Gordonia for degrading various phthalic acid esters and application of Gordonia in repairing phthalic acid ester polluted soil

Abstract

The invention discloses Gordonia for degrading various phthalic acid esters and application of the Gordonia in remediation of phthalic acid ester polluted soil. According to the invention, a Gordonia FV1 strain is separated from polluted soil, and the microbial preservation number of the Gordonia FV1 strain is CGMCC No.30310. The Gordonia FV1 strain still has excellent degradation capability on phthalate in a temperature range of 10-60 DEG C or a pH value range of 5.0-11.0, and is strong in environmental adaptability. The Gordonia FV1 can degrade 14 kinds of phthalic acid esters, and covers relatively short side chain PAEs, medium length side chain PAEs, relatively long side chain PAEs and complex side chain PAEs. When the Gordonia FV1 is applied to bioremediation of soil, di (2-ethyl) hexyl phthalate in the soil can be effectively removed. The method has application prospects in the aspects of microbial degradation of phthalate, bioremediation of soil and the like.

Description

Technical Field

[0001] The present invention relates to microbial strains for bioremediating soil, and particularly to Gordonia for degrading phthalate esters and its application in remediating PAEs-contaminated soil, belonging to the field of Gordonia and its application in soil bioremediation. Background Art

[0002] Phthalate ester acids (PAEs) are widely used as plasticizers. Although PAEs can improve the flexibility and durability of plastics, they are easily released into the environment, causing serious environmental pollution. PAEs have environmental estrogen effects, interfering with the endocrine system, nervous system, etc. of the human body and threatening human health. Six PAEs (DMP, DEP, DBP, BBP, DOP, and DEHP) are listed as priority environmental pollutants. Currently, researchers at home and abroad have isolated many PAEs-degrading bacteria from various environmental samples. However, these PAEs-degrading bacteria have a narrow substrate spectrum and cannot degrade PAEs with complex side chains, or have poor environmental adaptability, affecting their application in environmental remediation. For example, Gordonia LUNF6 can only degrade six PAEs with relatively simple side chain structures in neutral or alkaline sewage conditions (Publication No.: CN 118308275 A). Therefore, there is an urgent need to screen PAEs-degrading bacteria with a wider substrate spectrum, capable of degrading PAEs with complex side chains, and stronger environmental adaptability for application in the remediation of phthalate ester-contaminated soil. Summary of the Invention

[0003] One of the objectives of the present invention is to provide a strain of Gordonia that can degrade multiple phthalate esters (PAEs).

[0004] Another objective of the present invention is to apply the Gordonia to degrade phthalate esters.

[0005] A third objective of the present invention is to apply the Gordonia to bioremediate soil contaminated with phthalate esters.

[0006] To achieve the above objectives, the main technical solutions adopted by the present invention include: On the one hand, the present invention provides a strain of Gordonia ( Gordonia sp. ) FV1, whose microbial deposit number is CGMCC No. 30310; its taxonomic name is: Gordonia Gordonia sp. ; the deposit time is: April 11, 2024; the deposit unit is: China General Microbiological Culture Collection Center; the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0007] The colony morphology of Gordonia described in the present invention is as follows: the colony is round and red.

[0008] The Gordonia FV1 isolated in the present invention still has excellent degradation ability for phthalate esters within the temperature range of 10 - 60 °C or within the pH value range of 5.0 - 11.0; this Gordonia FV1 can degrade 14 phthalate esters, covering short-chain PAEs, medium-chain PAEs, long-chain PAEs, and complex-chain PAEs; this Gordonia FV1 can be used for bioremediation of soil to degrade phthalate esters in the soil.

[0009] Another aspect of the present invention is to apply the described Gordonia to degrade phthalate esters or bioremediate soil.

[0010] In a preferred specific embodiment of the present invention, the described Gordonia is applied to degrade phthalate esters.

[0011] In a preferred specific embodiment of the present invention, the phthalate esters include dimethyl phthalate, diethyl phthalate, dipropyl phthalate, dibutyl phthalate, di-n-pentyl phthalate, dihexyl phthalate, diheptyl phthalate, dioctyl phthalate, dinonyl phthalate, didecyl phthalate, butyl benzyl phthalate, dicyclohexyl phthalate, bis(2-ethylhexyl) phthalate, or diisobutyl phthalate, etc.

[0012] In a preferred specific embodiment of the present invention, the described Gordonia is applied to bioremediate contaminated soil.

[0013] In a preferred specific embodiment of the present invention, the contaminated soil contains phthalate esters.

[0014] In a preferred specific embodiment of the present invention, the phthalate esters include dimethyl phthalate, diethyl phthalate, dipropyl phthalate, dibutyl phthalate, di-n-pentyl phthalate, dihexyl phthalate, diheptyl phthalate, dioctyl phthalate, dinonyl phthalate, didecyl phthalate, butyl benzyl phthalate, dicyclohexyl phthalate, bis(2-ethylhexyl) phthalate, diisobutyl phthalate.

[0015] Another aspect of the present invention is to provide a method for bioremediating soil, including: preparing the described Gordonia into a microbial inoculant; inoculating the microbial inoculant into contaminated soil for microbial degradation.

[0016] A Gordonia sp. strain FV1 was isolated from contaminated soil. This strain can efficiently degrade phthalate esters within a wide temperature range (10 - 60 °C) and pH range (5.0 - 11.0), and has strong environmental adaptability. The Gordonia sp. strain FV1 can degrade a variety of phthalate esters, including dimethyl phthalate, diethyl phthalate, dipropyl phthalate, dibutyl phthalate, di-n-pentyl phthalate, dihexyl phthalate, diheptyl phthalate, dioctyl phthalate, dinonyl phthalate, didecyl phthalate, butyl benzyl phthalate, dicyclohexyl phthalate, bis(2-ethylhexyl) phthalate, diisobutyl phthalate, etc., a total of 14 phthalate esters, covering short-chain PAEs, medium-chain PAEs, long-chain PAEs, and complex-chain PAEs. Applying the Gordonia sp. strain FV1 to bioremediate soil can effectively remove phthalate esters in the soil and has application potential in bioremediating soil. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 It is a colony morphology diagram of Gordonia sp. strain FV1.

[0018] Figure 2 It is a phylogenetic analysis of Gordonia sp. strain FV1.

[0019] Figure 3 It is a statistical chart of the degradation of DEHP by Gordonia sp. strain FV1 at different temperatures.

[0020] Figure 4 It is a statistical chart of the degradation of DEHP by Gordonia sp. strain FV1 at different pH values.

[0021] Figure 5 It is the PAEs substrate spectrum of Gordonia sp. strain FV1.

[0022] Figure 6 It is a statistical chart of the degradation of DEHP in soil by Gordonia sp. strain FV1. DETAILED DESCRIPTION OF THE INVENTION

[0023] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description progresses. However, it should be understood that the described embodiments are exemplary only and do not constitute any limitation to the scope of the present invention. Those skilled in the art should understand that without departing from the spirit and scope of the present invention, modifications or substitutions can be made to the details and forms of the technical solutions of the present invention, but these modifications or substitutions all fall within the protection scope of the present invention. Example 1 Isolation and Identification of Gordonia sp. Strain ( Gordonia sp. ) FV1 1 Experimental Method Composition of TEM medium: CaCl 2 0.01 g / L, K 2 HPO 4 1.5 g / L, (NH4) 2 SO4 (2.0), MgSO 4 ·7H 2 O 0.2 g / L, Na 2 HPO4·12H 2 O 1.5 g / L, TES 100 μL.

[0024] Composition of TES: FeSO 4 ·7H 2 O 5 g / L, MnSO 4 ·2H 2 O 1.43 g / L, ZnSO 4 ·7H 2 O 0.022 g / L, CuSO 4 ·5H 2 O 0.03 g / L, Na 2 WO 4 ·2H 2 O 0.023 g / L, Na 2 MoO 4 ·2H 2 O 0.02 g / L, CoSO 4 ·7H 2 O 0.12 g / L.

[0025] Add 10 g of plastic-polluted soil to 100 mL of TEM liquid medium, then add DEHP to a final concentration of 0.5 mM, and culture at 180 rpm and 30 °C for 7 days. Take 1 mL of the culture solution and transfer it to TEM liquid medium containing 0.5 mM DEHP, and culture under the same conditions. Repeat the transfer 5 times. Spread the cultured bacterial solution on a TEM solid plate (containing 0.5 mM DBP) and culture at 30 °C for 5 days. Select a single colony with a clear halo around it and name it FV1, and perform molecular identification on strain FV1. Extract the genome of strain FV1, use genomic DNA as a template, and amplify the 16S rRNA gene fragment using primers 27F and 1492R. Send the amplified product to the company for sequencing, retrieve homologous sequences in NCBI, and construct a phylogenetic tree using MEGA11.

[0026] The nucleotide sequences of primers 27F and 1492R are shown as follows: 27F: AGTTTGACMTGGCTCAG (SEQ ID No.1); 1492R: CGGTTACCTTGTTACGACTT (SEQ ID No.2).

[0027] Experimental results Through enrichment and domestication of PAEs-degrading bacteria in the contaminated soil samples, there was a clear zone around the single colony of strain FV1 on the plate. The colony morphology of strain FV1 was as Figure 1 shown, the colony was round and red. According to the sequencing results of the 16S rRNA gene fragment and the phylogenetic tree ( Figure 2 ), it was confirmed that strain FV1 belonged to Gordonia genus, and it was named Gordonia ( Gordonia sp. ) FV1.

[0028] Test Example 1 Degradation characteristics test of Gordonia FV1 on PAEs 1 Degradation test of Gordonia FV1 on PAEs at different temperatures DEHP was added to 10 mL of TEM liquid medium (pH value 8.0) to a final concentration of 0.5 mM, and 200 μL of the Gordonia FV1 bacterial solution was inoculated. The bacterial solution was not added in the control group. Three independent replicates were set up and cultured with shaking at 180 rpm for 24 h at different temperatures (10°C, 20°C, 30°C, 40°C, 50°C, 60°C). The residual amount of DEHP in the samples was determined by HPLC.

[0029] After 24 hours of culture, Gordonia FV1 could maintain a high degradation activity against DEHP under different temperature conditions and had good adaptability to temperature. The test results were as Figure 3 shown. In the range of 20 - 60°C, Gordonia FV1 could maintain a degradation rate of more than 90% against DEHP. When the temperature was 20 - 40°C, Gordonia FV1 almost completely degraded DEHP. Even at 10°C, Gordonia FV1 could still degrade more than 50% of DEHP, indicating the excellent degradation ability of Gordonia FV1 against DEHP in a relatively wide temperature range.

[0030] Degradation test of Gordonia FV1 on PAEs at different pH values DEHP was added to 10 mL of TEM liquid medium (pH values 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0) to a final concentration of 0.5 mM, and 200 μL of the Gordonia FV1 bacterial solution was inoculated. The bacterial solution was not added in the control group. Three independent replicates were set up and cultured with shaking at 180 rpm for 24 h at 30°C. The residual amount of DEHP in the samples was determined by HPLC.

[0031] After 24 hours of cultivation, Gordonia sp. FV1 maintained a high degradation activity towards DEHP under different pH conditions and had good adaptability to pH. The test results are as Figure 4 shown. When the pH was 5.0 - 7.0, the degradation rate of DEHP by Gordonia sp. FV1 gradually increased from 34.52% to 89.84% with the increase of pH. When the pH was 8.0 - 11.0, Gordonia sp. FV1 could almost completely degrade DEHP. The results indicated that Gordonia sp. FV1 could efficiently degrade DEHP in acidic and strongly alkaline environments, especially with better degradation performance in alkaline environments, showing its potential in environmental remediation applications. Test Example 2: Determination of the Degradation Substrate Spectrum of Gordonia sp. FV1 1 Test Method Dimethylphthalate (DMP), Diethyl phthalate (DEP), Dipropyl phthalate (DPrP), Di-n-butyl phthalate (DBP), Di-n-pentyl phthalate (DPeP), Dihexyl phthalate (DHP), Diheptyl phthalate (DHeP), Di-n-octylphthalate (DOP), Dinonyl phthalate (DNP), Didecyl phthalate (DDP), Butylbenzyl phthalate (BBP), Dicyclohexyl phthalate (DCHP), Di(2-ethylhexyl) phthalate (DEHP), and Diisobutyl phthalate (DiBP) were added to 10 mL of TEM liquid medium (pH 8.0) to a final concentration of 0.5 mM. 200 μL of Gordonia sp. FV1 was inoculated. No bacterial solution was added to the control group, and 3 independent replicates were set. The cultures were shaken at 30 °C and 180 rpm for 7 days. The content of PAEs in the samples was determined by HPLC to determine the degradation ability of Gordonia sp. FV1 towards different PAEs substrates.

[0032] Degradation rate of PAEs = 100% × ( C 0-C t ) / C 0 ( C 0 is the initial concentration of PAEs, C t and is the concentration of PAEs after treatment with strain FV1).

[0033] Test results PAEs are highly hydrophobic and difficult to degrade, especially some species with more complex side-chain structures such as DEHP, DCHP, BBP, etc. Gordonia sp. FV1 can degrade 14 PAEs molecules, including PAEs with short side chains, medium-length side chains, long side chains, and complex side chains ( Figure 5 ). Except for DMP, Gordonia sp. FV1 can almost completely degrade the other 13 PAEs, showing a strong degradation ability. Test Example 3 Soil Remediation Test of Gordonia sp. FV1 1 Test method A control group (CK) and a treatment group (T) were set up. DEHP was added to 10 mL of TEM liquid medium (pH value 8.0) to a final concentration of 0.5 mM, and Gordonia sp. FV1 was inoculated. Gordonia sp. FV1 was cultured and a bacterial suspension was prepared, with a bacterial concentration of 3×10 8 cfu / mL. In the treatment group (T), 20 g of soil (dry weight) was placed in a conical flask, DEHP was added to the soil to a final concentration of 100 mg / kg, 2 mL of the bacterial suspension was added, and the soil water content was adjusted to 50%. In the control group (CK), 2 mL of inactivated bacterial suspension was added, and other conditions were the same as those in the treatment group. The samples were cultured in a biochemical incubator at 30 °C for 1, 3, 6, 10, 20, and 30 days, and the content of DEHP in the soil was measured by HPLC.

[0034] Test results To evaluate the potential of Gordonia sp. FV1 in environmental remediation, the degradation effect of Gordonia sp. FV1 on DEHP in soil was studied. DEHP was added to the soil to a final concentration of 100 mg / kg, and Gordonia sp. FV1 was inoculated. The samples were cultured at 30 °C for 1 - 30 days respectively.

[0035] The test results are as Figure 6 shown. After 1 day, the DEHP in the soil decreased by 19.48%. As time increased, the degradation rate of DEHP in the soil gradually increased, and DEHP was completely degraded after 30 days. The above results indicate that Gordonia sp. FV1 can effectively remove DEHP from the soil and has great potential for soil remediation applications.

Claims

1. A strain of Gordonia Gordonia sp. ), characterized in that, Its microorganism preservation number is: CGMCC No.30310.

2. Use of the Gordonia described in claim 1 in degrading phthalates.

3. The use according to claim 2, characterized in that: The phthalates include dimethyl phthalate, diethyl phthalate, dipropyl phthalate, dibutyl phthalate, di-n-pentyl phthalate, dihexyl phthalate, diheptyl phthalate, dioctyl phthalate, dinonyl phthalate, didecyl phthalate, butyl benzyl phthalate, dicyclohexyl phthalate, di(2-ethyl)hexyl phthalate or diisobutyl phthalate.

4. Use of the Gordonia described in claim 1 in bioremediation of contaminated soil.

5. The use according to claim 4, characterized in that: The soil contains phthalates.

6. The use according to claim 5, characterized in that: The phthalates include dimethyl phthalate, diethyl phthalate, dipropyl phthalate, dibutyl phthalate, di-n-pentyl phthalate, dihexyl phthalate, diheptyl phthalate, dioctyl phthalate, dinonyl phthalate, didecyl phthalate, butyl benzyl phthalate, dicyclohexyl phthalate, di(2-ethyl)hexyl phthalate or diisobutyl phthalate.

7. A bacterial agent composition for degrading phthalates, comprising: The bacterial agent for degrading phthalates and the auxiliary material or carrier for preparation are characterized in that the bacterial agent for degrading phthalates is prepared from the Gordonia described in claim 1.

8. A bacterial agent composition for repairing contaminated soil, comprising: The bacterial agent for degrading phthalates and the auxiliary material or carrier for preparation are characterized in that the bacterial agent for degrading phthalates is prepared from the Gordonia described in claim 1.

9. A method for bioremediation of contaminated soil, characterized in that: include: The Gordonia described in claim 1 is prepared into a microbial agent; and the microbial agent is inoculated into contaminated soil to perform microbial degradation of phthalates.

10. The bioremediation method according to claim 9, characterized in that: The phthalates include dimethyl phthalate, diethyl phthalate, dipropyl phthalate, dibutyl phthalate, di-n-pentyl phthalate, dihexyl phthalate, diheptyl phthalate, dioctyl phthalate, dinonyl phthalate, didecyl phthalate, butyl benzyl phthalate, dicyclohexyl phthalate, di(2-ethyl)hexyl phthalate or diisobutyl phthalate.

Images