Cslnc170-CsLOX4 gene pair in tea tree and application of Cslnc170-CsLOX4 gene pair in improvement of anthracnose resistance

Abstract

The invention discloses a group of Cslnc170-CsLOX4 gene pairs in tea trees and application of the Cslnc170-CsLOX4 gene pairs in improvement of anthracnose resistance, and belongs to the technical field of tea tree gene application. The gene is located on a chromosome of a tea genome, and a Cslnc170 gene with the total length of 1581bp is located at the downstream 9254bp position of a CsLOX4 gene of a 13-lipoxygenase (13-LOX) family member. The Cslnc170-CsLOX4 gene has the beneficial effects that the Cslnc170-CsLOX4 gene can be used for regulating and controlling the resistance of a tea tree to colletotrichum gloeosporioides, and in the aspect of an action mode, a ring 4 (252bp-271bp) of a Cslnc170 secondary structure and a 930bp-952bp region of a CsLOX4 promoter are main functional regions for interaction of the Cslnc170-CsLOX4 gene and the CsLOX4 promoter. The invention provides a new direction for improving the disease resistance of the tea trees, and has higher application prospect and economic value.

Description

Technical Field

[0001] The present invention belongs to the technical field of tea tree gene application, and particularly relates to a group of Cslnc170-CsLOX4 gene pairs in tea trees and their application in improving the ability to resist anthracnose. Background Art

[0002] In warm and humid tea tree planting areas, fungal diseases such as anthracnose are the main diseases affecting the yield and quality of tea beverage products. To resist the invasion of pathogens, plants have evolved a complex innate immune system, including PAMP-triggered immunity (PTI) triggered by pathogen-associated molecular patterns (PAMPs) and effector-triggered immunity (ETI) of the plant immune system triggered by effectors. Fungal stress-induced plant hormone pathways, such as salicylic acid, jasmonic acid, ethylene, and auxin signaling pathways, play important roles in regulating the plant's defense response to fungal stress.

[0003] More and more evidence supports the key role of non-coding RNA genes in enhancing plant immune functions. Non-coding RNAs (ncRNAs) with more than 200 nucleotides are defined as long non-coding RNAs (lncRNAs). LncRNAs are widely involved in the immune responses of plants to biotic and abiotic stresses, and their target genes are diverse and involve various physiological aspects. Related studies have shown that lncRNA target genes responsive to stress are enriched in plant immunity, including ROS accumulation, PR gene expression, miRNA biosynthesis pathways, plant-pathogen infection interactions, and hormone signaling pathways such as jasmonic acid and salicylic acid.

[0004] For example, among 567 disease-responsive lncRNAs in rice infected with Xanthomonas oryzae pv. oryzae, 73 lncRNAs interact with 39 protein-coding genes in the jasmonic acid pathway. Among them, 273 lncRNAs were found to respond to Botrytis cinerea infection in tomato fruits, and more antisense lncRNAs were found to target and regulate the expression of hydrolase-activating genes. The transcription of tomato-responsive lncRNAs revealed the role of hydrolase-encoding genes in response to Botrytis invasion. In tea trees, an evolutionarily conserved OPRL-OPR gene pair has also been found, and this gene pair affects the resistance of plants to Colletotrichum through the jasmonic acid pathway. So far, it has been reported that lncRNAs are widely involved in the regulation of tea tree life activities, such as they may be involved in regulating secondary metabolism. Tissue-specific long non-coding RNAs are involved in the aroma formation of black tea. To study the functions of long non-coding RNAs (lncRNAs) and the potential regulatory mechanisms of lncRNA-mRNA interactions, we performed enrichment analysis of tea tree-induced lncRNAs using transcriptome sequencing.

[0005] Defects and deficiencies of the prior art:

[0006] ①The existing prevention technologies for tea tree anthracnose rely on chemical control. Long-term and large-scale use of chemical agents such as pyraclostrobin emulsifiable concentrate, difenoconazole water dispersible granules, chlorothalonil wettable powder, etc. easily leads to pesticide residues in tea leaves and soil, which not only affects the quality of tea leaves but also pollutes the ecological environment and threatens the balance of the tea garden ecosystem.

[0007] ②The research on the mechanism of lncRNA regulating anthracnose resistance at the molecular level is not deep enough to effectively prevent anthracnose at the biomolecular level.

[0008] The Chinese patent application document with the publication number CN116162645A discloses the application of an induced transcription factor CoWRKY3 in plant resistance to anthracnose. This patent belongs to the technical field of transcription factor applications and discloses the application of an induced transcription factor CoWRKY3 in plant resistance to anthracnose. The application of the induced transcription factor CoWRKY3 in plant resistance to anthracnose includes the application of the protein encoded by the induced transcription factor CoWRKY3 in improving the anthracnose resistance of plants. The CoWRKY3 gene is of great significance for cultivating transgenic crops with anthracnose-resistant varieties and improving the stress resistance of crops, and enriches the gene resources for cultivating crops with strong disease resistance. However, there are few reports on long non-coding RNA genes related to tea tree anthracnose resistance. Summary of the Invention

[0009] The technical problem to be solved by the present invention is how to provide an lncRNA for regulating tea tree anthracnose resistance and its application.

[0010] The present invention solves the above technical problems through the following technical means:

[0011] In the first aspect of the present invention, a long non-coding RNA (Cslnc170 gene) is provided, and its cDNA sequence includes the nucleotide sequence shown in SEQ ID NO.1.

[0012] In the second aspect of the present invention, the above Cslnc170 gene is applied in any of the following:

[0013] (1) Application in activating the promoter of the CsLOX4 gene;

[0014] (2) Application in promoting the expression of the CsLOX4 gene;

[0015] (3) Application in the detection of tea tree anthracnose resistance;

[0016] (4) Application in improving tea tree anthracnose resistance;

[0017] (5) Application in cultivating tea tree varieties resistant to anthracnose.

[0018] Preferably, in (1), Cslnc170, as an lncRNA, activates the CsLOX4 promoter.

[0019] The third aspect of the present invention provides a recombinant vector containing the Cslnc170 gene described in claim 1.

[0020] The fourth aspect of the present invention provides a transfection vector containing the above recombinant vector.

[0021] Preferably, the transfection vector is Agrobacterium.

[0022] The fifth aspect of the present invention provides a drug for preventing and treating tea tree anthracnose, containing the above transfection vector.

[0023] The sixth aspect of the present invention provides the application of CsLOX4 in improving the resistance of tea trees to anthracnose. The CsLOX4 includes the CsLOX4 gene and the CsLOX4 protein. The nucleotide sequence of the CsLOX4 gene is shown in SEQ ID NO.2, and the amino acid sequence of the CsLOX4 protein is shown in SEQ ID NO.3.

[0024] The seventh aspect of the present invention provides a breeding method for anthracnose-resistant tea trees, including the following steps: obtaining plants with higher resistance to tea tree anthracnose than the target plants by promoting the expression of the Cslnc170 gene or the CsLOX4 gene in the target plants.

[0025] Preferably, the method for promoting the expression of the Cslnc170 gene or the CsLOX4 gene in the target plants includes: constructing an overexpression vector of the Cslnc170 gene or the CsLOX4 gene and introducing it into the target plants.

[0026] The beneficial effects of the present invention are as follows:

[0027] 1. The present invention provides a pair of Cslnc170-CsLOX4 genes in tea trees. On the chromosome of the tea genome, the Cslnc170 gene with a total length of 1581bp is located 9254bp downstream of the CsLOX4 gene, a member of the 13-lipoxygenase (13-LOX) family. It can improve the disease resistance of tea trees and provides a new direction for improving the disease resistance of tea trees.

[0028] 2. The single-base substitution experiment at the Cslnc170 locus combined with the CsLOX4 promoter activation experiment shows that Cslnc170, as a non-coding transcript, activates the expression of CsLOX4.

[0029] 3. The results of the truncation experiments of the CsLOX4 promoter and Cslnc170 truncation showed that loop4 of the Cslnc170 secondary structure and the 930bp - 952bp region of the CsLOX4 promoter are the main functional regions of their interaction. The results of transient overexpression of genes mediated by Agrobacterium and gene silencing mediated by antisense oligonucleotides showed that the Cslnc170 - CsLOX4 gene pair enhanced the resistance of tea plants to anthracnose.

[0030] 4. It was demonstrated by dual - luciferase reporter assays that Cslnc170 could activate the promoter of CsLOX4. To investigate the interaction mechanism between Cslnc170 and the CsLOX4 promoter, we used the IntaRNA software (MechRNA: predicting lncRNA mechanisms from RNA - RNA and RNA - protein interactions, IntaRNA 2.0: can be used to predict RNA - RNA interactions) to predict the specific sequence covalent binding sites between them. The prediction results showed that there is a binding region with a free energy of 9.82 kcal / mol at - 930bp - 952bp of the CsLOX4 promoter, which can bind to the 252bp - 271bp region of Cslnc170.

[0031] 5. The cis - acting Cslnc170 - CsLOX4 gene pair was demonstrated to positively regulate the resistance of tea plants to Colletotrichum. In terms of the mode of action, loop4 (252bp - 271bp) of the Cslnc170 secondary structure and the 930bp - 952bp region of the CsLOX4 promoter are the main functional regions of their interaction. Description of the Drawings

[0032] Figure 1 It is a transcription map of Cslnc170 positively regulating its target gene CsLOX4, where A is the RACE cloning map of Cslnc170, B is the agarose gel electrophoresis analysis map of Cslnc170 RACE cloning, C is the single - base substitution schematic diagram, D is the schematic diagram of effector and reporter vector constructs for transient expression assays in tobacco leaves, and E - G are the luciferase reporter detection maps of Cslnc170, Cslnc170 - 1, and Cslnc170 - 2 activating the CsLOX4 promoter (**P < 0.01, Student's t - test (two - way));

[0033] Figure 2Identification diagram of the mechanism by which Cslnc170 regulates CsLOX4. Among them, A is the structural diagram of the interaction binding site of the CsLOX4 promoter, B is the truncation diagram of the CsLOX4 promoter, C is the luciferase reporter detection diagram of Cslnc170 activating different lengths of the CsLOX4 promoter, D is the secondary structure diagram of stem-loop4 and stem4, and E-F are the luciferase reporter detections of stem-loop4 and stem4 activating the CsLOX4 promoter (**P<0.01, Student's t-test (two-way));

[0034] Figure 3 Diagram of the roles of CsLOX4 and Cslnc170 in tea plant resistance to Colletotrichum gloeosporioides. Among them, A is the workflow diagram of studying the resistance of tea plants to Colletotrichum gloeosporioides based on Agrobacterium-mediated transient gene expression and antisense oligonucleotide-mediated gene silencing, and B-C are the functional diagrams of CsLOX4 in analyzing the resistance of tea plants to Colletotrichum gloeosporioides through Agrobacterium-mediated transient expression and antisense oligonucleotide-mediated gene silencing, and D-F are the functional diagrams of Cslnc170 and stem4 in analyzing the resistance of tea plants to Colletotrichum gloeosporioides through Agrobacterium-mediated transient expression and antisense oligonucleotide-mediated gene silencing. Detailed implementation manners

[0035] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0036] The test materials and reagents used in the following embodiments can be obtained from commercial channels without special instructions.

[0037] For those not specifying specific techniques or conditions in the embodiments, they can all be carried out according to the techniques or conditions described in the literature in this field or according to the product specifications.

[0038] Example 1:

[0039] This example provides an LncRNA for regulating the resistance of tea plants to Colletotrichum gloeosporioides and its application. The steps are as follows:

[0040] 1. To explore the function of Cslnc170, we first cloned the full-length sequence of Cslnc170 using the RACE (rapid amplification of cDNA ends) technique based on the sequence information obtained by RNA-seq ( Figure 1 A, B).

[0041] The sequence (TL) obtained by RNA-seq is only 529 bp long; based on this, when performing 3'-RACE, a product 1052 bp long can be obtained; however, when performing 5'-RACE, no product can be obtained; further cloning of the full-length sequence of Cslnc170 revealed that the full length of Cslnc170 is 1581 bp. Genomic data shows that Cslnc170 is located on chromosome 14 with a full length of 1581 bp and no intron structure( Figure 1 A), and its cDNA sequence includes the nucleotide sequence shown in SEQ ID NO.1.

[0042] Predicting the coding ability of the full-length sequence of Cslnc170, it was found that Cslnc170 contains two putative ORFs( Figure 1 C - green and red modules), which may encode two short peptides with lengths of 33 aa and 27 aa respectively.

[0043] II. To verify whether Cslnc170 functions as a long non-coding RNA (lncRNA) or through the encoded short peptides, single-base substitution experiments were conducted on the start codon and stop codon of the two putative ORFs, that is, A-T or T-A substitutions were performed to prevent their coding, and the substitutions were named Cslnc170-1 and Cslnc170-2. We constructed Cslnc170, Cslnc170-1, and Cslnc170-2 on expression vectors respectively, and constructed the CsLOX4 promoter on the pGreenII 0800 vector fused with the LUC reporter gene. Under the mediation of Agrobacterium, tobacco transient co-expression was carried out together to observe whether Cslnc170, Cslnc170-1, and Cslnc170-2 activate the CsLOX4 promoter( Figure 1 D).

[0044] Construction of overexpression vectors

[0045] 1. Construction of overexpression vectors for Cslnc170 and its mutant forms

[0046] (1) Using the RNA obtained from Zhongcha 108 as the material, the 3'RACE-Ready cDNA template required for RACE cloning was synthesized using the SMARTer RACE 5′ / 3′Kit (Takara), and PCR amplification was performed using the following primers, and the amplified products were recovered:

[0047] UPM-F (SEQ ID NO:4): 5’-CTAATACGACTCACTATAGGGC-3’;

[0048] Cslnc170 - 3'RACE - R (SEQ ID NO:5):

[0049] 3’ - CTAGATGAGGCCACAACATGTGATGTG - 5’;

[0050] Cslnc170 - F (SEQ ID NO:6): 5’ - CATTAACGAGCAAGTTAATGTTATTC - 3’;

[0051] Cslnc170 - R (SEQ ID NO:7): 3’ - GGCGTTATTAATTAGACCAAATTAA - 5’;

[0052] (2) Using the amplified products recovered in step (1) as templates, perform base mutations of Cslnc170 using the following primers respectively to obtain the cloned products of Cslnc170 - 1 and Cslnc170 - 2:

[0053] Cslnc170 - 1 - F (SEQ ID NO:8): 5’ - TTACAAAATATTGTGTAAACT - 3’

[0054] Cslnc170 - 1 - R (SEQ ID NO:9): 3’ - TTGACTTTTAAGTTTTTTTAAC - 5’

[0055] Cslnc170 - 2 - F (SEQ ID NO:10): 5’ - AAGCTTATTTTGTTTGGACAAATG - 3’

[0056] Cslnc170 - 2 - R (SEQ ID NO:11): 3’ - TGTCTAAAAATAAAAAAATTATAC - 5’;

[0057] (3) Take the pCAMBIA1305.1 vector, perform double digestion with restriction enzymes BamhI and XbaI, and recover the vector backbone;

[0058] (4) Ligate the amplified products recovered in steps (1) and (2) with the vector backbone recovered in step (3) to obtain the recombinant plasmids 35S::Cslnc170, 35S::Cslnc170 - 1 and 35S::Cslnc170 - 2.

[0059] 2. Construction of the over - expression vector of CsLOX4

[0060] (1) Using the cDNA reverse - transcribed from the RNA obtained in Zhongcha 108 as a template, perform PCR amplification using the following primers and recover the amplified products:

[0061] CsLOX4-F (SEQ ID NO:12): 5’-ATGTTGAACAGTCAAGTTCACC-3’;

[0062] CsLOX4-R (SEQ ID NO:13): 3’-TCAAATTGAGATGCTATTTGGAAC-5’;

[0063] (2) Take the pCAMBIA1305.1 vector, perform double digestion with restriction enzymes BamhI and XbaI, and recover the vector backbone.

[0064] (3) Ligate the amplified product recovered in step (1) and the vector backbone recovered in step (3) to obtain the recombinant plasmid 35S::CsLOX4;

[0065] (4) Introduce the recombinant plasmid 35S::CsLOX4 into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium.

[0066] 3. Construction of overexpression vectors for the CsLOX4 promoter and its truncated forms

[0067] (1) Using the DNA obtained from Zhongcha 108 as the material, perform PCR amplification with the following primers and recover the amplified product:

[0068] CsLOX4pro-F (SEQ ID NO:14):

[0069] 5’-GGGTGAGACCCACTACCATATCATTAGTGG-3’

[0070] CsLOX4pro-R (SEQ ID NO:15):

[0071] 3’-CCATGGAATTAGAATTTGGACAGTATG-5’

[0072] (2) Using the amplified product recovered in step (1) as the template, perform sequence truncation of the CsLOX4 promoter with the following primers respectively to obtain the cloned products of different truncated forms P1, P2, P1-P2, P3, P4 and P5 of the CsLOX4 promoter:

[0073] (3) Take the pGreenII 0800 vector, perform single digestion with restriction enzyme BamhI, and recover the vector backbone.

[0074] (4)Ligate the amplified products recovered in steps (1) and (2) with the vector backbone recovered in step (3) to obtain the recombinant plasmids CsLOX4pro::LUC, P1-LUC, P2-LUC, (P1-P2)-LUC, P3-LUC, P4-LUC, and P5-LUC.

[0075] Dual-luciferase reporter assay

[0076] (1) Introduce all of the above recombinant vectors into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium.

[0077] (2) Activate and culture the recombinant Agrobacterium strains containing the effector (35S::Cslnc170, 35S::Cslnc170-1, and 35S::Cslnc170-2) and the reporter gene (CsLOX4pro::LUC, P1-LUC, P2-LUC, (P1-P2)-LUC, P3-LUC, P4-LUC, and P5-LUC) until the OD 600 reaches 0.8.

[0078] (3) Introduce the pGreenII 0800 vector into Agrobacterium tumefaciens GV3101 to obtain recombinant Agrobacterium as a control, and activate and culture this Agrobacterium until the OD 600 reaches 0.8;

[0079] (4) Centrifuge to collect the bacterial cells at room temperature and resuspend them twice in a solution containing 10 mM MgCl2, 10 mM MES, and 100 μM acetosyringone (pH 5.6);

[0080] (5) Adjust the OD of the Agrobacterium suspension 600 to 0.8 for infiltrating the leaves of 5- to 6-week-old Nicotiana benthamiana. The plants are then cultured for another 3 days.

[0081] (6) Spray the luciferase substrate on the leaves of Nicotiana benthamiana, and then detect the luminescence signal using a CCD imaging device (Lumazone Pylon2048B). Meanwhile, measure the activities of firefly LUC and Renilla (REN) using a dual-luciferase detection reagent (Promega, Madison, WI, USA). The LUC / REN ratio represents the activity of the promoter.

[0082] LUC imaging and dual-luciferase detection revealed that when Cslnc170 was co-expressed with the CsLOX4 promoter, the fluorescence intensity on the leaves was significantly higher than that of other control combinations; and the LUC activity was also significantly higher than that of other control combinations ( Figure 1E), indicating that Cslnc170 can activate the CsLOX4 promoter. When Cslnc170-1 or Cslnc170-2 was co-expressed with the CsLOX4 promoter, this activation effect still existed ( Figure 1 F, G). (The nucleotide sequence of the CsLOX4 gene is shown in SEQ ID NO.2, and the amino acid sequence of the protein encoded by the CsLOX4 gene is shown in SEQ ID NO.3)

[0083] These results prove that Cslnc170 can act as an lncRNA to activate the CsLOX4 promoter, rather than acting through short peptides.

[0084] III. According to the genome data assembled at the chromosomal level, Cslnc170 is located 9254 bp downstream of the CsLOX4 gene ( Figure 2 A). To study the interaction mechanism between Cslnc170 and the CsLOX4 promoter, we used IntaRNA software to predict the specific sequence covalent binding sites between them.

[0085] The prediction results showed that there was a binding region with a free energy of 9.82 kcal / mol at -930 bp - 952 bp of the CsLOX4 promoter, which could bind to the 252 bp - 271 bp region of Cslnc170 ( Figure 2 A). This result was further confirmed by gene truncation of the LOX4 promoter and Cslnc170 respectively and combined with the dual-luciferase assay (as Figure 2 shown).

[0086] The results of the dual-luciferase assay showed that the main region activated by Cslnc170 was the 1005 bp (P1) to 884 bp (P2) fragment of the CsLOX4 promoter ( Figure 2 B, C), and the 252 bp to 271 bp region of Cslnc170 was the key regulatory element for regulating the transcriptional activity of the CsLOX4 target gene CsLOX4 ( Figure 2 D, E, F).

[0087] IV. To verify the role of Cslnc170-CsLOX4 in resisting Colletotrichum camelliae, we transiently overexpressed and silenced these two genes respectively based on the Agrobacterium-mediated transient overexpression technology and the antisense oligonucleotide-mediated gene silencing technology.

[0088] 1. Transient overexpression in tea tree leaves

[0089] (1) Activate and culture the recombinant Agrobacterium of 35S::Cslnc170 and 35S::CsLOX4 to OD 600 to 0.8;

[0090] (2) Centrifuge to collect the bacterial cells at room temperature and resuspend them twice in a solution containing 10 mM MgCl2, 10 mM MES, and 100 μM acetosyringone (pH = 5.6);

[0091] (3) Adjust the OD of the Agrobacterium suspension 600 to 0.8 and inject the tea tree leaves.

[0092] 2. Transient silencing of tea tree

[0093] (1) Use SOLIGO software to select and synthesize the following candidate antisense oligonucleotides (AsODNs) targeting Cslnc170 and CsLOX4 through General Biosystems:

[0094] Cslnc170-sODN (SEQ ID NO:16): ATAAGATGCTCATGAGGGTG

[0095] Cslnc170-AsODN1 (SEQ ID NO:17): GTGGGAGTACTCGTAGAATA

[0096] Cslnc170-AsODN2 (SEQ ID NO:18): TAACACATCACATGTTGTGG

[0097] Cslnc170-AsODN3 (SEQ ID NO:19): CGTTTGAAATTACGAGAACC

[0098] CsLOX4-sODN (SEQ ID NO:20): AGGATCGTGGTAATTTCGGT

[0099] CsLOX4-AsODN1 (SEQ ID NO:21): TGGCTTTAATGGTGCTAGGA

[0100] CsLOX4-AsODN2 (SEQ ID NO:22): TGGTTGCTATGGCTTTAATG

[0101] CsLOX4-AsODN3 (SEQ ID NO:23): TCTGGTGGGCCGTATATCTT

[0102] (2) Inject 1 mL of a 100 μM AsODN mixed solution with a final concentration into the tea seedlings, and use the tea seedlings injected with sense oligonucleotides (sODNs) as a control;

[0103] (3) Perform quantitative detection and analysis after 48 hours.

[0104] 3. Infection of tea tree leaves by Colletotrichum camelliae

[0105] (1) Cultivate the Colletotrichum camelliae strain on PDA medium at a culture temperature of 28 °C for 5 days.

[0106] (2) Collect spores by centrifugation at 6000g for 10 minutes. After collection, resuspend the spores in sterile water and adjust their concentration to 10^6 spores / mL under microscopic monitoring for subsequent inoculation.

[0107] (3) Inoculate a total of 50 μL of the conidial suspension into the upper epidermis of plant leaves using a sterile syringe. Control plants are inoculated with an equal volume of sterile distilled water. The inoculated leaves are covered with plastic film to maintain high humidity and promote fungal growth.

[0108] (4) After a 24-hour incubation period, remove the film and record the symptoms of the infected leaves within 6 days after inoculation.

[0109] We constructed the target gene on the pCAMBIA1305.1 vector driven by CaMV35S through one-step ligation technology to obtain the recombinant vector of the candidate gene. Then, we used the Agrobacterium transient technology to transfer it into tea leaves (Zhongcha 108) respectively. After 24 hours, inoculate the Colletotrichum camelliae strain to induce the tea tree to develop diseases ( Figure 3 A).

[0110] Subsequently, we detected the expression of the corresponding gene by qRT-PCR. The results showed that compared with the control, the expression level of CsLOX4 in the tea tree leaves of the transient overexpression CsLOX4 experimental group was significantly increased, while the lesion area caused after inoculation was significantly reduced ( Figure 3 B); when the expression level of the CsLOX4 gene was silenced, the lesion area of the tea tree leaves after inoculation was significantly larger than that of the control leaves. The above results indicate that the expression level of the CsLOX4 gene is positively correlated with the resistance of tea trees to Colletotrichum camelliae ( Figure 3 C).

[0111] Similarly, transient overexpression and antisense oligonucleotide-mediated gene silencing experiments showed that there was a positive correlation between the expression of the Cslnc170 gene and the resistance of tea trees to Colletotrichum camelliae. Compared with the control group, transient overexpression of Cslnc170 significantly increased the expression level of CsLOX4 in tea leaves, which led to a significant reduction in the lesion area ( Figure 3 D). On the contrary, silencing Cslnc170 led to a significant decrease in the expression of CsLOX4 in tea leaves. The lesion area after inoculation was significantly larger than that observed in the control leaves. Figure 3E). In addition, when the Cslnc170-stem4 recombinant sequence lacking the 252bp-271bp region was transiently overexpressed in tea leaves, compared with the control group, the expression level of CsLOX4 did not change significantly. There was also no significant difference in the lesion size ( Figure 3 F). These results further confirmed the key role of the 252bp-271bp region in Cslnc170 in its anti-fungal function.

[0112] Cslnc170 truncation experiment

[0113] (1) Using the plasmid of Cslnc170 as a template, PCR amplification was carried out with the following primers, and the amplified products were recovered:

[0114] Stem4-1-F (SEQ ID NO:24):

[0115] CTCCTTATGAAGACAAAGAATGAAGAAAAAAAAATTC

[0116] Stem4(Stem4-1)-R (SEQ ID NO:25):

[0117] 3’-GGCGTTATTAATTAGACCAAATTAATATAATTC-5’;

[0118] Stem4(Stem4-2)-F (SEQ ID NO:26):

[0119] 5’-CATTAACGAGCAAGTTAATGTTATTCTACG-3’;

[0120] Stem4-2-R (SEQ ID NO:27):

[0121] 3’-GAATTTTTTTTTCTTCATTCTTTGTCTTCATAAGGAG-5’;

[0122] (2) After PCR fusion of the two amplified products obtained in step (1) as a template, PCR amplification was carried out with the following primers, the amplified products were recovered, and it was named stem4:

[0123] Stem4(Stem4-2)-F (SEQ ID NO:26):

[0124] 5’-CATTAACGAGCAAGTTAATGTTATTCTACG-3’;

[0125] Stem4(Stem4-1)-R(SEQ ID NO:25):

[0126] 3'-GGCGTTATTAATTAGACCAAATTAATATAATTC-5';

[0127] (3) The obtained stem4 was constructed on the pCAMBIA1305.1 expression vector to obtain a recombinant vector;

[0128] (4) The recombinant vector was introduced into Agrobacterium tumefaciens GV3101 for subsequent transient expression in Nicotiana benthamiana and tea tree leaves.

[0129] SEQ ID NO.1:

[0130]

[0131] SEQ ID NO.2:

[0132]

[0133] SEQ ID NO.3:

[0134] MLNSQVHQSHTVQILIPWHKPFPSGTASPSSSLHLLKPGLCGNQKDKGRVRCVPSTIKAIATTTTEQTTIVKAVVCVKLTVGGFLSNLGLSRGLDDVADMLGKSIQLELVSAELDPKTGLEKETIKGYAHRTSQEEDEVKYECNFVIPEGYGEIGAVLVENEHHKEMYLKQIVFHGFPPGGPVHVTCNSWVASKFHNPHKRIFFTNKSYLPSQTPDGLKRLREKELENLRGNGQGKRKIHERIYDYDVYNDIGDPDTSSTLKRPVLGGKQHPYPRRCRTGRPRSKTDPMSESWCSGSIYVPRDEAFSDVKQLTFSGMPVYSVLHALIPSIENAIVDIDLGFPYVTAIDSLFDEGVNLLPLSKNGLLKDLLPRLVKFVSDAEEGLLRFETPAMFERDKFSWLRDEEFSRQTLGGLNPCSIQLVKEWPLKSKLDLKIYGPPESAITKELIERQIRGFMTLEEALQTKKLFMLDYHDLLLPYVNKVRESKGTALYGSRTLFFLTPDGTLRPLAIELTRPPVDGKPQWKQVFTPTGDATGCWLWRLAKVHALAHDSGYHQLVSHWLRTHCVTEPYIIASNRQLSAMHPIYKLLHPHFRYTMEINALARQALINAGGIIETCFSPKKYSIELSSVAYDQQWRFDLQALPADLISRGMAMEDPTALHGLRLTIEDYPYASDGLLVWDAIKQWVTDYVKHYYQDASFVQSDKELQAWWTEIQTVGHGDKKDETWWPVLKTPQDLIGILTTMIWVTSGHHSAVNFGQYIYAGYFPNRPTIARTKMPTEEPTDEEWKCFINKPEVALLMCFPSQIQATKVMAVLDVLSNHSPDEEYLGKDMEASWIENPIIKAAFERFNGKLKELEGVIDRRNVDKNLKNRCGAGVVPYELLKPFSEPGVTGRGVPNSISI

[0135] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Cslnc170 gene, characterized in that: The cDNA sequence thereof includes the nucleotide sequence shown in SEQ ID NO.

1.

2. The Cslnc170 gene according to claim 1 is used in any of the following: (1) Application in activating the CsLOX4 gene promoter; (2) Application in promoting CsLOX4 gene expression; (3) Application in the detection of anthracnose resistance in tea trees; (4) Application in improving the resistance of tea trees to anthracnose; (5) Application in breeding tea varieties resistant to anthracnose.

3. The use according to claim 2, characterized in that: In (1), Cslnc170 acts as a lncRNA to activate the CsLOX4 promoter.

4. A recombinant vector, characterized in that: Contains the Cslnc170 gene according to claim 1.

5. A transfection vector, characterized in that: Contains the recombinant vector according to claim 4.

6. The transfection vector according to claim 5, characterized in that The transfection vector is Agrobacterium.

7. A drug for preventing and treating tea tree anthracnose, characterized in that: Containing the transfection vector described in any one of claims 5-6.

8. Application of CsLOX4 in improving the resistance of tea trees to anthracnose, characterized in that: The CsLOX4 includes a CsLOX4 gene and a CsLOX4 protein; the nucleotide sequence of the CsLOX4 gene is shown in SEQ ID NO.2; The amino acid sequence of the CsLOX4 protein is shown in SEQ ID NO.

3.

9. A method for breeding tea trees resistant to anthracnose, characterized in that: The following steps are involved: By promoting the expression of Cslnc170 gene or CsLOX4 gene in the target plant, a tea plant having higher anthracnose resistance than the target plant is obtained.

10. The method for breeding anthracnose-resistant tea trees according to claim 9, characterized in that: The method for promoting the expression of Cslnc170 gene or CsLOX4 gene in the target plant comprises: constructing a Cslnc170 gene or CsLOX4 gene overexpression vector and introducing the vector into the target plant.

Images