Acinetobacter baumannii SKLX17493 strain ugd gene knockout strain and construction and application thereof

Abstract

The invention discloses a ugd gene knockout strain of an acinetobacter baumannii SKLX17493 strain as well as construction and application of the ugd gene knockout strain. The method comprises the following steps: designing ugd gene upstream and downstream homologous arm sequence primers according to a genome sequence on acinetobacter baumannii, amplifying an acinetobacter baumannii SKLX17493 fusion fragment through cross PCR (Polymerase Chain Reaction), constructing a ugd-free recombinant suicide plasmid, transforming the plasmid, constructing a deleted strain, verifying that the strain ugd is successfully knocked out through sequencing, and the like. The acinetobacter baumannii ugd gene knockout strain constructed by the invention is used for researching the effect of the ugd gene on the biological characteristics of the acinetobacter baumannii. Results show that the complement killing resistance of the gene deletion strain is reduced, the normal division of bacteria is inhibited, and the like. Finally, the strain can also be used for researching the virulence mechanism of acinetobacter baumannii.

Description

Technical Field

[0001] The present invention relates to the technical field of bacteria, and particularly relates to a Ugd gene knockout strain of Acinetobacter baumannii SKLX17493 strain, and its construction and application. Background Art

[0002] Acinetobacter baumannii is a common Gram-negative conditional pathogen in clinical practice, and often causes bloodstream infections or pneumonia in severely immunocompromised patients. The 2020 National Bacterial Resistance Surveillance Report shows that this bacterium ranks fourth among all isolated Gram-negative bacteria, accounting for 9.5%, and the resistance rate to carbapenem antibiotics is 53.7%. Carbapenem-resistant Acinetobacter baumannii has been listed by the WHO as a pathogen that requires priority development of antibacterial drugs.

[0003] In addition to drug resistance, the virulence of Acinetobacter baumannii has attracted more and more attention, and capsular polysaccharide plays an important role in the full exertion of the virulence of Acinetobacter baumannii. Research shows that capsular polysaccharide can form a barrier around the bacterial cell wall, provide protection for bacteria against environmental stresses including drying, disinfectants, and host immune responses, and increase its resistance to a variety of antibacterial compounds. Ugd is one of the conserved genes encoding the capsular polysaccharide synthesis gene cluster. However, there has been no study on knocking out this gene in Acinetobacter baumannii, nor on its effects on the pathogenicity and biological functions of Acinetobacter baumannii.

[0004] At present, although there have emerged gene knockout methods for Acinetobacter baumannii including the double plasmid knockout technology, considering that this bacterium often has multi-drug resistance properties, there are many differences between strains, and the plasmids contained inside the bacterial cells are quite different in many cases, sometimes knocking out the internal genes of Acinetobacter baumannii by a single knockout method may not be successfully completed. Summary of the Invention

[0005] In order to solve the above problems, the purpose of the present invention is to provide a Ugd gene knockout strain of Acinetobacter baumannii SKLX17493 strain, and its construction and application.

[0006] The technical solution for the present invention to achieve its purpose is as follows: A Ugd gene knockout strain of Acinetobacter baumannii SKLX17493 strain, wherein the Ugd gene sequence is as shown in SEQ ID NO.11.

[0007] The construction method of the Ugd gene knockout strain of Acinetobacter baumannii SKLX17493 strain includes the following steps: (1)Based on the genomic sequence of Acinetobacter baumannii SKLX17493, the upstream primer SKLX17493-ugd-up-F (SEQ ID NO.1) and the downstream primer SKLX17493-ugd-up-R (SEQ ID NO.2) of the upstream homologous arm sequence of the ugd gene were designed, and the upstream primer SKLX17493-ugd-down-R (SEQ ID NO.3) and the downstream primer SKLX17493-ugd-down-F (SEQ ID NO.4) of the downstream homologous arm sequence of the ugd gene were designed; (2)Using the cross-PCR amplification method, with the genomic DNA of Acinetobacter baumannii SKLX17493 as the template, the upstream primer SKLX17493-ugd-up-F and the downstream primer SKLX17493-ugd-up-R were used for amplification to obtain the upstream homologous arm fragment of ugd; the upstream primer SKLX17493-ugd-down-R and the downstream primer SKLX17493-ugd-down-F were used for amplification to obtain the downstream homologous arm fragment of ugd; (3)Using the upstream homologous arm fragment and the downstream homologous arm fragment as templates, cross-PCR amplification was carried out to fuse the upstream homologous arm fragment and the downstream homologous arm fragment to obtain the upstream and downstream homologous arm fusion fragment of the ugd gene; (4)The fusion fragment was seamlessly cloned with the pMo130 vector digested by Not I and Bam HI to construct the ugd recombinant suicide plasmid; (5)The constructed ugd recombinant suicide plasmid was transformed into Escherichia coli S17 competent cells and introduced into the wild strain Acinetobacter baumannii SKLX17493 by conjugation, and the knockout strain was obtained by sucrose screening.

[0008] The application of the Acinetobacter baumannii SKLX17493 ugd gene knockout strain is used to study the influence of the ugd gene on the biological characteristics of Acinetobacter baumannii, including the ability to resist complement killing, bacterial morphology, and the role in the Galleria mellonella virulence model.

[0009] In summary, compared with the prior art, the advantages of the present invention are as follows: The Acinetobacter baumannii ugd gene knockout method provided by the present invention constructs a ugd recombinant suicide plasmid, constructs a knockout vector, chemically transforms the vector into the SKLX17493 wild strain, successfully constructs a gene deletion strain, reduces the ability of bacteria to resist complement killing, the median survival time of the Galleria mellonella virulence model, increases the cell length, and the adhesion ability to epithelial cells A549. Description of the Drawings

[0010] Figure 1A:Sequence structure diagram of the upstream fragment of the ugd gene; 5’→3’, containing a 15bp homologous fragment and a restriction enzyme site on the plasmid, as well as a fragment homologous to the 15bp sequence downstream of ugd.

[0011] Figure 1B :Sequence structure diagram of the ugd gene; The deleted sequence is indicated by a strikethrough.

[0012] Figure 1C :Sequence structure diagram of the downstream fragment of the ugd gene; 5’→3’, containing a 15bp terminal homologous fragment upstream of ugd, as well as a restriction enzyme site on the plasmid and a 15bp sequence homologous fragment.

[0013] Figure 2 :Amplifying the upstream and downstream fragments of the ugd gene; Among them, lanes 1-8 are the upstream fragments with a size of 737bp; lanes 9-16 are the downstream fragments with a size of 784bp.

[0014] Figure 3 :Amplifying the △ugd fusion fragment; Lanes 1-10: The arrow indicates the successfully constructed fusion fragment with a size of 1506 bp.

[0015] Figure 4 :Constructing the recombinant plasmid pM130--△ugd; Lanes 1-7: Picking monoclonal colonies on the resistant plate; lane 8: pMo130 control; the length of the empty vector amplification is 519 bp; the length after inserting △ugd is 1974 bp.

[0016] Figure 5 :Obtaining single crossover mutants. Lanes 1-16 are 8 monoclonal colonies respectively; among them, the odd numbers use the primers pMo130-R and ugd-conF, and the even numbers use the primers pMo130-F and ugd-conR. The amplification fragment length of ⑦⑥ should be 2242bp; the amplification fragment length of ⑤⑧ should be 3043 bp.

[0017] Figure 6 :Obtaining the ugd gene deletion strain through double crossover; Lanes 1-23 samples are different white clones as templates, using ugd-conF and ugd-conR as primers. The theoretical amplification band of the wild strain is 2951 bp, and the theoretical amplification band of the knockout strain is 1788 bp (lane 18).

[0018] Figure 7 :Transcriptional expression of the ugd gene in wild type, knockout and complemented strains.

[0019] Figure 8 : Role of the ugd gene in the killing of Acinetobacter baumannii by serum complement. *: p ≤ 0.05.

[0020] Figure 9 : Role of the ugd gene in the heat shock response of Acinetobacter baumannii. *: p ≤ 0.05.

[0021] Figure 10 : Role of the ugd gene in the adhesion of Acinetobacter baumannii to epithelial cells A549. *: P < 0.05; ns: P > 0.05.

[0022] Figure 11 : Effect of the ugd gene on the cell morphology of Acinetobacter baumannii; Scanning electron microscopy shows the effect of ugd on the cell surface. The scale bar for the figure magnified 20,000 times is 1 μm, and the scale bar for the figure magnified 5,000 times is 5 μm.

[0023] Figure 12 : Kaplan-Meier analysis of the survival curve of Galleria mellonella infected with Acinetobacter baumannii. Detailed implementation manners

[0024] The present invention will be further described below with reference to the accompanying drawings.

[0025] An Acinetobacter baumannii SKLX17493 strain ugd gene knockout strain, wherein the ugd gene sequence is as shown in SEQ ID NO.11. Figure 1A : Sequence structure diagram of the upstream fragment of the ugd gene; 5' → 3', containing a 15bp homologous fragment and a restriction enzyme site on the plasmid, and a fragment homologous to the 15bp sequence downstream of ugd. Figure 1B : Sequence structure diagram of the ugd gene; the deleted sequence is indicated by a strikethrough.

[0026] Figure 1C : Sequence structure diagram of the downstream fragment of the ugd gene; 5' → 3', containing a 15bp terminal homologous fragment upstream of ugd and a restriction enzyme site and a 15bp sequence homologous fragment on the plasmid.

[0027] The construction method of the Acinetobacter baumannii SKLX17493 strain ugd gene knockout strain comprises the following steps: (1)Based on the genomic sequence of Acinetobacter baumannii SKLX17493, the upstream primer SKLX17493-ugd-up-F (SEQ ID NO.1) and the downstream primer SKLX17493-ugd-up-R (SEQ ID NO.2) of the upstream homologous arm sequence of the ugd gene were designed, and the upstream primer SKLX17493-ugd-down-R (SEQ ID NO.3) and the downstream primer SKLX17493-ugd-down-F (SEQ ID NO.4) of the downstream homologous arm sequence of the ugd gene were designed; (2)Using the cross-PCR amplification method, with the genomic DNA of Acinetobacter baumannii SKLX17493 as the template, amplifying with the upstream primer SKLX17493-ugd-up-F and the downstream primer SKLX17493-ugd-up-R to obtain the upstream homologous arm fragment of ugd; amplifying with the upstream primer SKLX17493-ugd-down-R and the downstream primer SKLX17493-ugd-down-F to obtain the downstream homologous arm fragment of ugd; (3)Using the upstream homologous arm fragment and the downstream homologous arm fragment as templates, performing cross-PCR amplification to fuse the upstream homologous arm fragment and the downstream homologous arm fragment to obtain the upstream and downstream homologous arm fusion fragment of the ugd gene; (4)Performing seamless cloning of the fusion fragment with the pMo130 vector digested by Not I and Bam HI to construct the ugd recombinant suicide plasmid; (5)Transforming the constructed ugd recombinant suicide plasmid into Escherichia coli S17 competent cells and introducing it into the wild strain Acinetobacter baumannii SKLX17493 by conjugation, and obtaining the knockout strain through sucrose screening.

[0028] The application of the Acinetobacter baumannii SKLX17493 ugd gene knockout strain is used to study the influence of the ugd gene on the biological characteristics of Acinetobacter baumannii, including the ability to resist complement killing, bacterial morphology, and the role in the Galleria mellonella virulence model.

[0029] The method for knocking out, complementing, and applying the ugd gene in the genome of Acinetobacter baumannii SKLX17493 provided in this example includes the following steps: I. Gene knockout 1. Primer design: Based on the genomic sequence of Acinetobacter baumannii SKLX17493, the upstream primer SKLX17493-ugd-up-F and the downstream primer SKLX17493-ugd-up-R of the upstream homologous arm sequence of the ugd gene were designed, and the upstream primer SKLX17493-ugd-down-R and the downstream primer SKLX17493-ugd-down-F of the downstream homologous arm sequence of the ugd gene were designed; SKLX17493-ugd-up-F: cgcatgcatctagagGGATCCTTTAGGCCTAGGGCATGCTG (SEQ ID NO. 1) SKLX17493-ugd-up-R: TACACCAGCATGTAAGGTGGTTCCAAATACCGCGA (SEQ ID NO. 2) SKLX17493-ugd-down-R: accgtgctgacctgaGCGGCCGCTCAAGCCACTGACGAACTGT (SEQ ID NO. 3) SKLX17493-ugd-down-F: TTACATGCTGGTGTACGATCCGGCATATGTGAAAGC (SEQ ID NO. 4).

[0030] 2. Cross-PCR amplification of the Acinetobacter baumannii SKLX17493-ugd fusion fragment 2.1 Amplification of the upstream and downstream homologous arms of the gene Amplified with SKLX17493-ugd-up-F / SKLX17493-ugd-up-R to obtain the ugd upstream homologous arm a fragment; Amplified with SKLX17493-ugd-down-F / SKLX17493-ugd-down-R to obtain the ugd downstream homologous arm b fragment; The amplification program is as shown in Table 1 below:

[0031] The PCR verification of the amplification result of the ugd amplification fragment is as Figure 2 shown, where lanes 1-8 are all a fragments with a length of 737 bp; 9-16 are all b fragments with a length of 784 bp.

[0032] 2.2 Gene fusion of the upstream and downstream homologous arms of the ugd gene Using the ugd upstream homologous arm a fragment and the ugd downstream homologous arm b fragment as templates, cross-PCR amplification was carried out; the fusion ab fragment, and the reaction system is as shown in Table 2 below:

[0033] The amplification results of the overlapping amplification fragments verified by PCR are as Figure 3 shown.

[0034] 2.3 Construction of the ugd recombinant suicide plasmid 2.3.1 Construction of the linear knockout vector The pMo130 plasmid was double-digested with the restriction endonucleases Not I and Bam HI respectively, and the reaction system is shown in Table 3 below:

[0035] The reaction was carried out at 37 °C for 1 h. After agarose gel electrophoresis and recovery of the digestion products, the Bam HI digestion products were used again, and the reaction system is shown in Table 4 below:

[0036] The reaction was carried out at 30 °C for 1 h, and the reaction products were subjected to agarose gel electrophoresis and purified and recovered.

[0037] 2.3.2 Seamless cloning Please refer to Table 5 for the reaction system.

[0038]

[0039] Incubate in a PCR instrument at 37 °C for 30 min, transform E. coli DH5α competent cells, spread on tellurite-resistant plates, culture overnight at 37 °C, pick clones and perform PCR amplification using the primers pMo130-F and pMo130-R, as Figure 4 shown.

[0040] pMo130-F: GTATCACGAGGCCCTTTCGT (SEQ ID NO. 5) pMo130-R: CGCCCAGTTTCTCAGTCTGT (SEQ ID NO. 6).

[0041] 2.4 Transfer pMo130-△ugd into Acinetobacter baumannii 2.4.1 First, introduce the plasmid pMo130-△ugd into Escherichia coli S17-1 competent cells: Take the S17-1 cells out of the -80°C refrigerator, immediately place them on crushed ice. Wait for about 5 minutes until the bacterial cells thaw. Add pMo130-△ugd, and gently flick the bottom of the EP tube to mix evenly. Let it stand still in ice for 25 minutes. Heat shock at 42°C in a water bath for 45 seconds, immediately put it back on ice and let it stand still for 2 minutes. Add 700 μl of antibiotic-free LB medium to the centrifuge tube, mix well, and resuscitate at 37°C and 200 rpm for 60 minutes. At room temperature, centrifuge at 5000 rpm for 1 minute to collect the bacterial cells. Take 100 μl of the supernatant to resuspend the bacterial cells and spread them on MHA medium containing 6 mg / L potassium tellurite. After overnight incubation, select monoclonal colonies for the next step.

[0042] 2.4.2 Introduce the constructed plasmid pMo130-△ugd into Acinetobacter baumannii SKLX017493: ① Inoculate SKLX017493 and S17-1(pMo130-△ugd) respectively. After overnight incubation, pick monoclonal colonies. Inoculate S17-1(pMo130-△ugd) into LB medium containing 50 mg / L kanamycin, and inoculate SKLX17493 into ordinary LB medium, and incubate overnight. ② Take 200 μl from each of the two media and add them to 1000 μl of LB medium. Centrifuge at 5000 rpm for 3 minutes at room temperature. Wash the bacterial cells twice with 2 ml of LB medium. Add 30 μl of LB to resuspend the bacteria. Titrate all the resuspended solutions on the MHA plate and incubate at 30°C for 16 h. ③ Collect the bacterial cells from the plate, resuspend the bacterial cells with 400 μl of PBS with pH = 7.2. Take 100 μl of the resuspended solution and spread it on the MHA plate containing double antibiotics (30 mg / L potassium tellurite and 50 mg / L chloramphenicol), and incubate overnight at 37°C. ④ In a sterile environment, gently spray the surface of the plate with 0.45 mol / L catechol. Pick the yellow colonies for PCR identification. The primers used are pMo130-R, ugd-conF and pMo130-F, ugd-conR. Clones with band sizes consistent with the theoretical amplification lengths indicate that the suicide plasmid has inserted into Acinetobacter baumannii SKLX017493 through single crossover ( Figure 5 ).

[0043] pMo130-F: GTATCACGAGGCCCTTTCGT (SEQ ID NO. 5) pMo130-R: CGCCCAGTTTCTCAGTCTGT (SEQ ID NO. 6) ugd-conF: CAGGAGCAATACCCCACTCAG (SEQ ID NO.7) ugd-conR:CGTTTGTTGATCGTCCTGCAA (SEQ ID NO. 8). 2.5 Screening and identification of Acinetobacter baumannii SKLX017493-△ugd

[0044] ① Sucrose screening: The clones that have undergone a successful single exchange are placed in LB medium containing 10% sucrose for subculture. Since pMo130 contains sacB gene-encoded sucrose fructanase, which can convert sucrose into high molecular weight fructans and subsequently cause bacterial death, during continuous subculture in LB medium containing sucrose, the yellow clones that have undergone a successful single exchange will undergo a double exchange, resulting in a wild strain or a strain with a ugd gene deletion.

[0045] ② Transfer the bacterial solution at a ratio of 1:1000 each time, dilute an appropriate amount of the bacterial solution every day and spread it on the MHA plate, and culture it in an incubator at 37°C overnight; ③ Spray the plate surface lightly with 0.45 mol / L catechol, pick the common clone strains that have not turned yellow, and use primers ugd-conF and ugd-conR for PCR identification. The results show that the knockout is successful ( Figure 6 ), and sent to Hangzhou Qingke Biotechnology Co., Ltd. for sequencing.

[0046] 2. Gene complementation After the knockout was completed, the complementation vector pYMAb2-ugd was constructed and the ugd gene was amplified using primers ugd-F and ugd-R.

[0047] ugd-F: TGGTGGTGCTCGAGTGCGGCCGCATGAAAATCGCGGTATTTGG (SEQ ID NO. 9) ugd-R: CAGCAAATGGGTCGCGGATCCTAAGCGAAACCTTTTGCTTTC (SEQ ID NO. 10) The pMAb2 plasmid was digested with Not 1 and Bam HI, and the ugd gene was ligated to the digested pMAb2 by seamless cloning as described above, and transformed into competent Escherichia coli S17. Then, it was transferred to the knockout strain SKLX17493-△ugd by conjugation to obtain the complemented strain SKLX1493-△ugd-C. The expression of ugd in the complemented strain was verified by Q-PCR ( Figure 7 ).

[0048] 3. The above strains were used to study the biological characteristics of UGD, such as its virulence against Acinetobacter baumannii.

[0049] Complement-resistant killing assay: Bacteria in the logarithmic growth phase were taken, and the bacterial suspension concentration was adjusted to 1×10 8 CFU / ml. An appropriate amount of whole blood was drawn from volunteers, inverted several times at 180°, placed in a refrigerator at 4°C for 30 min, centrifuged at 4000 rpm for 15 min, the upper-layer serum was drawn, and filtered through a 0.22 μm filter element. The serum was placed in a water bath at 56°C and incubated for 30 min to inactivate complement. In a laminar flow hood, 100 μl of the bacterial suspension was added to 900 μl of sterile PBS with pH = 7.2 and mixed well; then 200 μl of the mixed bacterial suspension was taken and added to 800 μl of PBS with pH = 7.2 and mixed well. 180 μl of serum containing inactivated complement and serum containing normal complement were respectively placed in 1.5 ml EP tubes with the above 20 μl of bacterial suspension and gently mixed, and incubated in a water bath at 37°C for 1 h. The bacterial suspension treated with serum was diluted 100 times, 100 μl of the diluted bacterial suspension was taken and spread on an MH agar plate, and colony counting was performed after overnight culture. The calculation formula for the survival rate of bacterial cells is: Bacterial survival rate = number of colonies in normal serum / number of colonies in inactivated serum × 100%, and the quality control strain is Acinetobacter baumannii ATCC17978. As Figure 8 shown.

[0050] Heat shock assay: Bacteria in the logarithmic growth phase were adjusted to 1×10 8 CFU / ml, 1 ml was taken and incubated in a water bath at 37°C for 20 min, and at the same time, another 1 ml was taken and incubated in a water bath at 55°C for 20 min. After the incubated bacteria were serially diluted at a 10-fold ratio, they were spread on an MH agar plate, and counting was performed after overnight incubation. The survival rate of bacteria after heat shock is: CFUs after treatment at 55°C / CFUs after incubation at 37°C × 100%. As Figure 9 shown.

[0051] Epithelial cell adhesion assay: Human alveolar epithelial A549 cells were cultured in DMEM / F12 medium containing 10% heat-inactivated fetal bovine serum in a 5% CO 2 incubator at 37°C. When the confluence reached about 80%, they were digested, resuspended, plated in a 24-well plate, and incubated overnight. The bacteria in the logarithmic growth phase cultured in LB were washed 2 times with PBS with pH = 7.2, and their concentration was adjusted to 10 7CFU / ml. Add the above bacteria to cells with a confluence of about 90% at a ratio of multiplicity of infection (MOI) of 1:10, and centrifuge at 600 g for 5 min. Incubate at 37 °C for 120 min, wash 3 times with PBS to remove non-adherent bacteria, and then dissolve with 1 ml of sterile deionized water containing 0.25% Triton X-100 for 5 min. After serial dilution and plating, colony counting was performed after overnight incubation. As Figure 10 shown.

[0052] Scanning electron microscopy observation: Take 5 ml of bacteria in the logarithmic growth phase, centrifuge at 5000 rpm for 5 min, and discard the supernatant waste liquid; fix with 2.5% glutaraldehyde solution at room temperature for 1.5 h, and then place in a 4 °C refrigerator for overnight fixation; discard the fixing solution, add 1 ml of freshly prepared 0.1 M PBS with pH = 7.2 and rinse 3 times, 12 min each time; discard the PBS, add 1% osmium tetroxide solution that can cover the sample, and fix for 1 h; discard the osmium tetroxide fixing waste liquid into a special collection container, and rinse 3 times with 1 ml of PBS with pH = 7.2, 12 min each time; discard the PBS waste liquid, and dehydrate the sample with 50%, 70%, and 90% ethanol in sequence for 12 min each; discard the above ethanol, treat with 100% ethanol twice, 20 min; after critical point drying and coating, observe with an electron microscope, as Figure 11 shown. Greater wax moth infection experiment: Take bacteria in the logarithmic growth phase, centrifuge at 4000 rpm for 5 min, resuspend with PBS with pH = 7.2 and adjust the bacterial concentration to 1×107 CFU / ml uniformly; Randomly divide the greater wax moths with normal milky white body color, a length of 2 - 3 cm, a weight between 250 - 300 mg, and normal vitality cultured for about 1 month into five groups, with 15 in each group; Use a sterile micro syringe to pierce from the left last auxiliary foot, horizontally move upward to a depth of about 1.5 cm, and slowly inject 10 μl of 1×10 7 CFU / ml of bacteria, and place them in 2 9-cm petri dishes; At the same time, set up two control groups, one group for injecting an equal volume of PBS with pH = 7.2, and the other group without any injection. Culture the greater wax moths in a 37 °C incubator and observe once every 12 h; Gently poke the worms with forceps, and complete lack of response is considered death. Remove the dead greater wax moths from the petri dish. As Figure 12 shown.

[0053] Although the embodiments of the present invention have been shown and described above, it can be understood that the above embodiments are only exemplary and should not be construed as limiting the present invention. Those of ordinary skill in the art can make changes, modifications, substitutions, and variations to the above embodiments within the scope of the present invention without departing from the principles and purposes of the present invention, which also belong to the protection scope of the present invention.

Claims

1. A ugd gene knockout strain of Acinetobacter baumannii SKLX17493 strain, characterized in that: The ugd gene sequence is shown in SEQ ID NO.

11.

2. A method for constructing the ugd gene knockout strain of Acinetobacter baumannii SKLX17493 strain according to claim 1, characterized in that: The following steps are involved: (1) Based on the genome sequence of Acinetobacter baumannii SKLX17493, the upstream primer SKLX17493-ugd-up-F (SEQ ID NO. 1) and the downstream primer SKLX17493-ugd-up-R (SEQ ID NO. 2) of the upstream homology arm sequence of the ugd gene were designed, and the upstream primer SKLX17493-ugd-down-R (SEQ ID NO. 3) and the downstream primer SKLX17493-ugd-down-F (SEQ ID NO. 4) of the downstream homology arm sequence of the ugd gene were designed; (2) Using the cross-PCR amplification method, the genomic DNA of Acinetobacter baumannii SKLX17493 was used as a template, and the upstream primer SKLX17493-ugd-up-F and the downstream primer SKLX17493-ugd-up-R were used for amplification to obtain the upstream homology arm fragment of ugd; the upstream primer SKLX17493-ugd-down-R and the downstream primer SKLX17493-ugd-down-F were used for amplification to obtain the downstream homology arm fragment of ugd; (3) Using the upstream homology arm fragment and the downstream homology arm fragment as templates, cross PCR amplification is performed to fuse the upstream homology arm fragment and the downstream homology arm fragment to obtain the upstream and downstream homology arm fusion fragment of the ugd gene; (4) Seamlessly clone the fusion fragment into the pMo130 vector digested with Not I and Bam HI to construct the ugd recombinant suicide plasmid; (5) The constructed ugd recombinant suicide plasmid was transformed into Escherichia coli S17 competent cells and introduced into the wild strain of Acinetobacter baumannii SKLX17493 by conjugation, and the knockout strain was obtained by sucrose screening.

3. A use of the Acinetobacter baumannii SKLX17493 ugd gene knockout strain as claimed in claim 1, characterized in that: Used to study the effects of the ugd gene on the biological characteristics of Acinetobacter baumannii, including anti-complement killing ability, bacterial morphology and the virulence model of the wax moth.

Images