A Burkholderia strain ZL31 with disease-inhibiting and growth-promoting functions and its application
By using the bacteria agent prepared by Burkholderia ZL31, the pollution problem of tomato root rot is solved, providing broad-spectrum antibacterial and proliferation effects, promoting tomato growth and inhibiting a variety of plant pathogens, and achieving the effect of biological control.
Patent Information
- Application Number
- CN202510488821.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-18
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2045-04-18
AI Technical Summary
The prior art has problems of chemical contamination and enhanced resistance to pathogenic bacteria in preventing and treating tomato root rot, and lacks effective biological control methods.
A strain of Burkholderia ZL31 is provided, which has broad-spectrum antibacterial activity and proliferation properties, which can inhibit a variety of plant pathogens and promote tomato growth. It is fermented in LB liquid culture medium, and is prepared as a bacterial agent for spraying or root irrigation treatment.
Effectively inhibit tomato root rot and other plant diseases, promote tomato growth, improve plant growth, root length, wet and dry weight, and also has the ability to remove inorganic phosphorus, indole-3-acetic acid, iron carrier and cellulase.
Smart Images

Figure CN120060079B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microorganisms, and in particular to a Burkholderia ZL31 strain with the function of inhibiting disease and promoting growth and an application thereof. Background Art
[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.
[0003] Tomato root rot is a widespread and highly contagious root disease of tomatoes, a major cause of tomato yield reduction. The disease primarily affects the roots of infected tomatoes, with the epidermis of infected roots developing a brown or dark brown rotten appearance, a characteristic of root rot. Once infected, tomatoes experience slow plant growth, with lower leaves first turning yellow and gradually spreading upwards. Leaves wilt, appearing as if dehydrated. In severe cases, the entire plant's leaves wither and yellow, roots rot, and the plant ultimately dies. The tomato root rot pathogen has a wide host range and is highly resilient in the soil. Once established, it can severely impact tomato growth and reduce yield.
[0004] Currently, the prevention and control of tomato root rot in production mainly relies on chemical control and agricultural control. However, the long-term and large-scale use of chemical agents can lead to increasingly prominent problems such as pesticide residues, environmental pollution, increased pathogen resistance, and reduced control effectiveness. Therefore, people are gradually turning their attention to other control methods. Biological control, as a green and environmentally friendly control method, is considered to have great development potential. As the damage caused by tomato root rot becomes increasingly serious, it poses a huge threat to tomato production. Therefore, screening biological control strains with good control effects on tomato root rot is an important direction for the prevention and control of tomato root rot and is of vital importance to ensuring the sustainable development of the tomato industry. Summary of the Invention
[0005] In view of this, the present invention provides a strain of Burkholderia ZL31 with the function of inhibiting disease and promoting growth and its application. Specifically, the present invention isolated a strain of Burkholderia ZL31 from the soil at the root of Leiyang pear trees. Burkholderia sp.ZL31, its taxonomic status was determined by 16S rDNA sequencing, and its antibacterial and growth-promoting properties were found to be effective against a variety of plant pathogens such as Alternaria alternata ( Alternaria alternata ), Fusarium fusae ( Fusarium falciforme ), Neoerythraea ( Neocosmospora rubicola ), Fusarium equisetum ( Fusarium equiseti ), Fusarium oxysporum ( Fusarium oxysporum ), Fusarium solani ( Fusarium solani )、Fusarium fujikura(Fusarium fujikuroi ) exhibits broad-spectrum antibacterial activity. Furthermore, the Burkholderia ZL31 strain of the present invention possesses strong growth-promoting properties, capable of degrading inorganic phosphorus, producing indole-3-acetic acid (IAA), siderophores, and cellulase, and can also promote tomato growth. Based on the above research findings, the present invention was completed.
[0006] In order to achieve the above technical objectives, the present invention provides the following technical solutions:
[0007] The first aspect of the present invention provides a Burkholderia ZL31, Burkholderia Burkholderia sp.ZL31 was deposited in the China Center for Type Culture Collection on September 10, 2024, with the deposit number CCTCC NO:M 20241950.
[0008] A second aspect of the present invention provides a derivative of Burkholderia ZL31, including one or more of its live bacteria, inactivated bacteria, fermentation broth, exosomes or metabolites.
[0009] The third aspect of the present invention provides a bacterial agent comprising an active ingredient, wherein the active ingredient comprises Burkholderia ZL31 or a derivative thereof.
[0010] Furthermore, the bacterial agent includes Burkholderia ZL31 and its fermentation broth.
[0011] The fourth aspect of the present invention provides a method for preparing the above-mentioned bacterial agent, the preparation method comprising: inoculating the Burkholderia into LB liquid culture medium, placing it in a shaker at 30°C for fermentation, the culture conditions being pH 7.0±0.2, and the rotation speed being 170~190 r·min -1 , the fermentation time is 24~48 hours.
[0012] A fifth aspect of the present invention provides the use of Burkholderia ZL31 or a derivative of Burkholderia ZL31 or the above-mentioned bacterial agent in any one or more of the following:
[0013] (a) Inhibit tomato root rot;
[0014] (b) suppressing plant pathogens or diseases caused by plant pathogens;
[0015] (c) promoting tomato growth;
[0016] (d) hydrolysis of inorganic phosphorus;
[0017] (e) production of indole-3-acetic acid, siderophores and cellulases;
[0018] Wherein, the plant pathogen is Alternaria alternata ( Alternaria alternata ), Fusarium fusae ( Fusarium falciforme ), Neoerythraea ( Neocosmospora rubicola ), Fusarium equisetum ( Fusarium equiseti ), Fusarium solani ( Fusarium solani )、Fusarium fujikura( Fusarium fujikuroi ); The tomato root rot refers to tomato root rot caused by Fusarium oxysporum ( Fusarium oxysporum ) caused by tomato root rot.
[0019] Furthermore, the promotion of tomato growth is specifically manifested in increasing the plant length, root length, wet weight and dry weight of the tomato plants.
[0020] A sixth aspect of the present invention provides a method for preventing and controlling plant diseases, the method comprising spraying or root irrigation with Burkholderia ZL31 or a derivative of Burkholderia ZL31 or the above-mentioned bacterial agent on a plant, wherein the plant disease is caused by Alternaria alternata ( Alternaria alternata ), Fusarium fusae ( Fusarium falciforme ), Neoerythraea ( Neocosmospora rubicola ), Fusarium equisetum ( Fusarium equiseti ), Fusarium solani ( Fusarium solani )、Fusarium fujikura( Fusarium fujikuroi ) caused by plant diseases; the plant is tomato.
[0021] A seventh aspect of the present invention provides a method for preventing and controlling tomato root rot, the method comprising spraying or irrigating the roots of tomato plants with Burkholderia ZL31 or a derivative of Burkholderia ZL31 or the above-mentioned bacterial agent, wherein the tomato root rot is caused by Fusarium oxysporum ( Fusarium oxysporum ) caused by tomato root rot.
[0022] An eighth aspect of the present invention provides a method for promoting the growth of tomato plants, comprising soaking seeds and irrigating roots with Burkholderia ZL31 or a derivative of Burkholderia ZL31 or the above-mentioned bacterial agent.
[0023] Beneficial technical effects of one or more of the above technical solutions:
[0024] Compared with existing technologies, the Burkholderia ZL31 provided by the present invention exhibits antagonistic activity against tomato root rot and various plant pathogenic fungi in production, demonstrating broad-spectrum antibacterial activity. Furthermore, the Burkholderia ZL31 provided by the present invention has excellent inorganic phosphorus decomposition capabilities and can produce indole-3-acetic acid (IAA), siderophores, and cellulase-based auxins. Therefore, the Burkholderia ZL31 provided by the present invention has great potential for application in the prevention and control of tomato root rot and various important fungal diseases of crops. Furthermore, the Burkholderia ZL31 described by the present invention can promote plant growth, providing an excellent biocontrol resource for the prevention and control of diseases caused by pathogenic fungi in tomatoes. It also provides a reference for the prevention and control of diseases caused by various pathogenic fungi in peppers, potatoes, and other crops. It lays a foundation for the development of new microbial agents and provides new materials for biological control, thus possessing great application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] The accompanying drawings, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.
[0026] Figure 1 The colony morphology and microscopic morphology (100x) of Burkholderia ZL31 in Example 1 of the present invention are shown.
[0027] Figure 2 A Neighbor-Joining phylogenetic tree was constructed for Burkholderia ZL31 in Example 2 of the present invention based on the 16S rRNA gene sequence alignment results.
[0028] Figure 3 This is a diagram showing the antagonistic effect of Burkholderia ZL31 against Fusarium oxysporum in Example 4 of the present invention.
[0029] Figure 4 The antagonistic effect and antibacterial spectrum of Burkholderia ZL31 against various plant pathogenic fungi in Example 5 of the present invention are shown; wherein A is the phenotypic diagram of the Burkholderia ZL31-treated group and the control group, and B is the antibacterial rate of the Burkholderia ZL31-treated group.
[0030] Figure 5 This is a qualitative detection phenotype diagram of indole-3-acetic acid (IAA) production by Burkholderia ZL31 compared with the negative control group and the positive control group in Example 6 of the present invention.
[0031] Figure 6This is a diagram showing the qualitative determination results of the growth-promoting properties of Burkholderia ZL31 on tomato seedlings in Example 6 of the present invention; wherein A is a qualitative test for the ability to decompose inorganic phosphorus, B is a qualitative test for the ability to produce cellulase, C is a qualitative test for the ability to secrete siderophores, and D is a qualitative test for the production of indole-3-acetic acid (IAA).
[0032] Figure 7 This figure compares the growth promotion of tomato seedlings by Burkholderia ZL31 in Example 7 of the present invention. Figure A shows seedlings in the Burkholderia ZL31-treated group, and Figure B shows seedlings in the control group. Figure C shows a comparison of photos taken after the seedlings were pulled out. The two plants on the left are in the control group, and the two plants on the right are in the Burkholderia ZL31-treated group. DETAILED DESCRIPTION
[0033] It should be noted that the following detailed description is illustrative and is intended to further illustrate the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by those of ordinary skill in the art to which the present invention belongs. Unless otherwise specified, the experimental methods disclosed in the present invention all adopt conventional techniques in the art, and the reagents and raw materials used in the examples are all commercially available.
[0034] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments of the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is intended to include the plural form. In addition, it should be understood that when the term "comprising" or "including" is used in this specification, it indicates the presence of features, steps, operations, devices, components or combinations thereof.
[0035] In a typical embodiment of the present invention, a Burkholderia ZL31 is provided. Burkholderia sp.ZL31 was deposited in the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China) on September 10, 2024, with the deposit number CCTCC NO:M 20241950.
[0036] In another embodiment of the present invention, a derivative of Burkholderia ZL31 is provided, including one or more of its live bacteria, inactivated bacteria, fermentation broth, exosomes or metabolites.
[0037] In the present invention, the term "metabolite" refers to the primary metabolites or secondary metabolites produced during the metabolism of microorganisms. Primary metabolism refers to the process in which microorganisms absorb various nutrients from the outside world and generate substances and energy to maintain life activities through catabolism and anabolism. The products of primary metabolism are primary metabolites, such as monomers such as monosaccharides or monosaccharide derivatives, nucleotides, vitamins, amino acids, fatty acids, and various macromolecular polymers composed of them, such as proteins, nucleic acids, polysaccharides, lipids, etc. Secondary metabolism refers to the process in which microorganisms, during a certain growth period, use primary metabolites as precursors to synthesize substances that have no clear function in the life activities of microorganisms. The products of secondary metabolism are secondary metabolites, which are mostly compounds with relatively complex molecular structures.
[0038] In the present invention, the metabolites can be obtained from a culture of Burkholderia ZL31. The metabolites can be sterile metabolites of Burkholderia ZL31 or bacteria-containing metabolites of Burkholderia ZL31. The sterile metabolites of Burkholderia ZL31 can be prepared by culturing Burkholderia ZL31 in a liquid culture medium and filtering out the Burkholderia ZL31 in the liquid culture (fermentation broth) to obtain sterile metabolites of Burkholderia ZL31. The bacteria-containing metabolites of Burkholderia ZL31 can be prepared specifically by culturing Burkholderia ZL31 in a liquid culture medium and collecting the fermentation broth; the fermentation broth is the bacteria-containing metabolites of Burkholderia ZL31.
[0039] In a specific embodiment of the present invention, the culture medium may be LB culture medium, which is not specifically limited herein.
[0040] In another embodiment of the present invention, a microbial agent is provided, comprising an active ingredient, wherein the active ingredient comprises Burkholderia sp. ZL31 or a derivative thereof. The active ingredient of the microbial agent may further comprise other biological components and / or non-biological components. Those skilled in the art can determine the other active ingredients of the microbial agent based on their antibacterial effects, disease resistance effects, plant growth promotion effects, and plant seed germination promotion effects.
[0041] Furthermore, the bacterial agent includes Burkholderia ZL31 and its culture.
[0042] Among the above-mentioned microbial agents, the microbial agent can be a plant pathogen inhibitor, a plant disease inhibitor, a plant growth promoting microbial agent or a biocontrol and growth promoting microbial agent.
[0043] Among the above-mentioned microbial agents, plant pathogen inhibitors can be used to treat Alternaria alternata ( Alternaria alternata ), Fusarium fusae ( Fusarium falciforme ), Neoerythraea ( Neocosmospora rubicola), Fusarium equisetum ( Fusarium equiseti ), Fusarium oxysporum ( Fusarium oxysporum ), Fusarium solani ( Fusarium solani )、Fusarium fujikura( Fusarium fujikuroi ) has an inhibitory effect, and the plant disease may be tomato root rot.
[0044] In the above-mentioned microbial agent, in addition to the active ingredient, the agent further contains a carrier. The carrier can be a commonly used and biologically inert carrier in the pesticide field, and is not specifically limited here.
[0045] The above-mentioned microbial agents may be in various dosage forms, such as liquid, emulsion, suspension, powder, granule, wettable powder or water-dispersible granule.
[0046] In another embodiment of the present invention, a method for preparing the above-mentioned microbial agent is provided, the preparation method comprising: inoculating the Burkholderia into LB liquid culture medium, placing it in a shaker at 30°C for fermentation, the culture conditions being pH 7.0±0.2, and the rotation speed being 170~190 r·min -1 , the fermentation time is 24~48 hours.
[0047] A fifth aspect of the present invention provides the use of Burkholderia ZL31 or a derivative of Burkholderia ZL31 or the above-mentioned bacterial agent in any one or more of the following:
[0048] (a) Inhibit tomato root rot;
[0049] (b) suppressing plant pathogens or diseases caused by plant pathogens;
[0050] (c) promoting tomato growth;
[0051] (d) hydrolysis of inorganic phosphorus;
[0052] (e) production of indole-3-acetic acid, siderophores and cellulases;
[0053] Wherein, the plant pathogen is Alternaria alternata ( Alternaria alternata ), Fusarium fusae ( Fusarium falciforme ), Neoerythraea ( Neocosmospora rubicola ), Fusarium equisetum ( Fusarium equiseti ), Fusarium solani ( Fusarium solani )、Fusarium fujikura( Fusarium fujikuroi ); The tomato root rot refers to tomato root rot caused by Fusarium oxysporum ( Fusarium oxysporum ) caused by tomato root rot.
[0054] Furthermore, the promotion of tomato growth is specifically manifested in increasing the plant length, root length, wet weight and dry weight of the tomato plants.
[0055] In another embodiment of the present invention, a method for preventing and controlling plant diseases is provided, comprising spraying or root irrigation with Burkholderia ZL31 or a derivative of Burkholderia ZL31 or the above-mentioned bacterial agent on a plant, wherein the plant disease is caused by Alternaria alternata ( Alternaria alternata ), Fusarium fusae ( Fusarium falciforme ), Neoerythraea ( Neocosmospora rubicola ), Fusarium equisetum ( Fusarium equiseti ), Fusarium solani ( Fusarium solani )、Fusarium fujikura( Fusarium fujikuroi ) caused by plant diseases; the plant is tomato.
[0056] In another embodiment of the present invention, a method for preventing and controlling tomato root rot is provided, comprising spraying or irrigating the roots of tomato plants with Burkholderia ZL31 or a derivative of Burkholderia ZL31 or the above-mentioned microbial agent, wherein the tomato root rot is caused by Fusarium oxysporum ( Fusarium oxysporum ) caused by tomato root rot.
[0057] In another embodiment of the present invention, a method for promoting the growth of tomato plants is provided, comprising soaking seeds and irrigating roots with Burkholderia ZL31 or a derivative of Burkholderia ZL31 or the above-mentioned bacterial agent.
[0058] The present invention is further explained by the following examples, but is not intended to limit the present invention. It should be understood that these examples are only intended to illustrate the present invention and are not intended to limit the scope of the present invention.
[0059] The formula of LB medium described in the following examples is: 10 g of tryptone, 5 g of yeast extract, 10 g of NaCl, adjusted to pH 7.0 with 5 mol / L NaOH, and diluted to 1 L with deionized water.
[0060] The formula of the PDA culture medium described in the following examples is: 200 g potato, 20 g glucose, 18 g agar, and 1000 mL distilled water.
[0061] The formula of the cellulose detection medium described in the following examples is: 2 g potassium dihydrogen phosphate, 4 g ammonium sulfate, 0.5 g magnesium sulfate heptahydrate, 10 g CMC-Na, 0.5 g sodium chloride, 1 g peptone, 15 g agar, and 1000 mL distilled water.
[0062] The formula of the siderophore assay medium (CAS) described in the following examples is: chrome azurol-S 60.5 mg, cetyltrimethylammonium bromide 72.9 mg, ferric chloride hexahydrate 2.645 mg, sodium dihydrogen phosphate dihydrate 295.25 mg, disodium hydrogen phosphate dodecahydrate 1213.5 mg, ammonium chloride 125 mg, potassium dihydrogen phosphate 37.5 mg, sodium chloride 62.5 mg, agar 9 g, distilled water 1000 mL, pH adjusted to 6.8 ± 0.1.
[0063] The formula of the iron-limited SA liquid culture medium in the quantitative detection of siderophore capacity described in the following examples is: sucrose 20.0 g, L-asparagine 2.0 g, K2HPO4 0.5 g, MgSO4·7H2O 0.5 g, 1000 mL distilled water, sterilized at 121°C for 20 min.
[0064] The formula of the IAA detection medium described in the following examples is: 10 g mannitol, 0.5 g dipotassium hydrogen phosphate, 0.2 g magnesium sulfate heptahydrate, 0.1 g sodium chloride, 1 g yeast extract, 1 g ammonium nitrate, 0.1 g L-tryptophan, 1% 2.5 g / L Congo red solution, 1000 mL distilled water, pH 7.0.
[0065] The formula of the inorganic phosphorus-dissolving medium described in the following examples is: 10.0 g glucose, 0.5 g ammonium sulfate, 0.3 g sodium chloride, 0.3 g magnesium sulfate, 0.03 g manganese sulfate, 0.3 g potassium sulfate, 0.03 g ferrous sulfate, 5.0 g calcium phosphate, 15.0 g agar, 1000 mL distilled water, pH 7.0-7.5.
[0066] The formula for the CAS siderophore detection dye described in the following examples is as follows: 0.079 g of CAS was dissolved in 50 mL of deionized water, and 10 mL of a 1 mmol / L FeCl3 solution (containing 12 mmol / L HCl) was added to obtain solution A; 0.069 g of hexadecyltrimethylammonium bromide (HDTMA) was dissolved in 40 mL of deionized water to obtain solution B; solution A was slowly added to solution B along the wall of the beaker and stirred to obtain 100 mL of CAS blue detection solution.
[0067] The formula of the Salkowski colorimetric solution described in the following examples is: 18 mol / L H2SO4 150 mL, double distilled water 250 mL, 0.5 mol / L FeCl3 7.5 mL.
[0068] The formula of the improved vanadium molybdenum yellow color developing solution described in the following examples is as follows: 100 g / L ammonium molybdate solution, 2.35 g / L ammonium metavanadate solution and nitric acid solution (concentrated nitric acid: water = 1:2) are prepared into a color developing solution in a volume ratio of 1:1:2, and 0.25 mol / L sodium acetate solution is used as a buffer solution.
[0069] Burkholderia Burkholderia sp.ZL31, abbreviated as: Burkholderia ZL31.
[0070] Example 1 Isolation and screening of strains
[0071] 1. Sample Source
[0072] The sample soil was obtained from the root soil of pear trees in Leiyang, Hunan.
[0073] 2. Screening of strains
[0074] Take 10 g of rhizosphere soil sample in a conical flask, add 90 mL of sterile water and add some glass beads for oscillation mixing, 200 r / min, 37 ° C for 30 min, and then use the gradient dilution method to dilute the rhizosphere soil suspension into 5 concentration gradients (1×10 -2 g / mL, 1×10 -3 g / mL, 1×10 -4 g / mL, 1×10 -5 g / mL, 1×10 -6 g / mL), pipette 100 μL of each suspension onto plates. Set up three replicates for each gradient and incubate inverted in a 30°C incubator for 3–5 days. Select appropriate dilution concentrations based on size, color, and morphology, and isolate six representative single colonies of different strains. After three generations of purification using the three-zone streak method on LB medium, screened strains were stored in 25% glycerol and numbered. Store at -20°C for further use.
[0075] 3. Rescreening of Antagonistic Strains
[0076] The plate confrontation culture method was used to screen Fusarium oxysporum ( Fusarium oxysporum ) inhibit bacteria. Fusarium oxysporum ) The cake was placed in the center of the PDA culture medium, and 10 μL of different bacterial solutions were applied at a distance of 2.5 cm from the center of the Fusarium. 10 μL of LB liquid culture medium was dropped into one of the spots as a blank control group. After the liquid dried, it was sealed and incubated at 30℃ for 5 days. After observation, the bacteria that inhibited Fusarium oxysporum ( Fusarium oxysporum ) The strain with better growth results was named strain ZL31, and strain ZL31 was stored at -80℃ for future use.
[0077] Example 2 Identification of strains
[0078] 1. Morphological identification of strains
[0079] The strain ZL31 preserved in 25% glycerol was inoculated on LB medium plate by streak method and cultured at 30℃ for 24h. The morphological characteristics of the colonies were observed. The colony morphology and cell morphology under optical microscope were shown in Figure 2. Figure 1 .
[0080] Figure 1 The results showed that the colony of strain ZL31 was light yellow and opaque, with raised edges and neat but irregular margins. After Gram staining of strain ZL31, microscopic observation revealed that strain ZL31 was a Gram-negative bacterium with a short rod shape.
[0081] 2. Molecular Biology Identification
[0082] The genome of strain ZL31 was extracted using a genomic DNA extraction kit. The 16S rRNA gene of strain ZL31 was amplified by PCR using universal bacterial 16S rDNA detection primers (27F: AGAGTTTGATCCTGGCTCAG (SEQ ID NO. 1); 1492R: TACGGCTACCTTGTTACGACTT (SEQ ID NO. 1)). After identification by agarose gel electrophoresis, the genome was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. The 16S rRNA sequencing sequence was submitted to the GenBank database for BLAST comparison analysis. A phylogenetic tree was constructed using MEGA software. The phylogenetic tree is shown in Figure 1. Figure 2 .
[0083] The 16S rDNA gene sequence of the strain ZL31 is shown in SEQ ID NO.3.
[0084]
[0085] The results showed that the strain ZL31 obtained in the initial screening belonged to the same branch as Burkholderia and had the closest relationship. The strain ZL31 was identified as a new species of the genus Burkholderia. Burkholderia sp.ZL31, Burkholderia ZL31 was deposited in the China Center for Type Microorganism Collection on September 10, 2024, with the deposit number: CCTCC NO:M 20241950, and the deposit address is Wuhan University, Wuhan, China.
[0086] Example 3 Preparation of Burkholderia ZL31 Inoculum
[0087] The Burkholderia ZL31 was inoculated into LB liquid culture medium and placed in a shaker at 30°C for fermentation. The culture conditions were pH 7.0±0.2 and the rotation speed was 170-190 r·min. -1 The fermentation time was 24-48 h, and the fermentation broth of Burkholderia ZL31 (concentration of 1×10 8 ~1×10 9 CFU / mL), which is the bacterial agent, and stored at 4°C for future use.
[0088] Example 4 Determination of the antagonistic activity of Burkholderia ZL31 against Fusarium oxysporum
[0089] Take Fusarium oxysporum ( Fusarium oxysporum ) on the PDA medium. After the mycelium has grown all over the plate, take a bacterial cake from the plate with a 5 mm aperture puncher and place it with the mycelium side facing down in the center of the PDA medium. With the position of Fusarium oxysporum as the center, 10 μL of Burkholderia ZL31 bacterial solution is applied at a distance of 2.5 cm. 10 μL of LB liquid medium is dropped on one of the places as a blank control group. After the liquid is dried, seal the plate, set up three replicates, and culture in a 30℃ incubator for 5-7 days. Observe and record the antibacterial effect.
[0090] Mycelial growth inhibition rate (%) = (control colony diameter - treated colony diameter) / (control colony diameter - 6) × 100%.
[0091] Wherein, the unit of each colony diameter is "cm"; "6" is the initial diameter of the treated colony.
[0092] The antagonistic effect of Burkholderia ZL31 on Fusarium oxysporum is shown in the figure. Figure 3 The antibacterial effects are shown in Table 1.
[0093] Table 1 Antibacterial effect of Burkholderia strain ZL31 on Fusarium oxysporum
[0094]
[0095] The results showed that Burkholderia ZL31 exhibited strong inhibitory activity, with an average inhibition rate of 67.27±0.7%, indicating that Burkholderia ZL31 had a significant antagonistic effect against Fusarium oxysporum.
[0096] Example 5 Determination of the broad-spectrum antibacterial spectrum of Burkholderia ZL31
[0097] Using the plate confrontation culture method, Alternaria alternata ( Alternaria alternata ), Fusarium fusae ( Fusarium falciforme ), Neoerythraea ( Neocosmospora rubicola ), Fusarium equisetum ( Fusarium equiseti )Fusarium fujikura Fusarium fujikuroi ), Fusarium solani ( Fusarium solani ) were cultured on PDA medium. After the mycelium had grown all over the plate, a 5 mm pore hole punch was used to punch out bacterial blocks on the plate. One of the bacterial cakes was taken, with the mycelium side facing down, and inoculated into the center of a new PDA plate. 10 μL of Burkholderia ZL31 bacterial solution was applied at a distance of 2.5 cm from the bacterial cake. 10 μL of LB liquid medium was dropped into one of the spots as a blank control group. After the liquid was dried, the plate was sealed and three replicates were set up. The plate was placed in a 30°C incubator for 5-7 days, and the antibacterial effect was observed and recorded. The results are shown in the figure. Figure 4 The relative inhibition rates of Burkholderia ZL31 against various pathogens are shown in Table 2.
[0098] Table 2 Antibacterial effect of Burkholderia ZL31 on six plant pathogenic fungi
[0099]
[0100] The results are as follows Figure 4 As shown in Figures A and B, Burkholderia ZL31 exhibited the most significant inhibitory activity against the pathogenic fungi Fusarium fusarifolia and Fusarium fusokurae, with relative inhibition rates of 67.06% and 64%, respectively. Furthermore, Burkholderia ZL31 exhibited relative inhibition rates of 46.45% against Alternaria alternata, 47.05% against Neotriton spp., 59.5% against Fusarium equisetifolia, and 59.48% against Fusarium solani. This indicates that Burkholderia ZL31 has a strong antagonistic effect against all six fungal pathogens. Burkholderia ZL31 may directly disrupt fungal cell membrane integrity or interfere with metabolic pathways through the secretion of secondary metabolites (such as antibiotics and lipopeptides) or competitive inhibition (such as siderophore deprivation).
[0101] Example 6 Determination of the growth-promoting characteristics of Burkholderia sp. ZL31
[0102] The inorganic phosphorus solubilization, cellulase production, siderophore secretion, and indole-3-acetic acid (IAA) production activities of Burkholderia sp. ZL31 were determined by the plate method, and the inorganic phosphorus solubilization, siderophore secretion, and indole-3-acetic acid (IAA) production of Burkholderia sp. ZL31 were quantitatively determined.
[0103] (1) Determination of inorganic phosphorus solubilization ability: Burkholderia sp. ZL31 was inoculated onto an inorganic phosphorus solid medium and cultured in an incubator at 30 °C for 2 - 5 d. Colonies showing a clear halo were selected for observation and recording. The single colonies formed on the medium were successively subcultured 3 times on the inorganic phosphorus medium to obtain the initial strain. The soluble index SI = d / D, where d is the halo diameter and D is the colony diameter. The criteria for judging phosphorus solubilization ability are as follows: low (SI < 2), medium (2 < SI < 3), and high (SI > 3). The results are shown in Table 3 and Figure 6 as shown in A in [reference], a clear halo was produced around the colonies of Burkholderia sp. ZL31, indicating its ability to solubilize inorganic phosphorus. The soluble index SI was 4.9, indicating a strong phosphorus solubilization ability.
[0104] Quantitative detection of inorganic phosphorus solubilization ability: The detection solution was a modified vanadomolybdophosphoric yellow colorimetric solution. Preparation of the phosphorus standard curve: A stock solution of a phosphorus standard solution at 100 μg / mL was prepared using dried potassium dihydrogen phosphate, and then diluted into phosphorus standard solutions at 5, 20, 35, 50, 65, 80, and 95 μg / mL, respectively. The standard solution was prepared once for each experiment and used immediately. Detection was carried out using the vanadomolybdophosphoric yellow method. 1 mL of the test sample, 2 mL of the colorimetric solution, and 1 mL of the sodium acetate buffer solution were thoroughly mixed. After standing for 10 min, the absorbance value at OD415 was measured using an ultraviolet spectrophotometer. The standard curve was plotted with the OD415 value as the abscissa and the phosphorus content (μg / mL) as the ordinate. Among them, the standard curve was y = 123.46x - 12.889, and R2 was 0.9998, indicating that the detection method had a high feasibility.
[0105] The activated Burkholderia ZL31 strain was inoculated into LB medium and cultured on a shaker at 30°C and 200 rpm for 72 hours. The culture was centrifuged at 4°C and 12,000 rpm for 5 minutes, and the supernatant was collected. One mL of the supernatant was thoroughly mixed with 2 mL of colorimetric solution and 1 mL of sodium acetate buffer. The mixture was allowed to stand for 10 minutes for color development, and the OD415 value was measured using a UV spectrophotometer. The phosphorus content per unit volume of fermentation broth was calculated using the obtained standard curve equation. The OD415 value of Burkholderia ZL31 was 0.588, which, when substituted into the standard curve, yielded a phosphorus content of 59.704 μg / mL. This phosphate-solubilizing capacity surpasses that of previously reported Burkholderia strains.
[0106] Burkholderia ZL31 can break down insoluble tricalcium phosphate in the culture medium into inorganic phosphorus (e.g., phosphate ions) that can be used by plants. Monitoring changes in inorganic phosphorus concentration in the culture medium effectively evaluates the phosphate-solubilizing ability of Burkholderia ZL31. The increase in inorganic phosphorus concentration in the culture medium is positively correlated with the phosphate-solubilizing ability of Burkholderia ZL31; a greater increase in inorganic phosphorus concentration indicates a stronger phosphate-solubilizing ability.
[0107] (2) Determination of cellulase production capacity: Inoculate Burkholderia ZL31 onto cellulose test medium and place in a 30°C incubator. When colonies grow on the medium, add 1 mg / mL Congo red and stain for 10-15 minutes. Wash with 1 mol / L sodium chloride 2-3 times and observe whether a transparent circle is produced. The results are as follows. Figure 6 As shown in B, after three washes, a transparent zone is formed around the colony of Burkholderia ZL31, indicating that it has the ability to produce cellulase.
[0108] (3) Determination of the ability to secrete iron carriers: Burkholderia ZL31 was inoculated on the CAS test plate using the dot inoculation method and cultured at 30°C for 48 h. If the strain has the ability to produce iron carriers, a clear orange-yellow transparent circle will appear around the colony on the CAS test plate. Record the size, color, and morphological characteristics of the orange-yellow halo. At the same time, calculate the halo ratio, i.e., the solubility index SI. Solubility index SI = d / D (SI ≥ 1.5 is determined to be a strong iron carrier-producing strain). Wherein, d is the halo diameter and D is the colony diameter. The results are shown in Tables 3 and Figure 6 As shown in C, there is an obvious orange-yellow transparent circle around the colony of Burkholderia ZL31, which has the ability to produce siderophores, and the solubility index SI is 3.0, which is a strong siderophore-producing strain.
[0109] Table 3 Colony size and halo diameter of Burkholderia ZL31 that degrades inorganic phosphate and produces siderophores
[0110]
[0111] Quantitative siderophore activity assay: The culture medium was iron-restricted SA liquid medium, and the assay solution was CAS siderophore assay solution. The strain was inoculated into the iron-restricted SA liquid medium and cultured at 37°C with shaking at 180 rpm for 48 h. The culture was centrifuged at 10,000 rpm for 10 min, and the supernatant was collected and mixed with an equal volume of freshly prepared CAS assay solution. The supernatant was thoroughly mixed by inverting the plate several times. After standing in the dark for 1 h, the absorbance at 630 nm (As) was measured in triplicate, and the average of the results was calculated. Zero adjustment was performed using double-distilled water as a control. The absorbance value of an equal volume of blank iron-restricted liquid medium mixed with CAS assay solution was used as the reference value (Ar). The siderophore activity units (Su) (%) were calculated using the formula: [(Ar - As) / Ar] × 100).
[0112] The absorbance value Ar of blank SA liquid culture medium was 0.334, and the A630 nm value was positively correlated with the siderophore content. The siderophore activity was calculated to be 85.84% according to the formula using the measured values, and the As / Ar ratio was 0.142, indicating a strong siderophore secretion ability.
[0113] (4) Indole-3-acetic acid (IAA) assay method: Burkholderia ZL31 was inoculated onto IAA solid detection medium and cultured in an incubator at 28°C for 2-5 days. Observation and recording were performed, and the single colonies formed on the culture medium were transferred to the IAA detection medium three times to obtain the primary strain. The IAA production capacity of the strain was determined by the Salkowski colorimetric method. The purified Burkholderia ZL31 was cultured overnight in LB liquid medium and prepared into a fermentation broth. 0.5 mL was inoculated into 50 mL LB medium containing 3 mmol / L L-tryptophan and cultured at 30°C and 180 rpm for 48 h. 1 mL of the fermentation broth was centrifuged at 4°C and 10,000 r / min for 5 min. 300 μL of the supernatant was placed in a 2 mL centrifuge tube and 300 μL of Salkowski colorimetric reagent was added for color development. Use 300 μL of 60 mg / L IAA standard solution as the positive control and LB medium without bacterial solution as the negative control. Incubate at room temperature in the dark for 30 minutes and observe the color change. Figure 5 As shown, the LB culture medium to which the Burkholderia ZL31 bacterial solution was added turned red, indicating that Burkholderia ZL31 had the ability to produce IAA.
[0114] IAA quantitative detection: The detection solution is Salkowski colorimetric solution. To construct an IAA standard curve: Accurately weigh 10 mg of IAA and dissolve the sample in a small amount of ethanol. Then, dilute to 100 mL with distilled water to prepare a stock solution with a concentration of 100 μg / mL, which is set aside. The stock solution is then diluted to prepare a series of standard solutions at 0 (blank), 0.5, 1.0, 5.0, 10.0, 15.0, 20.0, and 25.0 μg / mL. Prepare a separate standard solution for each experiment, using it immediately. Add 1 mL of the IAA standard solution sequentially, mix with 4 mL of the Salkowski reagent, and incubate at 40°C for 30 min (heating accelerates color development). Measure the absorbance of the reaction solution at 530 nm. Plot the standard curve with the OD530 value as the abscissa and the IAA concentration (μg / mL) as the ordinate. The equation is y = 67.567x - 0.3845, with an R² = 0.9996.
[0115] The activated bacteria were inoculated into LB medium supplemented with L-tryptophan (final concentration 500 μg / mL). A control was used, LB medium without inoculation and supplemented with 500 μg / mL L-tryptophan. The culture was shaken at 30°C and 200 rpm for 48 hours. The culture was centrifuged at 4°C and 10,000 rpm for 10 minutes, and the supernatant was collected. The supernatant was mixed with an equal volume of Salkowski colorimetric solution and allowed to stand in the dark for 30 minutes for color development. The OD530 value was then measured. Using a blank LB medium and an equal volume of Salkowski colorimetric solution as a control, the relative IAA content was calculated using a standard curve. The OD530 value of Burkholderia ZL31 was 0.318, which, when substituted into the formula, yielded an IAA content of 21.102 μg / mL.
[0116] In summary, Burkholderia ZL31 possesses the ability to degrade inorganic phosphate, produce cellulases, and secrete siderophores and indole-3-acetic acid (IAA). Its robust inorganic phosphate degradability (transparent zone diameter 4.4 mm > 4 mm) indicates its ability to mobilize insoluble phosphate in soils, potentially excelling in phosphorus-deficient soils and enhancing phosphorus availability. Its robust siderophore secretion (solubility index SI 3.0 ≥ 1.5) reflects its strong competitive iron uptake mechanism, enabling it to both provide nutrients and inhibit pathogens. Its cellulase and IAA production demonstrate its ability to degrade organic matter and stimulate plant root development. Through its synergistic mechanisms of phosphate degradability, siderophore production, IAA, and cellulase, Burkholderia ZL31 demonstrates its potential for highly effective plant growth promotion.
[0117] Example 7 Growth-Promoting Effect of Burkholderia ZL31
[0118] This experiment employed the seed soaking and 7-day root irrigation treatment method using the inoculum containing Burkholderia ZL31 prepared in Example 3. Tomato seeds of uniform size and full size were selected and disinfected with 75% ethanol for 1 minute, rinsed 2-3 times with sterile water, disinfected with 3% sodium hypochlorite solution for 10 minutes, rinsed multiple times with sterile water, and then soaked in sterile water at 28°C for 24 hours. The seeds were then soaked in the Burkholderia ZL31 inoculum for 5 hours in a 30°C constant-temperature incubator. A control group was soaked in sterile water. After soaking, the seeds were transplanted into a seedling tray containing sterilized soil, covered with a small amount of sterile soil, and placed in a constant-temperature, light-lit incubator at 26-28°C with 16 hours of light. On the 7th day of growth, 2 mL of the Burkholderia ZL31 inoculum was added to the roots of the treated seedlings, while 2 mL of sterile water was added to the roots of the control seedlings. After 30 days of cultivation, the growth conditions of the seedlings in the Burkholderia ZL31 agent group and the control group were as follows: Figure 7 As shown in A and B in the figure, the seedlings were dug out and rinsed with tap water. Figure 7 As shown in Figure C, fresh weight was determined by absorbing surface moisture with sterilized filter paper. Plant and root lengths were measured, and the entire plant was then oven-dried at 80°C for 48 hours to determine dry weight. The relevant data were statistically analyzed, and the results are shown in Table 4.
[0119] Table 4 Effects of Burkholderia ZL31 on the growth of tomato seedlings
[0120]
[0121] As shown in Table 4, the Burkholderia ZL31 inoculant seed soaking and 7-day root irrigation treatment significantly increased the plant length, root length, fresh weight, and dry weight of tomato seedlings, indicating that the Burkholderia ZL31 inoculant can promote the growth of tomato seedlings.
[0122] In summary, the Burkholderia ZL31 provided by the present invention has a significant antagonistic effect on tomato root rot, has antagonistic activity against a variety of plant pathogenic fungi, has a good ability to decompose inorganic phosphorus, can produce indole-3-acetic acid (IAA), siderophores and cellulases, can promote the growth of tomato seedlings, and provides new paths and resources for the biological control of tomato root rot and a variety of crop fungal diseases. It also provides optional strains for the prevention and control of other important diseases and the development of new biocontrol agents, thereby promoting the development of the field of biological control.
[0123] It should be noted that the above examples are only intended to illustrate the technical solutions of the present invention and are not intended to limit the same. Although the present invention has been described in detail with reference to the examples given, those skilled in the art may modify or replace the technical solutions of the present invention as needed without departing from the spirit and scope of the technical solutions of the present invention.
Claims
1. A strain of Burkholderia ZL31, Burkholderia Burkholderia sp.ZL31 was deposited in the China Center for Type Culture Collection on September 10, 2024, with the deposit number CCTCC NO:M 20241950; The 16S rDNA gene sequence of the Burkholderia ZL31 is shown in SEQ ID NO.
3.
2. A fermentation broth of Burkholderia ZL31 according to claim 1.
3. A bacterial agent, characterized in that The invention comprises an active ingredient, wherein the active ingredient comprises the Burkholderia ZL31 according to claim 1 or the fermentation broth according to claim 2.
4. The bacterial agent according to claim 3, characterized in that The bacterial agent comprises Burkholderia ZL31 and its fermentation liquid.
5. The method for preparing the bacterial agent according to claim 3 or 4, characterized in that: The preparation method comprises: inoculating the Burkholderia into LB liquid culture medium, placing the culture medium in a shaker at 30°C for fermentation, and the culture conditions are pH 7.0±0.2 and a rotation speed of 170-190 r·min -1 , the fermentation time is 24~48 hours.
6. Use of the Burkholderia ZL31 according to claim 1, the fermentation broth according to claim 2, or the bacterial agent according to any one of claims 3 to 4 in any one or more of the following: (a) Inhibit tomato root rot; (b) suppressing plant pathogens or diseases caused by plant pathogens; (c) promoting tomato growth; (d) hydrolysis of inorganic phosphorus; (e) production of indole-3-acetic acid, siderophores and cellulases; in, The plant pathogen is Alternaria alternata ( Alternaria alternata ), Fusarium fusae ( Fusarium falciforme ), Neoerythraea ( Neocosmospora rubicola ), Fusarium equisetum ( Fusarium equiseti ), Fusarium solani ( Fusarium solani )、Fusarium fujikura( Fusarium fujikuroi ); The tomato root rot refers to tomato root rot caused by Fusarium oxysporum ( Fusarium oxysporum ) caused by tomato root rot.
7. The use according to claim 6, characterized in that The tomato growth promotion is specifically manifested in increasing the plant length, root length, wet weight and dry weight of the tomato plants.
8. A method for preventing and controlling plant diseases, characterized in that: The method comprises spraying or root irrigation treatment on plants using the Burkholderia ZL31 according to claim 1 or the fermentation liquid according to claim 2 or the bacterial agent according to claims 3-4, wherein the plant disease is caused by Alternaria ( Alternaria alternata ), Fusarium fusae ( Fusarium falciforme ), Neoerythraea ( Neocosmospora rubicola ), Fusarium equisetum ( Fusarium equiseti ), Fusarium solani ( Fusarium solani )、Fusarium fujikura( Fusarium fujikuroi ) plant diseases caused by The plant is tomato.
9. A method for preventing and controlling tomato root rot, characterized in that: The method comprises spraying or root irrigation treatment on tomato plants using the Burkholderia ZL31 of claim 1 or the fermentation liquid of claim 2 or the bacterial agent of claims 3-4, wherein the tomato root rot is caused by Fusarium oxysporum ( Fusarium oxysporum ) caused by tomato root rot.
10. A method for promoting the growth of tomato plants, characterized in that: The method comprises using the Burkholderia ZL31 according to claim 1 or the fermentation liquid according to claim 2 or the bacterial agent according to claims 3-4 for seed soaking and root irrigation treatment.
Citation Information
Patent Citations
Endophytic burkholderia gladioli JS-59 and application thereof
CN116218709A
Burkholderia cepacia and application thereof
CN116218740A
Burkholderia forest and application thereof
CN116286483A
Broad-spectrum disease-resistant burkholderia and application thereof
CN117229952A
Biocontrol of plant diseases using novel endophytic isolate of burkholderia vietnamensis MC1404
KR1020050034000A