C, 5 gradients of induction time: 25 h, 30 h, 35 h, 40 h, and 45 h, and 6 gradients of the amount of inducer IPTG used: 0.25 mM, 0.5 mM, 0.75 mM, 1.0 mM, 1.5 mM, and 2 mM.

[0068] SDS-PAGE ( Figure 6 ) results show that the target proteins expressed by the 3 engineering strains are all present in the supernatant. There are differences between the apparent molecular weight and the actual molecular weight, and they are all greater than the theoretical relative molecular weight. The electrophoresis detection results show that the sizes of the three carbonic anhydrase proteins are between 25 - 30 kDa.

[0069] After purifying the 3 carbonic anhydrase proteins with a Ni-IDA affinity chromatography column, SDS-PAGE ( Figure 7 ) was used to test the purification situation. The results found that the protein concentrations of β-CA1 and γ-CA after purification were relatively low, and the purification result of β-CA2 was better. The enzyme activities of the 3 carbonic anhydrase were verified by the CO 2 hydration method. The activity of β-CA2 was the best. The enzyme activity before purification was 0.138 U, and the specific activity was 0.641 U / mg.

[0070] Verification of extracellular activity found that the engineered bacteria had stronger activity than the wild bacteria. Through the results of single-factor experiments ( Figure 8 ), the optimal induction conditions for three groups of carbonic anhydrases were finally obtained. For β-CA1, it was induced at 16 °C and 0.6 mM IPTG for 35 h. For β-CA2, it was induced at 16 °C and 0.8 mM for 29 h. For γ-CA, it was induced at 15 °C and 0.7 mM for 35 h. The enzyme activities measured under these conditions were U β-CA1 = 0.097, U β-CA2 = 0.136, and U γ-CA = 0.115, and among the above three influencing factors, the influence of the induction temperature was dominant.

[0071] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, for those of ordinary skill in the art, it is still possible to modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions required to be protected by the present invention.

Claims

1. A deep-sea Bacillus yw6 with carbon fixation function, characterized in that: Its classification is named Bacillus safensis It is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC No.32498.

2. Carbonic anhydrase produced by Bacillus saffron yw6 according to claim 1.

3. The carbonic anhydrase according to claim 2, characterized in that The carbonic anhydrase is β-type carbonic anhydrase β-CA1 as shown in SEQ ID No.4, or β-type carbonic anhydrase β-CA2 as shown in SEQ ID No.5, or γ-type carbonic anhydrase γ-CA as shown in SEQ ID No.

6.

4. The carbonic anhydrase according to claim 3, characterized in that The nucleotide sequence of the gene encoding the carbonic anhydrase is shown as SEQ ID No. 1, or as SEQ ID No. 2, or as SEQ ID No.

3.

5. A recombinant vector, characterized in that: The recombinant vector contains the carbonic anhydrase gene shown in SEQ ID No.1, or shown in SEQ ID No.2, or shown in SEQ ID No.

3.

6. An engineered bacterium, characterized in that: The engineered bacteria contains the recombinant vector according to claim 5.

7. Use of the Bacillus sabdariffa yw6 described in claim 1 or the engineered bacteria described in claim 6 in producing carbonic anhydrase.

8. The use according to claim 7, characterized in that: The induction production conditions of the carbonic anhydrase are: 15°C-18°C, 0.6 mM-0.8 mM IPTG conditions for induction production for 29h-35h.

9. The use according to claim 8, characterized in that: The optimal induction production conditions of carbonic anhydrase β-CA1 were 16℃, 0.6 mM IPTG for 35 h; the optimal induction production conditions of carbonic anhydrase β-CA2 were 16℃, 0.8 mM for 29 h; the optimal induction production conditions of carbonic anhydrase γ-CA were 15℃, 0.7 mM for 35 h.

Images