Alkaline incision beta-1, 4 xylanase XynT and application thereof
Through bioengineering technology, the basic endotomy β-1,4 xylanase XynT is optimized and expressed, and the existing enzymes have insufficient alkali resistance and heat resistance, and the enzymes with high activity in high alkali environments are achieved, which are suitable for a variety of industrial and food fields.
Patent Information
- Application Number
- CN202510194025.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-21
- Publication Date
- 2025-05-30
AI Technical Summary
The existing endotomy β-1,4 xylanase has insufficient alkali resistance and heat resistance, and the pH range is small, which limits its wide application in food, papermaking, wastewater treatment and feed fields.
Through bioengineering technology, the codons derived from Streptocytica were optimized and heterologously expressed onto the vector, and transferred to E. coli to amplify and express, and obtained basic endotomy β-1,4 xylanase XynT with high endotomy β-1,4 xylanase activity.
It has achieved endotomy β-1,4 xylanase with high activity in high alkali environment, with a wide pH range and good heat resistance, and is suitable for flour improvement, probiotic value-added, fruit and vegetable processing, pulping processing, industrial wastewater treatment and other fields.
Smart Images

Figure CN120060211A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of bioengineering, and particularly relates to an alkaline endo-β-1,4-xylanase XynT and its application. Background Art
[0002] Endo-β-1,4-xylanase (Endo-1,4-β-xylanase, abbreviated as Xyn) acts on xylan and long-chain xylo-oligosaccharides, randomly hydrolyzing and breaking the β-1,4-xylosidic bonds inside the main chain of xylan. Most of them act on the side-chain-free segments of xylan, producing xylo-oligosaccharides or oligosaccharides with side chains, thereby reducing the degree of polymerization of xylan. Therefore, endo-β-1,4-xylanase has great application potential in the fields of food, papermaking, wastewater treatment, feed, etc.
[0003] Natural Xyn widely exists in animals, plants and microorganisms. However, the yield of Xyn in animals and plants is low and it is difficult to extract. Microorganisms grow rapidly, have simple culture conditions and relatively simple preparation, and are currently an important source of Xyn. However, the current endo-β-1,4-xylanases on the market have deficiencies such as poor alkali resistance and heat resistance, and a small pH action range, which limits the wide application of endo-β-1,4-xylanase. Therefore, it is urgent to explore and characterize new endo-β-1,4-xylanases with excellent performance. Summary of the Invention
[0004] In view of some deficiencies in the prior art, the present invention provides an alkaline endo-β-1,4-xylanase XynT and its application. The present invention optimizes the codons of a putative protein derived from Streptomyces through bioengineering technology, heterologously expresses it on a vector, and transfers it into Escherichia coli with a clear genetic background and a fast growth cycle for amplification and expression. After purification, a protein product is prepared. The amino acid sequence of the protein product is shown in SEQ ID NO.1, and the nucleotide sequence encoding the protein product is shown in SEQ ID NO.2. The present invention characterizes that the protein product has high endo-β-1,4-xylanase activity, denoted as alkaline endo-β-1,4-xylanase XynT. The alkaline endo-β-1,4-xylanase XynT has outstanding advantages such as alkali resistance, a wide pH action range, and high enzyme activity, and has good applications in the fields of food, papermaking, wastewater treatment, feed, etc.
[0005] In order to achieve the above technical effects, the present invention adopts the following technical means:
[0006] The present invention first provides an alkaline endo-β-1,4-xylanase XynT, and the amino acid sequence of the alkaline endo-β-1,4-xylanase XynT is shown in SEQ ID NO.1.
[0007] The present invention also provides a gene encoding the above-mentioned alkaline endo-β-1,4-xylanase XynT.
[0008] Preferably, the nucleotide sequence of the gene includes SEQ ID NO.2, or its degenerate sequence.
[0009] The present invention also provides a recombinant vector containing the above-mentioned gene.
[0010] Preferably, the expression vector of the recombinant vector includes pET28a.
[0011] The present invention also provides a recombinant bacterium, which contains the gene encoding the above-mentioned alkaline endo-β-1,4-xylanase XynT, or the above-mentioned recombinant vector.
[0012] Preferably, the construction method of the recombinant bacterium includes:
[0013] (1) Linearize the pET28a plasmid to obtain a linearized pET28a plasmid, then ligate the linearized pET28a plasmid with the gene encoding alkaline endo-β-1,4-xylanase XynT by seamless cloning, and transform it into Escherichia coli competent cells by heat shock method. After PCR and Sanger sequencing, a recombinant vector is obtained;
[0014] (2) Transfer the recombinant vector into a host bacterium to obtain the recombinant bacterium.
[0015] Preferably, the host bacterium of the recombinant bacterium includes Escherichia coli.
[0016] The present invention also provides a production method of the above-mentioned alkaline endo-β-1,4-xylanase XynT, and the method includes: culturing, inducing expression, and separating and purifying the above-mentioned recombinant bacterium to obtain the alkaline endo-β-1,4-xylanase XynT.
[0017] The present invention also provides the application of the above-mentioned alkaline endo-β-1,4-xylanase XynT, or the alkaline endo-β-1,4-xylanase XynT encoded by the above-mentioned gene, or the alkaline endo-β-1,4-xylanase XynT produced by the above-mentioned recombinant bacterium in flour improvement, probiotic proliferation, fruit and vegetable processing, pulp processing, industrial wastewater treatment, liquefaction of coffee mucus, clarification of fruit juice and wine, and production and processing of vegetable oil.
[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0019] In the present invention, the codons of a putative protein derived from Streptomyces are optimized through bioengineering technology and heterologously expressed on a vector, and then transferred into Escherichia coli with a clear genetic background and a fast growth cycle for amplification and expression to obtain a protein product; the amino acid sequence of the protein product is shown in SEQ ID NO.1, and the nucleotide sequence encoding the protein product is shown in SEQ ID NO.2; it is characterized in the present invention that the protein product has a high endo-β-1,4-xylanase activity, denoted as alkaline endo-β-1,4-xylanase XynT. This alkaline endo-β-1,4-xylanase XynT can have a high endo-β-1,4-xylanase activity under high alkalinity, and has outstanding advantages such as simple operation, rapid preparation, and high purity.
[0020] For the alkaline endo-β-1,4-xylanase of the present invention, the enzyme activity can reach 12235 U / mg at pH = 8 and 55 °C; the relative enzyme activity of the alkaline endo-β-1,4-xylanase can reach more than 50% within the temperature range of 50 - 60 °C, and there is still more than 10% activity at 65 °C; the relative enzyme activity of the alkaline endo-β-1,4-xylanase can reach more than 60% within the pH range of 6.0 - 8.0.
[0021] Compared with other endo-β-1,4-xylanases, the putative protein of the present invention is verified to have excellent properties of endo-β-1,4-xylanase; this alkaline endo-β-1,4-xylanase XynT has never been characterized, and it has outstanding advantages such as high endo-β-1,4-xylanase activity, alkali resistance, and a wide pH action range, and has good applications in the fields of food, papermaking, wastewater treatment, and feed, and can be used in fields such as flour improvement, probiotic proliferation, fruit and vegetable processing, pulp processing, industrial wastewater treatment, liquefaction of coffee mucus, clarification of fruit juice and wine, and production and processing of vegetable oil. Description of the Drawings
[0022] Figure 1 It is the electrophoresis pattern of the target gene after PCR amplification in Example 1.
[0023] Figure 2 It is the map of the recombinant vector pET28a-XynT.
[0024] Figure 3 It is the SDS-PAGE pattern of the expression product after shake-flask fermentation of recombinant Escherichia coli H1; in the figure, M: standard protein Marker; 1: the induced BL21(DE3) / pET28a bacterial solution; 2: the supernatant of the broken H1 cells after induction; 3: the precipitate of the broken H1 cells after induction; 4: the endo-β-1,4-xylanase XynT protein purified by Ni-NTA in H1.
[0025] Figure 4Activity of alkaline endo-β-1,4-xylanase XynT at different pH values (A) and temperatures (B). Detailed implementation manners
[0026] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, but the protection scope of the present invention is not limited thereto. In the following embodiments, various processes and methods not described in detail are all conventional methods well known in the art. The sources, trade names of the reagents used and those for which it is necessary to list their components are indicated when they first appear. For the same reagents used later, without special instructions, they are the same as those indicated in the first appearance; the reagents, materials, etc. involved are not specially described, and they are all for commercial use.
[0027] In the following embodiments, the pET28a plasmid, JM109 competent cells, and Escherichia coli BL21(DE3) are all common materials in the art, so they will not be described in detail; the components of the LB medium described in the following embodiments include: 1% tryptone + 0.5% yeast extract + 1% NaCl + 8 g / L glucose + 50 μg / mL kanamycin sulfate.
[0028] Example 1: Obtaining of the target gene
[0029] In the present invention, the hypothetical protein in Streptomyces (Genbank accession no. WP_182667183.1) is codon-optimized according to Escherichia coli BL21(DE3). The codon-optimized sequence is shown in SEQ ID NO.2, and the protein encoded by it is shown in SEQ ID NO.1. It is submitted to GenScript Biotech Corporation for the synthesis of the target gene (SEQ ID NO.2, the same below) fragment.
[0030] SEQ ID NO.1:
[0031] ASTLGAAAAEKGRYFGAAVANNRLGESDYVNTLNREFNSITAENEMKWESLQRTRGNFTFTEADRIANHARSRGMSLRGHTLVWHSQLPGWVDNINNATELRTVMRTHIETVMGRYRGQVHSWDVVNEAFQDGSSGARRNSVFQRVLGNGYIEESFRMARAADPNAKLCYNDYNTDGRNAKSDAVYNLVRDLKQRGVPIDCVGFQSHFNPQSPVPNDYQANLQRFADLGVEVQITELDIEGSGTAQANDYRRVIQACLNVSRCTGITVWGVTDKYSWRSSGTPLLFDGNYNKKPAYDAVLATLGGSSNGGGTGGGTGGG
[0032] SEQ ID NO.2:
[0033] GCTAGCACCCTGGGTGCAGCAGCAGCCGAAAAAGGTCGCTATTTTGGTGCAGCCGTTGCAAATAATCGCCTGGGTGAAAGTGATTATGTTAATACCCTGAATCGTGAATTTAACAGCATTACCGCCGAAAATGAAATGAAATGGGAAAGCCTGCAGCGCACCCGCGGTAATTTTACCTTTACCGAAGCCGATCGTATTGCAAATCATGCACGCAGTCGCGGTATGAGCCTGCGTGGTCATACCCTGGTGTGGCATAGCCAGCTGCCGGGCTGGGTTGATAATATTAATAATGCCACCGAACTGCGTACCGTGATGCGCACCCATATTGAAACCGTGATGGGTCGTTATCGCGGTCAGGTGCATAGCTGGGATGTTGTTAATGAAGCATTTCAGGATGGTAGTAGCGGCGCACGTCGTAATAGCGTGTTTCAGCGCGTGCTGGGTAATGGTTATATTGAAGAAAGCTTTCGCATGGCCCGCGCCGCCGATCCGAATGCAAAACTGTGTTATAATGATTATAACACCGACGGTCGTAATGCAAAAAGCGATGCAGTTTATAATCTGGTTCGTGATCTGAAACAGCGCGGCGTTCCGATTGATTGCGTGGGCTTTCAGAGCCATTTTAATCCGCAGAGTCCGGTGCCGAATGATTATCAGGCAAATCTGCAGCGTTTTGCCGATCTGGGTGTGGAAGTGCAGATTACCGAACTGGATATTGAAGGTAGTGGTACCGCACAGGCAAATGATTATCGCCGTGTGATTCAGGCCTGTCTGAATGTGAGTCGTTGCACCGGCATTACCGTGTGGGGCGTGACCGATAAATATAGTTGGCGTAGCAGCGGCACCCCGCTGCTGTTTGATGGCAATTATAATAAAAAGCCGGCCTATGATGCAGTTCTGGCAACCCTGGGTGGCAGCAGCAATGGCGGTGGCACCGGCGGTGGTACCGGTGGTGGT。
[0034] Using the synthesized gene fragment as a template, PCR amplification was carried out with primers F1 and R1, and the product obtained by PCR amplification was verified by agarose gel electrophoresis. The verification results are as Figure 1 shown.
[0035] F1: ctggtgccgcgcggcagc AGCCTGCCGAATGGCAGCTGGC (SEQ ID NO.3, the underlined part is the homologous arm);
[0036] R1: ggtggtggtggtggtgctcgagtta ATCTTCATTAATATGCAC (SEQ ID NO.4, the underlined part is the homologous arm).
[0037] Figure 1 is the electrophoresis pattern of the product obtained by PCR amplification. It can be seen from the figure that the length of the product obtained by PCR amplification is 957 bp. This is because the primers for seamless cloning are relatively long and will contain homologous arm fragments. Finally, the band after PCR is larger than the band with only the target gene fragment. The size of the band is consistent with the sum of the sizes of the target gene and the primers, indicating that the target gene has been successfully obtained.
[0038] Example 2: Construction of recombinant vector and recombinant bacterium containing the target gene
[0039] (1) Construction of recombinant vector pET28a-XynT:
[0040] Using the pET28a plasmid as a template, PCR linearization was carried out with primers F2 and R2 to obtain a linearized plasmid fragment; then the linearized plasmid fragment was ligated with the target gene obtained in Example 1 by seamless cloning to obtain the recombinant vector pET28a-XynT.
[0041] The obtained recombinant vector pET28a-XynT was transformed into JM109 competent cells by heat shock method. After verification by PCR and Sanger sequencing, the recombinant vector pET28a-XynT was successfully constructed; the map of the recombinant vector pET28a-XynT is as Figure 2 shown.
[0042] Among them, the sequences of primers F2 and R2 are as follows:
[0043] F2: caccaccaccaccaccac (SEQ ID NO.5);
[0044] R2: gctgccgcgcggcaccag (SEQ ID NO.6).
[0045] (2) Construction of recombinant bacterium:
[0046] The recombinant vector pET28a-XynT was transferred into Escherichia coli BL21(DE3) to obtain a recombinant bacterium, denoted as recombinant Escherichia coli H1, for standby.
[0047] In this step, an empty vector strain was also used as a control to investigate the expression products of recombinant Escherichia coli H1 after shake flask fermentation. The empty vector strain pET28a / BL21(DE3) was obtained by directly transferring the pET28a plasmid into Escherichia coli BL21(DE3). The specific investigation steps were as follows:
[0048] S1. Seed liquid preparation:
[0049] The glycerol-preserved empty vector strain pET28a / BL21(DE3) and recombinant Escherichia coli H1 were respectively streaked on a plate, and single colonies were picked and inoculated into a 250 ml conical flask containing 50 mL of LB liquid medium, and shaken overnight at 37 °C and 220 r / min to obtain the seed liquids of the overnight-cultured empty vector strain pET28a / BL21(DE3) and recombinant Escherichia coli H1.
[0050] S2. Fermentation:
[0051] The seed liquids of the overnight-cultured empty vector strain pET28a / BL21(DE3) and recombinant Escherichia coli H1 were respectively centrifuged, and the cells were resuspended with LB medium and inoculated into a shake flask fermentation medium to make their initial OD 600 be 0.1. Then, they were cultured at 37 °C and 220 r / min until the OD 600 was about 0.6, and then 0.5 mM IPTG was added to induce the empty vector strain pET28a / BL21(DE3) and recombinant Escherichia coli H1. After induction, the culture conditions were adjusted to 16 °C and 100 r / min and cultured for 24 h to obtain the induced culture liquids of the empty vector strain pET28a / BL21(DE3) and recombinant Escherichia coli H1.
[0052] S3. Sample treatment:
[0053] 1 mL of the induced culture liquids of the empty vector strain pET28a / BL21(DE3) and recombinant Escherichia coli H1 were respectively taken into 1.5 mL centrifuge tubes, and the cells were collected by centrifugation at room temperature, 10000 r / min, and 5 min. Then, 100 μL of PBS buffer (pH 7.0) was added and boiled in a water bath for 10 min. After centrifugation (room temperature, 6000 r / min, 5 min), the supernatant and precipitate of the lysate were obtained, and SDS-PAGE electrophoresis was performed on the supernatant and precipitate of the lysate. The electrophoresis results were as Figure 3 shown.
[0054] Figure 3SDS-PAGE pattern of the expression product after shake-flask fermentation of recombinant Escherichia coli H1. It can be seen from the figure that after induction with IPTG, there is a specific protein band at 37.3 kDa in the supernatant and precipitate of the lysate of recombinant Escherichia coli H1, while there is no such band in the control of the empty vector strain. This indicates that the XynT gene has been effectively expressed in Escherichia coli BL21(DE3). Therefore, the target protein XynT can be obtained by culturing, inducing expression, and separating and purifying recombinant Escherichia coli H1.
[0055] Example 3: Purification and Characterization of Target Protein XynT
[0056] In this example, the recombinant Escherichia coli H1 in Example 2 was cultured, induced for expression, separated and purified to obtain the target protein XynT, and the function of the target protein XynT was characterized. The specific steps are as follows:
[0057] (1) Obtaining crude enzyme solution:
[0058] The recombinant Escherichia coli H1 was treated and fermented using the steps S1 and S2 in Example 3. Then, the induced culture solution of recombinant Escherichia coli H1 was taken into a 50 mL centrifuge tube, centrifuged and collected by a refrigerated centrifuge (4 °C, 6000 r / min, 5 min), washed twice with PBS buffer (pH 7.0), resuspended with 2 mL of equilibration buffer (pH 7.0) after washing, and sonicated on ice for 15 - 20 min (power 550 W, working time 3 s, interval time 35 s). Whether the bacterial solution was clear and transparent was used to judge whether the disruption was complete.
[0059] The completely disrupted bacterial solution was centrifuged at low temperature and high speed to collect the supernatant and precipitate of the lysate. The supernatant was filtered through a MCE filter membrane with a pore size of 0.22 μm, and the obtained filtrate was the crude enzyme solution.
[0060] (2) Purification:
[0061] The above-obtained crude enzyme solution was loaded onto a pre-equilibrated Ni 2+ -NTA affinity chromatography column, gently inverted the chromatography column to resuspend the resin, continuously inverted it for 30 - 60 min to allow the crude enzyme solution to fully bind to the resin. The chromatography column was vertically static for 5 - 10 min to allow the resin to precipitate under the action of gravity, and the liquid was drained. 5 mL of washing solution (pH 8.0) was added, gently inverted the chromatography column to resuspend the resin, vertically static for 5 - 10 min to allow the resin to precipitate under the action of gravity, and the liquid was drained. This step was repeated 3 times. 1 mL of elution solution (pH 8.0) was added, gently inverted the chromatography column to resuspend the resin, vertically static for 5 - 10 min to allow the resin to precipitate under the action of gravity, and the elution solution was drained into a new centrifuge tube, which was the soluble recombinant protein. This step was repeated 3 times.
[0062] The eluted protein was dialyzed with double-distilled water to remove salt particles, and the purified alkaline endo-β-1,4-xylanase XynT could be obtained and stored in a refrigerator at 4 °C for standby. The purified target protein XynT was subjected to SDS-PAGE electrophoresis, and the electrophoresis results are as Figure 3 shown. As Figure 3 shown, it indicates that after the pET28a-XynT / BL21(DE3), namely strain H1, was purified by Ni 2+ -NTA, there was a specific protein band of the pure enzyme at 37.3 kDa, indicating that the target protein XynT was successfully purified.
[0063] (3) Characterization of the target protein XynT:
[0064] In this step, the activity of the endo-β-1,4-xylanase of the target protein XynT purified in step (2) was characterized by specific activity. The specific principle is as follows:
[0065] Since endo-β-1,4-xylanase is a main-chain enzyme that randomly cleaves the β-1,4 bonds between xylopyranosyl residues in the main chain of xylan. This enzyme has different folding, action mechanisms, substrate specificities, hydrolysis activities and physicochemical properties. It has a characteristic absorption peak at 480 nm. Therefore, the protein content was first determined by BCA protein quantification, and then the increase in absorbance at 480 nm was measured to represent the activity of endo-β-1,4-xylanase, and the specific activity of endo-β-1,4-xylanase was calculated.
[0066] The specific measurement steps were as follows: 400 μL of the enzyme solution diluted 50 times was taken, preheated at 50 °C for 10 min, and then added to 800 mL of a buffer solution containing 0.8% (m / v) beechwood xylan to initiate the enzymatic reaction. The reaction was carried out for 10 min under the set conditions, and the reaction was terminated with 1.2 mL of DNS reagent. The absorbance value was measured at 480 nm. The blank control was the same amount of heat-inactivated diluted enzyme solution. The amount of enzyme required to produce 1 mol of xylose per minute was used as 1 enzyme activity unit (U), and the experiment was set with three replicates.
[0067] According to the above method, the activities of the target protein XynT at different pH values (3.0 - 9.0) and different temperatures (40 °C - 70 °C) were respectively tested. Taking the highest enzyme activity as 100%, the enzyme activities measured at other temperatures were compared with it, and the relative enzyme activities at these temperatures were obtained. The test results are as Figure 4 shown.
[0068] From Figure 4It can be seen that when the temperature is 55 °C, the enzyme activity of the target protein XynT first increases and then decreases with the change of pH, and the enzyme activity reaches the maximum at pH 8, which is 11634 ± 2.6 U / mg. Under the condition of pH 8, the enzyme activity of XynT first increases and then decreases with the change of temperature, and the enzyme activity reaches the maximum at 45 °C, which is 12235 ± 0.6 U / mg. Therefore, the target protein XynT has the activity of endo-β-1,4-xylanase, the optimal reaction temperature is 45 °C, and the optimal reaction pH is 8.0. It is denoted as alkaline endo-β-1,4-xylanase.
[0069] It can also be seen from Figure 4 that within the temperature range of 50 - 60 °C, the relative enzyme activity of the alkaline endo-β-1,4-xylanase can reach more than 50%, and at 65 °C, the relative enzyme activity still has more than 10% activity, which indicates that the alkaline endo-β-1,4-xylanase has good heat resistance. In addition, within the pH range of 7.5 - 8.0, the relative enzyme activity of the alkaline endo-β-1,4-xylanase can reach more than 90%, and within the pH range of 6.0 - 8.0, the relative enzyme activity can reach more than 60%, which indicates that the alkaline endo-β-1,4-xylanase has a wide pH range of action, but the enzyme activity is low under acidic conditions, and it is a typical alkaline endo-β-1,4-xylanase.
[0070] It can be seen that compared with the optimal reaction temperature and pH values of other endo-β-1,4-xylanases, which are 35 - 65 °C and pH 3.0 - 5.5; the alkaline endo-β-1,4-xylanase described in the present invention is more heat-resistant and alkali-resistant, and has a wide pH range of action.
[0071] In summary, in the present invention, the codons of the putative protein derived from Streptomyces are optimized by bioengineering technology and heterologously expressed on a vector, and then transferred into Escherichia coli with a clear genetic background and a fast growth cycle for amplification and expression, realizing the expression of the alkaline endo-β-1,4-xylanase XynT. The alkaline endo-β-1,4-xylanase XynT described in the present invention can have a high endo-β-1,4-xylanase activity under high alkali conditions, and has outstanding advantages such as simple operation, rapid preparation, and high purity. The alkaline endo-β-1,4-xylanase XynT described in the present invention has never been characterized. Compared with other endo-β-1,4-xylanases, it has outstanding advantages such as high endo-β-1,4-xylanase activity, alkali resistance, and wide pH range of action, and has good applications in flour improvement, probiotic proliferation, fruit and vegetable processing, pulp processing and industrial wastewater treatment, liquefaction of coffee mucus, clarification of fruit juices and wines, and production and processing of vegetable oils.
[0072] The described embodiments are the preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Without departing from the essential content of the present invention, any obvious improvements, substitutions or modifications that those skilled in the art can make all fall within the protection scope of the present invention.
Claims
1. An alkaline endo-β-1,4 xylanase XynT, the amino acid sequence of the alkaline endo-β-1,4 xylanase XynT is shown in SEQ ID NO.
1.
2. A gene encoding the alkaline endo-β-1,4-xylanase XynT according to claim 1.
3. The gene according to claim 2, characterized in that The nucleotide sequence of the gene includes SEQ ID NO. 2, or a degenerate sequence thereof.
4. A recombinant vector comprising the gene according to claim 2 or 3.
5. The recombinant vector according to claim 4, characterized in that The expression vector of the recombinant vector includes pET28a.
6. A recombinant bacterium, characterized in that: The recombinant bacterium comprises the gene encoding the alkaline endo-β-1,4-xylanase XynT according to claim 2 or 3, or the recombinant vector according to claim 4 or 5.
7. The recombinant bacterium according to claim 6, characterized in that The construction method of the recombinant bacteria comprises: (1) linearizing the pET28a plasmid to obtain a linearized pET28a plasmid, then connecting the linearized pET28a plasmid with the gene encoding the alkaline endo-β-1,4-xylanase XynT according to claim 2 by seamless cloning, transforming into Escherichia coli competent cells by heat shock method, and obtaining a recombinant vector after PCR and Sanger sequencing; (2) The recombinant vector is transferred into the host bacteria to obtain the recombinant bacteria.
8. The recombinant bacterium according to claim 7, characterized in that The host bacteria of the recombinant bacteria include Escherichia coli.
9. The method for producing the alkaline endo-β-1,4-xylanase XynT according to claim 1, characterized in that: The method comprises: culturing, inducing expression, and separating and purifying the recombinant bacteria according to any one of claims 6 to 8 to obtain the alkaline endo-β-1,4 xylanase XynT.
10. Use of the alkaline endo-β-1,4 xylanase XynT according to claim 1, or the alkaline endo-β-1,4 xylanase XynT encoded by the gene according to claim 2 or 3, or the alkaline endo-β-1,4 xylanase XynT produced by the recombinant bacteria according to any one of claims 6 to 8 in flour improvement, probiotics value-added, fruit and vegetable processing, pulping processing and industrial wastewater treatment, liquefaction of coffee mucus, clarification of fruit juice and wine, and production and processing of vegetable oil.