Tryptophan synthase mutant for synthesizing cysteine or cystine as well as derivative, synthesis method and application of tryptophan synthase mutant

Abstract

The invention provides a tryptophan synthase mutant for synthesizing cysteine or cystine as well as a derivative, a synthesis method and application of the tryptophan synthase mutant, and relates to the field of enzyme engineering. The engineering bacterium with high tryptophan synthase activity is obtained by carrying out protein directed evolution on tryptophan synthase EcTrpBA, including the steps of alanine scanning, site-directed saturated mutation, combined mutation and the like, cell disruption is not needed, the engineering bacterium can directly carry out catalytic reaction with a substrate to synthesize cysteine or cystine, the preparation process is simplified, and the production cost is reduced. The yield and the conversion rate of the cysteine are improved, and the production cost of the cysteine is reduced.

Description

Technical Field

[0001] The invention belongs to enzyme engineering technology and relates to tryptophan synthase, in particular to a tryptophan synthase mutant for synthesizing cysteine ​​or cystine and its derivatives, synthesis method and application. Background Art

[0002] L-Cysteine ​​is a natural amino acid, mainly used in medicine, cosmetics, biochemical research, etc. It is used in bread materials to promote gluten formation and fermentation, demoulding, and prevent aging. It is used in natural fruit juice to prevent vitamin C from oxidizing and preventing the juice from turning brown. This product has a detoxifying effect and can be used for acrylonitrile poisoning and aromatic acid poisoning. L-cysteine ​​also has the effect of preventing radiation damage to the human body. It is also a drug for treating bronchitis, especially as an expectorant (mostly used in the form of acetyl L-cysteine ​​methyl ester salt). In cosmetics, it is mainly used in beauty water, perm solution, sunscreen skin cream, etc.

[0003] At present, the production of L-cysteine ​​is mainly carried out through chemical synthesis and hair extraction. The current fermentation method for producing L-cysteine ​​is not ideal, and the sulfur conversion rate is low, which cannot meet the requirements of industrial production. The synthesis of L-cysteine ​​by bioenzymatic method / whole cell conversion method is a feasible path of green, economical and efficient. Compared with the enzyme method, the whole cell conversion method does not need to break the cells, is simpler to operate, shortens the time and cost, has high conversion efficiency, and has a considerable yield suitable for industrialization. The whole cell conversion method produces L-cysteine ​​by first expressing the required catalytic enzyme through an engineered strain, using the whole cell as a catalyst to catalyze the reaction of serine and sulfhydride in vitro to produce cysteine. At the same time, cysteine ​​is not stable, and some of it will be oxidized to form cystine.

[0004] Tryptophan synthase (TrpS) is an enzyme that catalyzes the conversion of serine to cysteine. It is composed of two subunits, β-subunit (TrpB) and α-subunit (TrpA). It originally catalyzes the reaction of indole and serine to synthesize tryptophan in vivo. Studies have shown that tryptophan synthases from various sources not only have the function of synthesizing tryptophan, but can also catalyze serine and sodium hydrosulfide to produce cysteine, especially the Trps (EcTrpBA) produced by Escherichia coli has a considerable yield, which has opened up new ideas for the enzymatic production of cysteine. At present, in the process of cysteine ​​catalyzed by EcTrps, the amount of enzyme required per unit yield of cysteine ​​is relatively large, resulting in a high production cost. Therefore, by performing protein directed evolution on tryptophan synthase EcTrps, the yield and conversion rate of cysteine ​​per unit enzyme amount can be increased, and the cost of producing cysteine ​​can be reduced.

[0005] The prior art CN117683760A is based on the tryptophan synthase TrpS from Escherichia coli, and mutants with higher enzyme activity are obtained through site-directed mutagenesis screening. Cysteine and cystine are prepared by in vitro enzymatic catalysis using the mutants. The mutants consist of an α-subunit and a β-subunit, and the β-subunit is obtained by mutating the following selected sites: 1) mutation of amino acids at positions 36-40 from QKDPE to AAAPA; 2) mutation of the amino acid at position 47 from D to W or R;

[0006] 3) mutation of the amino acid at position 64 from N to W; 4) mutation of the amino acid at position 127 from G to R; 5) mutation of the amino acid at position 143 from S to W or R; 6) mutation of the amino acid at position 170 from C to A; 7) mutation of the amino acid at position 246 from N to A. The disadvantage of this technology is that it is necessary to lyse cells for catalytic preparation of cysteine and cystine, and the yield is not high, so industrialization cannot be achieved.

[0007] The prior art CN117230050A mutates the thermostable tryptophan synthase PfTrps from Pyrococcus furiosus to improve its enzyme activity for catalytic synthesis of L-cysteine at low temperatures. Specifically, this technology is obtained by mutating PfTrps from Pyrococcus furiosus through amino acid substitution. The PfTrps includes two subunits, an α-subunit (PfTrpA, Uniplot ID Q8U094) and a β-subunit (PfTrpB, Uniplot ID Q8U093). The mutation is located on the β-subunit (PfTrpB) and is obtained by amino acid substitution at the following selected sites: 1) mutation of glutamate at position 13 to glutamine; 2) mutation of tyrosine at position 54 to threonine; 3) mutation of alanine at position 56 to cysteine;

[0008] 4) mutation of asparagine at position 85 to glutamine; 5) mutation of histidine at position 275 to phenylalanine; 6) mutation of tyrosine at position 301 to phenylalanine; 7) mutation of glutamate at position 307 to glutamine. The disadvantage of this technology is also that it is necessary to lyse cells and the yield is not high. Summary of the Invention

[0009] In view of the problems in the prior art that the synthesis of cysteine or cystine using tryptophan synthase mutants requires cell lysis and the yield is not high, the present invention provides tryptophan synthase mutants and their derivatives for synthesizing cysteine or cystine, a synthesis method, and an application. By performing directed evolution of the protein on tryptophan synthase EcTrps, including steps such as alanine scanning, site-directed saturation mutagenesis, and combinatorial mutagenesis, the present invention obtains an engineered bacterium with high tryptophan synthase activity, and cell disruption is not required. The fermentation broth of the engineered bacterium or the engineered bacterium can directly carry out a catalytic reaction with the substrate to synthesize cysteine or cystine, simplifying the production process and reducing the cost of producing cysteine.

[0010] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0011] On the one hand, the present invention provides a tryptophan synthase mutant, which is composed of an α-subunit and a β-subunit. The amino acid sequence of the α-subunit is as shown in SEQ ID NO.1, and the β-subunit is based on the amino acid sequence shown in SEQ ID NO.2 and is selected from any one of the following site mutations:

[0012] (1) The lysine residue at position 50 is mutated to any one of alanine, tyrosine, and asparagine;

[0013] (2) The glycine residue at position 83 is mutated to any one of alanine, serine, and glutamine;

[0014] (3) The arginine residue at position 206 is mutated to any one of glutamate, glutamine, and alanine;

[0015] (4) The threonine residue at position 289 is mutated to any one of glycine, isoleucine, and tryptophan;

[0016] (5) A combination of two or more of the above four site mutations;

[0017] In the case of the mutation combination selected from (5), it can be a combination of two, three, or four of the four mutations from (1) to (4); in some embodiments, the mutation combination is a combination of two, for example, the combination of the arginine at position 206 mutated to alanine and the threonine at position 289 mutated to glycine (labeled as R206A / T289G).

[0018] On the other hand, the present invention provides a nucleic acid molecule that encodes the above-mentioned tryptophan synthase mutant.

[0019] On the other hand, the present invention provides a biological material containing the above nucleic acid molecule, and the biological material includes a DNA fragment, a plasmid vector, a viral vector, or an engineered bacterium.

[0020] Preferably, the plasmid vector is a prokaryotic expression vector.

[0021] Preferably, the prokaryotic expression vector includes pET28a, pETDueT, pEtrc, or pACYC.

[0022] On the other hand, the present invention provides a recombinant microorganism, which is obtained by introducing the above nucleic acid molecule into a host cell through a plasmid or integrating it into the host cell genome by genetic engineering means.

[0023] Preferably, the host cell is a bacterium.

[0024] Preferably, the bacterium includes Escherichia coli or Bacillus subtilis.

[0025] Preferably, the bacterium is Escherichia coli.

[0026] Preferably, the Escherichia coli includes Escherichia coli W3110 and Escherichia coli BL21.

[0027] On the other hand, the present invention provides the use of the above tryptophan synthase mutant, the above nucleic acid molecule, the above biological material, or the above recombinant microorganism in the synthesis of cysteine or cystine.

[0028] On the other hand, the present invention provides a method for synthesizing cysteine or cystine, which includes using the above tryptophan synthase mutant, the above nucleic acid molecule, the above biological material, or the above recombinant microorganism.

[0029] Preferably, the synthesis method includes the following steps:

[0030] Cultivate the engineered bacteria expressing the above tryptophan synthase mutant, collect, centrifuge, and wash the engineered bacteria, and then add them to the catalytic reaction system to catalyze the synthesis of cysteine or cystine using serine and hydrosulfide as substrates.

[0031] In some embodiments, the synthesis method includes the following steps:

[0032] Cultivate the engineered bacteria expressing the above tryptophan synthase mutant, and add the culture solution of the engineered bacteria to the catalytic reaction system to catalyze the synthesis of cysteine or cystine using serine and hydrosulfide as substrates.

[0033] Preferably, the hydrosulfide includes sodium hydrosulfide, hydrogen sulfide, or potassium hydrosulfide.

[0034] Preferably, the hydrosulfide is sodium hydrosulfide.

[0035] Preferably, the catalytic reaction system further contains a buffer, pyridoxal phosphate, and butyl acetate.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] 1. The tryptophan synthase mutant provided by the present invention can significantly improve the cysteine yield. The conversion rate of R206A / T289G is 93.3%, which is 2.6 times higher than that of the wild type.

[0038] 2. The present invention directly uses intact cells as catalysts, which can efficiently catalyze the reaction of serine and hydrosulfide to generate cysteine in vitro, avoiding the step of lysing cells, simplifying the process, and reducing the production cost. Description of the Drawings

[0039] Figure 1 Example diagram of the HPLC detection sample spectrum.

[0040] Figure 2 Partial results of the screening of alanine scanning mutants.

[0041] Figure 3 Partial results of the screening of alanine scanning mutants.

[0042] Figure 4 Results of the screening of the saturation mutation library at the K50 site.

[0043] Figure 5 Results of the screening of the saturation mutation library at the G83 site.

[0044] Figure 6 Results of the screening of the saturation mutation library at the R206 site.

[0045] Figure 7 Results of the screening of the saturation mutation library at the T289 site.

[0046] Figure 8 Results of the screening of the combined mutants. Detailed Embodiments

[0047] Unless otherwise specified, the raw materials used in the present invention are all ordinary commercially available products, and their sources are not specifically limited. Table 1 describes the sources of key materials and instruments.

[0048] Table 1 Description of Key Materials and Instruments

[0049] Materials / Equipment Article number / Batch number / Model factory L-Serine KY-LS-20220809B Propharma Sodium Hydrosulfide 202401202405 Shandong Lelixin Pyridoxal phosphate B2327530 Aladdin Butyl acetate 20110701 Enox FastDigest DpnI 3053167 Thermo Fisher Constant temperature shaker ZWYR-D2401 smart city Constant temperature water bath RCTBS025 IKA HPLC LC2030 Shimadzu

[0050] Reagent Preparation:

[0051] The following describes the specific reagents used in the examples and comparative examples.

[0052] pH 8.0 Phosphate Buffer: Weigh 32.56 g of dipotassium hydrogen phosphate and 1.776 g of potassium dihydrogen phosphate, dissolve them in 1000 mL of pure water, and adjust the pH to 8.0.

[0053] 0.5 M Boric Acid Solution: Weigh 7.73 g of boric acid, dissolve it in 250 mL of pure water, and adjust the pH to 7.7 with 1 M NaOH.

[0054] Fmoc-Cl Solution: Dissolve 0.129 g of fluorenylmethyloxycarbonyl chloride in 50 mL of acetonitrile.

[0055] ADAM Solution: Dissolve 0.374 g of adamantylamine in 200 mL of acetonitrile-water (volume ratio of acetonitrile to water is 1:1) solution.

[0056] Detection Method:

[0057] The detection methods used in the examples and comparative examples are described below.

[0058] Cysteine Yield Determination Method: Cysteine yield measured by liquid phase (g / L) + cystine yield measured by liquid phase (g / L) / relative molecular weight of cystine * relative molecular weight of cysteine. In the reaction, cysteine oxidized to cystine is converted into cysteine with the same molar concentration and added to cysteine in the reaction solution to obtain the total cysteine concentration.

[0059] Cysteine Conversion Rate Determination Method: (Cysteine yield (g / L) / relative molecular weight of cysteine) / (serine input amount (g / L) / relative molecular weight of serine) * 100%.

[0060] Example 1: Cultivation of Bacteria

[0061] Inoculate Escherichia coli into LB medium containing 50 mg / L kanamycin, culture it at 37 °C with shaking at 250 rpm for 12 h to obtain a seed solution. Inoculate the seed solution into fresh LB medium containing 50 mg / L kanamycin at an inoculation amount of 2% (v / v), culture it at 37 °C with shaking at 250 rpm for 1 - 2 h. When the measured OD 600 reaches 0.8, add isopropyl β-D-thiogalactopyranoside (IPTG) with a final concentration of 0.4 mM, then culture it at 34 °C with shaking at 250 rpm for 24 h. The obtained bacterial solution is centrifuged and resuspended, and the bacterial solution is concentrated to a wet cell concentration of 40 g / L for subsequent catalytic reactions.

[0062] Example 2: Determination of the Catalytic Activity of Tryptophan Synthase

[0063] The concentrated bacterial solution obtained in Example 1 was used for in vitro enzymatic catalysis reaction verification. Based on 10 mL of phosphate buffer solution with pH 8.0 in a 50 mL plastic centrifuge tube, L-serine, sodium hydrosulfide, pyridoxal phosphate, butyl acetate and whole cells were added successively according to the reaction system in Table 2 (20 mL). After mixing, the volume was finally made up to 20 mL with phosphate buffer solution and mixed well to fully disperse the cells. Then, the reaction was carried out at 35 °C and 1000 rpm for 16 h in a constant temperature water bath. The whole cells refer to taking 10 mL of the concentrated bacterial solution obtained in Example 1, centrifuging to remove the supernatant, washing twice with phosphate buffer solution, and then adding it to the reaction system. The final concentration of wet bacterial cells in the system was 20 g / L.

[0064] After reacting for 16 h, the reaction solution was centrifuged and the supernatant was taken, diluted 100 times with ddH 2 O and subjected to derivatization treatment for sample preparation. Derivatization method: Take 100 μL of the diluted solution, add 100 μL of 0.5 M boric acid solution with pH 7.7, mix well, incubate in a water bath at 30 °C for 3 min, add 200 μL of Fmoc-Cl solution, mix well, incubate in a water bath at 30 °C for 5 min, add 800 μL of ADAM solution, mix well and react for 2 min, and detect by HPLC after filtering with organic phase.

[0065] Table 2 Catalytic reaction system (20 mL)

[0066]

[0067] The method for determining L-cysteine in the reaction system by HPLC is as follows: Precisely pipette the derivatized supernatant through a 0.22 μm organic filter membrane and perform HPLC detection. The parameters of HPLC are as follows: Use an Agilent SB-C18 4.6 * 150 mm chromatographic column; the mobile phase is A: 0.1% formic acid aqueous solution, C: acetonitrile, initial ratio, A:C = 55:45; the gradient elution program is shown in Table 3, the column flow rate is 1.35 mL / min, the column temperature is 30 °C; the wavelength is 264 nm, the injection volume is 5 μL; an example diagram of the HPLC chromatogram is as Figure 1 shown. Content calculation: Sample concentration = sample peak area / standard product peak area * standard product concentration * dilution factor. In the reaction, cysteine is oxidized to cystine, which is converted into cysteine with the same molar concentration and added to the cysteine in the reaction solution to obtain the total cysteine concentration.

[0068] Table 3 Gradient elution program

[0069] Time (mins) Phase A (% v / v) Phase C (% v / v) 0.01 55 45 7.00 47 53 7.50 25 75 8.00 0 100 10.00 0 100 10.50 55 45

[0070] Example 3: Determination of the catalytic activity of tryptophan synthase

[0071] The concentrated bacterial solution obtained in Example 1 was directly used for in vitro enzymatic catalysis reaction verification. Based on 10 mL of phosphate buffer solution with pH 8.0 in a 50 mL plastic centrifuge tube, L-serine, sodium hydrosulfide, pyridoxal phosphate, butyl acetate and the concentrated bacterial solution were sequentially added according to the reaction system in Table 4 (20 mL). After mixing, the volume was finally made up to 20 mL with phosphate buffer solution and mixed well to fully disperse the cells. Then, the reaction was carried out at 35 °C and 1000 rpm in a constant temperature water bath for 16 h. After centrifuging the bacterial solution, the supernatant was taken. It was confirmed by the HPLC detection method in Example 2 that the supernatant did not contain cysteine and cystine and would not interfere with the catalytic reaction results.

[0072] Table 4 Catalytic reaction system (20 mL)

[0073] name Addition amount L-Serine 75g / L Sodium Hydrosulfide 46.5g / L Pyridoxal phosphate 0.13g / L Butyl acetate 0.25％ Concentrated bacterial solution 10mL pH 8.0 phosphate buffer Refill to 20mL

[0074] After the reaction for 16 h, the supernatant was taken after centrifuging the reaction solution, and it was diluted 100 times with ddH 2 O and subjected to derivatization treatment for sample preparation. The derivatization treatment and HPLC detection method were the same as those in Example 2.

[0075] Example 4: Construction of the vector of tryptophan synthase EcTrps

[0076] The genomic DNA of Escherichia coli W3110 was extracted using a microbial genomic DNA extraction kit (TaKaRa MiniBEST Bacteria Genomic DNA Extraction Kit). Primers TrpBA-F: CTTTAAGAAGGAGATATACCATGACAACATTACTTAACCCCTATTTTGGTGAGTTTGGC (SEQ ID NO.3) and TrpBA-R: CTCGAGTGCGGCCGCAAGCTTTTAACTGCGCGTCGCCGCTTTCA (SEQ ID NO.4) were designed. Using the extracted W3110 genomic DNA as a template, the target tryptophan synthase EcTrps gene fragment was amplified by PCR; the AxyPrep DNA Gel Extraction Kit was used to purify and recover the target gene fragment. After sequencing, the sequence of the EcTrps gene fragment was SEQ ID NO.5; the coding gene of the α-subunit TrpA was shown in SEQ ID NO.6, and the amino acid sequence was shown in SEQ ID NO.1; the coding gene of the β-subunit TrpB was shown in SEQ ID NO.7, and the amino acid sequence was shown in SEQ ID NO.2. Finally, EcTrps (TrpBA) was cloned into the NcoⅠ and HindⅢ multiple cloning sites of pET28a to construct the expression vector pET28a-TrpBA.

[0077] Example 5: Selection of Alanine Scanning Sites of Tryptophan Synthase EcTrps

[0078] Using the tryptophan synthase EcTrps gene sequence obtained in Example 3 as a template, a three-dimensional protein structure model of tryptophan synthase EcTrps was established on the SWISS MODEL online server. The model was imported into the Hot Spot Wizard online software for hot spot scanning prediction, and the amino acid residues that were both near the active pocket and within the substrate channel were selected to be mutated to alanine.

[0079] The substrates pyridoxal phosphate and L-serine were docked to the active center of the enzyme EcTrps using Auto Dock software. According to the docking results, the amino acid residues within the range were selected to be mutated to alanine. A total of 40 sites were selected for alanine scanning. The specific sites are shown in Figure 2 and Figure 3 .

[0080] Example 6: Construction of Alanine Scanning Mutants of Tryptophan Synthase EcTrps Using the pET28a-TrpBA plasmid obtained in Example 3 as a template, according to the Figure 2 and Figure 3 mutation settings (for example, 114A means the amino acid at position 114 is mutated to alanine, and so on; Table 5 shows some amplification primers for alanine scanning mutants), the coding gene of the β-subunit TrpB in the plasmid (see SEQ ID NO.7) was mutated at the corresponding sites. The PCR amplification product was digested with DPNI enzyme to remove the template and then transferred into Escherichia coli TG1 competent cells. The next day, positive recombinants were screened on a kanamycin-resistant plate, and monoclonal colonies were selected. Colony PCR verification was performed using the T7 and T7-Term universal primers (T7: 5'-GCTAGTTATTGCTCAGCGG-3', T7-Term: 5'-TAATACGACTCACTATAGGG-3'). The positive monoclonal colonies were sent to the company for DNA sequencing. The plasmid with correct sequencing was transferred into Escherichia coli BL21(DE3) to obtain the mutant recombinant bacterium BL21(DE3)-TrpBA mutant . At the same time, the wild-type plasmid pET28a-TrpBA was transferred into Escherichia coli BL21(DE3) to obtain the recombinant strain BL21(DE3)-TrpBA expressing wild-type Trps as a control (WT). The enzyme activity was measured according to the method of Example 2. The results are shown in Figure 2 and Figure 3 . The dominant mutants with increased cysteine production were screened as G83A, L75A, L48A, K50A, Q206A, V231A, and T289A.

[0082] Table 5 Amplification primers for partial alanine scanning mutants

[0083]

[0084]

[0085] Example 7: Construction of a saturation mutant library of tryptophan synthase EcTrps

[0086] According to the results of Example 5, the dominant sites 50, 83, 206, and 289 were selected for site-directed saturation mutagenesis. The amino acids at these sites were mutated into the other 19 amino acids, and the obtained dominant mutants were then subjected to combinatorial mutagenesis. The specific operations are as follows:

[0087] Using the pET28a-TrpBA plasmid as a template, the NNK mutagenic primers shown in Table 6 were used to perform saturation mutagenesis on the coding gene of the β-subunit TrpB at amino acid sites 50, 83, 206, and 289. The PCR amplification products were digested with DpnI to remove the template and then transferred into competent Escherichia coli TG1 cells. The next day, positive recombinants were screened on a kanamycin-containing resistant plate, and monoclonal colonies were selected for sequencing. The plasmids with correct sequencing were transferred into Escherichia coli BL21(DE3), and the enzyme activity was measured according to the method of Example 2. The results are as Figure 4-7 shown. The dominant mutants with increased cysteine production screened by saturation mutagenesis at site 50 were K50A, K50N, and K50Y; those at site 83 were G83A, G83S, and G83Q; those at site 206 were R206E, R206Q, and R206A; and those at site 289 were T289G, T289I, and T289W.

[0088] The above dominant sites were subjected to pairwise combinatorial mutagenesis. The combination settings and results are as Figure 8 shown. The combinatorial mutants G83A / R206A, G83A / K50A, R206A / T289G, and R206Q / T289I could significantly improve cysteine production. Among them, the cysteine production of R206A / T289G was 75.5 g / L, and the conversion rate was 93.3%, which was 2.8 times higher than that of the wild type.

[0089] Table 6 Amplification primers for the saturation mutant library

[0090]

[0091]

[0092] Note: For site-saturation mutagenesis, degenerate primers are introduced during primer design (where R = A / G, Y = C / T, M = A / C, K = G / T, S = C / G, W = A / T, H = A / C / T, B = C / G / T, V = A / C / G, D = A / G / T, N = A / C / G / T)).

[0093] Comparative example: Directed mutagenesis of tryptophan synthase EcTrps

[0094] Select the best mutation setting in CN117683760A (amino acids at positions 36 - 40 are mutated from QKDPE to AAAPA). According to the method of Example 7 of the present invention, the amino acids at positions 36 - 40 of the β-subunit TrpB of tryptophan synthase EcTrps (amino acid sequence shown in SEQ ID NO.2) are mutated from QKDPE to AAAPA. After obtaining the strain, the cysteine yield is measured to be 46.8 g / L and the conversion rate is 54.1%, which is much lower than the cysteine yield of 75.5 g / L and the conversion rate of 93.3% of the R206A / T289G mutation in Example 7 of the present invention.

[0095] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than limiting the protection scope of the present invention. Any simple modification or equivalent replacement of the technical solution of the present invention by those of ordinary skill in the art shall not depart from the essence and scope of the technical solution of the present invention.

Claims

1. A tryptophan synthase mutant, characterized in that: It is composed of an α-subunit and a β-subunit, wherein the amino acid sequence of the α-subunit is shown in SEQ ID NO.1, and the β-subunit is based on the amino acid sequence shown in SEQ ID NO.2, and is selected from any one of the following site mutations: (1) The lysine residue at position 50 is mutated to any one of alanine, tyrosine, or asparagine; (2) The glycine residue at position 83 is mutated to any one of alanine, serine, or glutamine; (3) the arginine residue at position 206 is mutated to any one of glutamic acid, glutamine, or alanine; (4) The threonine residue at position 289 is mutated to any one of glycine, isoleucine, or tryptophan; (5) A combination of two or more of the above four site mutations.

2. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the tryptophan synthase mutant according to claim 1.

3. A biological material comprising the nucleic acid molecule according to claim 2, characterized in that: The biological material includes a DNA fragment, a plasmid vector, a virus vector or an engineered bacterium. The plasmid vector is a prokaryotic expression vector. The prokaryotic expression vector includes pET28a, pETDueT, pEtrc or pACYC.

4. A recombinant microorganism, characterized in that The recombinant microorganism is obtained by introducing the nucleic acid molecule of claim 2 into a host cell via a plasmid or integrating it into the host cell genome via genetic engineering.

5. The recombinant microorganism according to claim 4, characterized in that The host cell is a bacterium, which includes Escherichia coli or Bacillus subtilis, and the Escherichia coli includes Escherichia coli W3110 and Escherichia coli BL21.

6. Use of the tryptophan synthase mutant according to claim 1, the nucleic acid molecule according to claim 2, the biological material according to claim 3 or the recombinant microorganism according to any one of claims 4 to 5 in the synthesis of cysteine ​​or cystine.

7. A method for synthesizing cysteine ​​or cystine, characterized in that: The synthesis method comprises using the tryptophan synthase mutant according to claim 1, the nucleic acid molecule according to claim 2, the biological material according to claim 3 or the recombinant microorganism according to any one of claims 4-5.

8. The synthesis method according to claim 7, characterized in that The synthesis method comprises the following steps: The engineered bacteria expressing the tryptophan synthase mutant are cultured, and the engineered bacteria or the culture solution of the engineered bacteria are added to the catalytic reaction system to catalytically synthesize cysteine ​​or cystine using serine and hydrogen sulfide as substrates.

9. The synthesis method according to claim 8, characterized in that The hydrosulfide includes sodium hydrosulfide, hydrogen sulfide or potassium hydrosulfide.

10. The synthesis method according to claim 8, characterized in that The catalytic reaction system also comprises a buffer solution, pyridoxal phosphate and butyl acetate.

Images