MiR156 precursor gene and application thereof in regulation and control of stalk length

Abstract

The invention relates to the technical field of plant breeding, in particular to a miR156 precursor gene and application thereof in regulation and control of stem length. The miR156 precursor gene comprises a nucleotide sequence as shown in SEQ ID NO. 1 (sequence identifier number 1). The application comprises the step of reducing the stem length of the plant by improving the expression level of the miR156 precursor gene. The invention finds a novel miR156 precursor gene and novel application of miR156 through research, and the stem length of a plant can be further regulated and controlled by regulating and controlling the expression level of miR156. The miR156 precursor gene and the new application of miR156 provided by the invention can be applied to cultivation of high-quality plant varieties, not only can the theoretical knowledge of a plant stem elongation regulation mechanism be enriched, but also important gene resources can be provided for genetic improvement and new variety cultivation of bamboos.

Description

Technical Field

[0001] The present invention relates to the technical field of plant breeding, and particularly relates to a miR156 precursor gene and its application in regulating stem length. Background Art

[0002] Bamboo is a plant with a relatively fast growth rate, and the rapid elongation of its stem is an important economic trait of bamboo. As the main supporting and material transporting organ of bamboo, its stem completes rapid development from bamboo shoots to mature bamboo stalks within several weeks, with a daily growth rate of up to dozens of centimeters and a maximum of 1 meter. The rapid growth characteristics of bamboo make it have important application values in the fields of ecological restoration, building materials, pulp and paper making, etc. However, the current research on the molecular mechanism of bamboo stem elongation is relatively less, which restricts the development of bamboo molecular breeding.

[0003] Stem elongation is a key biological process in plant growth and development, which directly affects plant morphogenesis and biomass accumulation. The rapid elongation of bamboo stems not only determines its competitive advantage in the natural environment, but also is closely related to its economic value, such as affecting the yield and quality of bamboo. At present, although there is a certain research basis on the regulation mechanism of plant stem elongation in some model plants, there are significant species specificities among different plants, and these research results are difficult to be directly applied to Phyllostachys edulis. miRNA is a class of endogenous non-coding small RNAs that play important regulatory roles in the process of plant growth and development. As a highly conserved miRNA family in plants, miR156 has been proven to be involved in regulating multiple growth and development processes of plants, including the transition of the vegetative growth stage, lateral branch development, leaf morphogenesis, etc. In a variety of plants, miR156 affects the plant growth and development process by targeting and regulating specific transcription factors, such as genes of the SPL (SQUAMOSA PROMOTER BINDING PROTEIN -LIKE) family. There has been no research report on the function or mechanism of action of the miR156 gene in regulating stem length. Summary of the Invention

[0004] In order to solve the problems existing in the prior art, the present invention provides a miR156 precursor gene and its application in regulating stem length.

[0005] In the first aspect, the present invention provides a miR156 precursor gene (also known as phe-MIR156o), including any one of the following nucleotide sequences: (1) The nucleotide sequence shown in SEQ ID NO.1; (2) A nucleotide sequence obtained by substitution, deletion or insertion of one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.1 and capable of encoding a protein with the same function; (3) A nucleotide sequence that can hybridize with the nucleotide sequence shown in SEQ ID NO.2 under stringent conditions.

[0006] The nucleotide sequence shown in SEQ ID NO.1: GGGAUCUGACAGAAGAGAGUGAGCAUAUAUAGUGCUUUUCUUGCAUAUGUGCAUAUAGGCAGACUGCAUAGGGAUCGAAAUCGAGUUCAUGCAUGUGCUUGAAGCUAUAUGUGCUCACUUCUCUUUCUGUCAGCAA.

[0007] In a second aspect, the present invention provides a vector, which comprises the aforementioned miR156 precursor gene, preferably the pCAMBIA1300 vector.

[0008] In a third aspect, the present invention provides a transgenic cell, which comprises the aforementioned miR156 precursor gene, or the aforementioned vector.

[0009] In a fourth aspect, the present invention provides a kit, which comprises the aforementioned miR156 precursor gene, or the aforementioned vector, or the aforementioned transgenic cell.

[0010] In a fifth aspect, the present invention provides the use of the miR156 gene, or the aforementioned miR156 precursor gene, or the aforementioned vector, or the aforementioned transgenic cell, or the aforementioned kit in regulating the stem length of plants.

[0011] The present invention further provides the use of the miR156 gene, or the aforementioned miR156 precursor gene, or the aforementioned vector, or the aforementioned transgenic cell, or the aforementioned kit in any one of the following: (1) Reducing the plant height; (2) Cultivating dwarf plant varieties; (3) Cultivating transgenic plants; (4) Improving the germplasm resources of plants.

[0012] Furthermore, the miR156 gene comprises any one of the following nucleotide sequences: (1) The nucleotide sequence shown in SEQ ID NO.2; (2) A nucleotide sequence obtained by substitution, deletion or insertion of one or more nucleotides in the nucleotide sequence shown in SEQ ID NO.2 and capable of encoding a protein with the same function; (3) A nucleotide sequence that can hybridize with the nucleotide sequence shown in SEQ ID NO.2 under stringent conditions.

[0013] The nucleotide sequence shown in SEQ ID NO.2: CUGACAGAAGAGAGUGAGCA.

[0014] Furthermore, by increasing the expression level of the miR156 gene or the miR156 precursor gene, the stem length of the plant is reduced.

[0015] Furthermore, the expression level of the miR156 gene or the miR156 precursor gene in the plant is regulated by any one of the following methods: Transgenic, hybridization, backcross, self-cross or asexual reproduction; The transgenic preferably includes one or more of the following methods: Ti plasmid, plant virus vector, direct DNA transformation, microinjection, gene gun, electroporation or Agrobacterium-mediated transformation.

[0016] Furthermore, the plant is a monocotyledon or a dicotyledon, preferably bamboo or rice.

[0017] The present invention has the following beneficial effects: Through in-depth research on the miR156 gene of Phyllostachys edulis, the present invention finds that this gene plays an important role in the stem growth of plants and can regulate the stem length of plants. By overexpressing the phe-MIR156o gene, the stem length of plants can be significantly reduced, thereby regulating the plant height, cultivating dwarf plants and improving the lodging resistance. The application of the miR156 gene of Phyllostachys edulis provided by the present invention is not only applicable to bamboo, but also can be extended to the improvement of other related plants (such as rice), providing a valuable gene resource for the genetic improvement and new variety cultivation of bamboo and other related plants, and having important theoretical significance and potential application value in the field of plant genetic engineering. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0019] Figure 1 It is the electrophoresis pattern of cloning the phe-MIR156o gene provided in Example 1 of the present invention; wherein, M is the DNA marker; 1 and 2 respectively represent the electrophoresis bands of the phe-MIR156o gene.

[0020] Figure 2Results of detecting positive plants of the phe-MIR156o transgenic rice line provided in Example 1 of the present invention; where M is the DNA marker; WT is the wild type; E is the empty vector pC1300, P is the vector pC1300-phe-MIR156o, and 1-15 are the results of detecting positive plants.

[0021] Figure 3 Comparison of plant height phenotypes between the phe-MIR156o transgenic rice provided in Example 1 of the present invention and the wild type; where A is the comparison of plant photos, and B is the comparison of statistical results; where WT is the wild type, #2, #6, and #9 are different phe-MIR156o transgenic rice plants, and the unit of plant height is cm. Detailed implementation manners

[0022] To make the objectives, technical solutions, and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments in the present invention without making creative efforts fall within the scope of protection of the present invention.

[0023] For the experimental methods involved in the following embodiments, unless otherwise specified, they are all conventional methods in the art. For example, they can be referred to the experimental manuals in the art or according to the conditions recommended in the manufacturer's instructions.

[0024] For the experimental materials and reagents involved in the following embodiments, unless otherwise specified, they can all be obtained from commercial channels. For example:

[0025] Example 1 1. First, the present invention clones the precursor gene phe-MIR156o of moso bamboo miR156, and the process is as follows: (1) The moso bamboo spring bamboo shoots are collected from Guangde County, Anhui Province, and the collected materials are stored at -80 °C for subsequent experimental use.

[0026] (2) To extract the DNA of moso bamboo, the Hi-DNAsecure Plant Kit (DP350) rapid extraction kit provided by Tiangen Biochemical Technology (Beijing) Co., Ltd. is used. The specific operation steps are carried out according to the instructions in the kit.

[0027] (3) Cloning of the phe-MIR156o gene Based on the phe-MIR156o (SEQ ID NO.2) sequence identified by local blast, specific primers are designed, and the primer sequences are as follows: Upstream primer phe-MIR156o-F: 5'-GGGATCTGACAGAAGAGAGTGAGC-3', Downstream primer phe-MIR156o-R: 5'-TTGCTGACAGAAAGAGAAGTGAGC-3'.

[0028] i) PCR amplification Using moso bamboo genomic DNA as a template, the target gene was amplified by PCR. The reaction program was set as follows: Table 1 PCR amplification program

[0029] The amplification system was 20 μL, and the specific ratio was as follows: Table 2 PCR reaction system

[0030] ii) Electrophoresis was performed using 1% agarose gel to detect whether the size of the amplified band was as expected (as Figure 1 shown). The target band was confirmed by image analysis, and subsequent gel extraction and purification were carried out.

[0031] (4) Ligation of the cloned product with the vector i) In a new microcentrifuge tube, add 30 ng of the PCR product, 1 μL of the pMD19-T vector, 5 μL of Solution I, and an appropriate amount of ddH 2 O to make the total volume reach 10 μL. React at 16 °C for 1 h.

[0032] ii) The ligated product was transformed into competent bacteria by heat shock transformation. First, the ligation product was mixed evenly with the competent bacteria, then quickly placed on ice for cooling, and immediately heat shocked at 42 °C for 30 - 60 s. After heat shock, it was quickly cooled, and then the mixture was added to the liquid medium and cultured at 37 °C for 60 min. Then, the mixture was evenly spread on an agarose plate containing the appropriate antibiotic.

[0033] iii) After culturing overnight on the culture plate, colonies with good growth were selected for PCR detection to confirm whether they contained the target clone. Colonies were selected for colony PCR to further verify the sequence of the inserted fragment, and the identified positive bacterial liquid was sent to Suzhou Genewiz Co., Ltd. for sequencing. The nucleotide sequence of the phe-MIR156o gene is shown in SEQ ID NO.2.

[0034] (5) Construction of the phe-MIR156o expression vector i) Design seamless cloning primers for the phe-MIR156o expression vector, and the primer sequences are as follows: pCAMBIA1300- phe-MIR156o F1: 5'-GAGCTCGGTACCCGGGGATCCGGGATCTGACAGAAGAGAGTGAGC-3', pCAMBIA1300- phe-MIR156o R1: 5'-GTAGTCCATTCTAGAGGATCCTTGCTGACAGAAAGAGAAGTGAGC-3'.

[0035] ii) Use the phe-MIR156o cloning vector as a template to amplify the target gene by PCR. Linearize the pCAMBIA1300 vector using BamH Ⅰ enzyme digestion, and perform seamless cloning of the inserted fragment and the vector at a molar ratio of 3:1. The reaction is carried out at 37°C for 30 min.

[0036] iii) Transform the ligation product into Escherichia coli by heat shock method. Spread the transformed bacterial solution on an LB plate containing antibiotics, and select white colonies for positive screening. Verify by colony PCR and extract the plasmid for sequencing.

[0037] 2. Transformation of rice Adopt the Agrobacterium-mediated rice callus transformation method (Hiei et al., 1994) for rice transformation, including the following process: Transform the pCAMBIA1300-phe-MIR156o vector into Agrobacterium tumefaciens EHA105, culture it on YEP medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, and culture it for 2 days under dark conditions at 28°C. Collect Agrobacterium cells, resuspend them in the co-culture solution, adjust the OD600 to 0.4, and add acetosyringone (AS) to a final concentration of 0.1 mmol / L to prepare the co-culture solution for rice transformation. Add the Agrobacterium suspension to the rice callus for co-culture. Then, screen and culture the transformed callus on the selective medium.

[0038] 3. Screening, identification and analysis of transgenic plants (1) Screening of transgenic rice Collect the obtained rice seeds, soak them in clean water, and germinate them in an incubator or oven at 28°C. Change the water source daily, and the seeds will show white tips after about 3 days. Subsequently, evenly spread the germinated seeds in the small holes of the tray containing 200 mg / L G418 solution, and continue to culture at 28°C.

[0039] Experimental observations showed that the roots of positive plants grew well, with root lengths reaching over 8 cm; while the root development of negative plants was restricted, only 2 - 4 cm, and their above-ground parts were shorter than those of positive plants. The transgenic efficiency was evaluated by counting the ratio of positive and negative plants.

[0040] (2)Identification of positive transgenic plants Genomes were extracted from the selected rice seedlings. Amplification was carried out according to the optimized PCR cycling conditions. The PCR products were detected by agarose gel electrophoresis. If the size of the amplified band was consistent with the expected size ( Figure 2 ), then the plant was confirmed as a positive transgenic plant, that is, a phe-MIR156o transgenic rice plant.

[0041] (3)Phenotypic observation and detection of transgenic plants The experimental group was transgenic rice plants (phe-MIR156o transgenic rice plants), and the control group was wild-type rice plants. All experimental plants were cultivated in the same growth environment to ensure the reliability and comparability of the experimental data.

[0042] i)Plant height measurement Before the heading and maturity stages of rice, the plant height from the ground surface to the top of the rice panicle (excluding awns) was measured. Each plant was measured 3 times and the average value was calculated. At least 20 transgenic rice plants and wild-type rice plants were randomly selected for measurement to ensure the representativeness of the data.

[0043] ii)Leaf morphology measurement The length of the leaf (the distance from the leaf base to the leaf tip) and the width of the leaf (at the widest part of the leaf) were measured using a ruler. Each leaf was measured 3 times and the average value was taken to ensure the accuracy of the data.

[0044] iii)Statistics of rice panicles and grains After the rice matured, at least 20 rice panicles of transgenic rice and wild-type rice were randomly collected, the total number of grains per panicle was recorded, and the number of plump grains and empty grains was counted respectively to evaluate the effect of transgene on grain development.

[0045] 4、The results are as Figure 3 shown. It can be seen that compared with wild-type rice, the plant height of phe-MIR156o transgenic rice plants was significantly reduced.

[0046] From Figure 3 it can be seen that compared with wild-type rice, the plant height of phe-MIR156o transgenic rice plants was reduced by about 13 cm (#2), 11 cm (#6), and 10 cm (#9) respectively.

[0047] In addition, further statistics of the present invention found that the growth rate of wild-type rice is 0.42 cm / d, and the growth rates of transgenic lines #2, #6, and #9 are 0.16 cm / d, 0.27 cm / d, and 0.16 cm / d, respectively.

[0048] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A miR156 precursor gene, characterized in that: Includes any of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO.1; (2) A nucleotide sequence encoding a protein with the same function obtained by replacing, deleting or inserting one or more nucleotides of the nucleotide sequence shown in SEQ ID NO.1; (3) A nucleotide sequence that can hybridize with the nucleotide sequence shown in SEQ ID NO. 2 under stringent conditions.

2. A carrier, characterized in that The vector comprises the miR156 precursor gene according to claim 1.

3. A transgenic cell, characterized in that: The transgenic cell comprises the miR156 precursor gene according to claim 1 or the vector according to claim 2.

4. A kit, characterized in that: The kit comprises the miR156 precursor gene according to claim 1, or the vector according to claim 2, or the transgenic cell according to claim 3.

5. Use of the miR156 gene, or the miR156 precursor gene described in claim 1, or the vector described in claim 2, or the transgenic cell described in claim 3, or the kit described in claim 4 in regulating the stem length of a plant.

6. Use of the miR156 gene, or the miR156 precursor gene according to claim 1, or the vector according to claim 2, or the transgenic cell according to claim 3, or the kit according to claim 4 in any of the following: (1) Reduce plant height; (2) Cultivating dwarf plant varieties; (3) Cultivation of transgenic plants; (4) Improvement of plant germplasm resources.

7. The use according to claim 5 or 6, characterized in that: The miR156 gene includes any one of the following nucleotide sequences: (1) the nucleotide sequence shown in SEQ ID NO.2; (2) A nucleotide sequence encoding a protein with the same function obtained by replacing, deleting or inserting one or more nucleotides of the nucleotide sequence shown in SEQ ID NO.2; (3) A nucleotide sequence that can hybridize with the nucleotide sequence shown in SEQ ID NO. 2 under stringent conditions.

8. The use according to claim 5 or 6, characterized in that: By increasing the expression level of the miR156 gene or the miR156 precursor gene, the stem length of the plant is reduced.

9. The use according to claim 8, characterized in that: The expression level of the miR156 gene or the miR156 precursor gene in the plant is regulated by any of the following methods: Transgenic, hybrid, backcross, selfing or asexual reproduction.

10. The use according to claim 5 or 6, characterized in that: The plant is bamboo or rice.

Images