Application of AtERG1 gene in regulation and control of plant chloroplast development

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to application of an AtERG1 gene to regulation and control of plant chloroplast development. The invention explores the influence of the AtERG1 gene on the development of arabidopsis thaliana chloroplast by means of reverse genetics in combination with morphological and physiological and biochemical methods. Compared with wild arabidopsis thaliana, the AtERG1 gene down-regulated mutant seedlings and adult seedlings present phenotypes of yellowing, slow growth / dwarfing. The AtERG1 gene mutation reduces the content of chloroplast coding photosynthesis protein, resulting in incomplete chloroplast structure, reduced chloroplast photosynthetic efficiency and affected chlorophyll content. The color of the AtERG1 gene overexpression mutant is consistent with that of wild type arabidopsis, the AtERG1 gene overexpression mutant is a green phenotype, and seedlings are slightly larger than that of the wild type. According to the invention, the influence of the AtERG1 gene on chloroplast development and photosynthetic efficiency is analyzed, and a foundation is laid for deeply knowing the action mechanism of AtERG1 protein and the influence on chloroplast development. The method can be used for leaf color genetic engineering improvement and breeding of horticultural plants.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to the application of the AtERG1 gene in regulating the development of plant chloroplasts. Background Art

[0002] Chloroplasts are important organelles in higher plants. As the photosynthesis center of plant cells and the key site for various biosynthetic pathways, the precise regulation of their development and function is of inestimable importance for plant growth and development, environmental adaptation, and the improvement of plant productivity. Understanding the development of chloroplasts in higher plants plays an important role in artificially modifying the photosynthesis mechanism and creating high-yield or colorful agricultural and forestry species.

[0003] Chloroplasts are derived from cyanobacteria and form organelles of eukaryotic cells through endosymbiosis. Chloroplasts are formed from the development of proplastids, which are surrounded by a double membrane and contain DNA, vesicles, and starch granule structures. Vesicles are formed by the invagination of the inner membrane of the double membrane of proplastids. The number of vesicles increases and they fuse with each other to form lamellae. Multiple lamellae are arranged in parallel rows to form grana thylakoids, which then develop into green chloroplasts. Chloroplasts are semi-autonomous organelles that can convert light energy into chemical energy. Chloroplasts have their own genomes, independent genetic systems, can replicate genes and transcribe, have independent ribosomes, and can carry out gene expression. The development of chloroplasts from initial formation to final maturity undergoes a series of highly ordered and strictly regulated developmental stages. This process not only involves the expression regulation of the chloroplast's own genetic material, but is also closely linked to the processes of transcription, translation, and subsequent modification of the nuclear genome, forming an intricate regulatory network.

[0004] The maturation of chloroplast ribosomes plays a crucial role in chloroplast development. According to the cyanobacterial origin characteristics of chloroplasts, the chloroplast genome characteristics are similar to those of prokaryotic genomes. During evolution, some genes of the cyanobacterial genome are integrated into the host nuclear genome, and these genes are expressed in the 80S ribosomes in the cytoplasm, translated into proteins, modified, and then enter the chloroplast to perform functions. The chloroplast's own genomic DNA encodes some key proteins for photosynthesis, which are synthesized in the 70S ribosomes of the chloroplast. A large number of studies have confirmed that the maturation of chloroplast ribosomes requires precise regulation of nuclear genes and chloroplast genes. Generally, the biosynthesis of chloroplast ribosomes begins with the transcription of a large precursor rRNA. The precursor rRNAs are processed, folded, and finally assembled with ribosomal proteins into mature ribosomes. This highly complex and coordinated process is co-regulated by some rRNA processing factors and assembly auxiliary factors. In plant cells, GTPase enzymes play a key role in various organelle activities, including the maturation of chloroplast ribosomes. For example, the Arabidopsis thaliana YqeH-type GTPase enzyme is involved in the biosynthesis process of Arabidopsis thaliana chloroplast ribosomes; the OsNOA1 / RIF1 protein in rice is also a GTPase enzyme homologous to the bacterial protein YqeH, located in the chloroplast, and is involved in the metabolism of chloroplast 16S rRNA, suggesting that it plays an important role in the maturation and function maintenance of chloroplast ribosomes. Homologs of the bacterial Era protein exist in animals, plants, and humans, and the homolog of Era in plants is called ERG (Era-related GTPase). The AtERG1 (At5g66470) protein in the Arabidopsis thaliana genome has typical Era characteristics, containing a GTPase domain and a KH domain. Existing studies have shown that Arabidopsis thaliana AtERG1 is located in the nucleoid region within the chloroplast, but its genetic function has not been reported yet. Summary of the Invention

[0005] The present invention provides a protein and its gene related to leaf color variation in Arabidopsis thaliana, as well as a method for modifying leaf color using the said gene.

[0006] The technical solution adopted by the present invention is as follows: the application of the AtERG1 gene in regulating plant chloroplast development, and the nucleotide sequence of the AtERG1 gene is as shown in SEQ ID No.1.

[0007] Further defined, the amino acid sequence of the protein encoded by the AtERG1 gene is as shown in SEQ ID No.2.

[0008] Further limitation is that the regulation of plant chloroplast development is as follows: by down-regulating the AtERG1 gene, the plant shows a yellowing phenotype, slow growth, abnormal chloroplast development, abnormal thylakoid membrane development, reduced content of chloroplast-encoded photosynthesis proteins, and / or decreased chlorophyll content.

[0009] Further limitation is that a recombinant plant expression vector with down-regulated AtERG1 gene is constructed, and then the recombinant vector with down-regulated AtERG1 gene is transferred into wild-type plants. The transgenic plants show a yellowing phenotype, slow growth, abnormal chloroplast development, abnormal thylakoid membrane development, reduced content of chloroplast-encoded photosynthesis proteins, and / or decreased chlorophyll content.

[0010] Further limitation is that an artificial microRNA technology is used to construct a recombinant vector with down-regulated AtERG1 gene. The target gene sequence of the microRNA of the AtERG1 gene is as shown in SEQ ID No.3 or as shown in SEQ ID No.4.

[0011] Further limitation is that the present invention also provides the use of the above gene. The gene can change the leaf color of plants by means of gene knockdown.

[0012] The present invention explored the effect of AtERG1 protein on Arabidopsis chloroplast development by reverse genetics means, combined with morphological and physiological and biochemical methods. The AtERG1 protein contains a GTP-binding domain and a KH domain and is highly conserved within higher plant species. Phenotypic analysis of the AtERG1 gene down-regulated mutant showed that compared with wild-type Arabidopsis, the mutant seedlings showed a yellowing phenotype and slow growth. The AtERG1 gene over-expression mutant had the same green phenotype as wild-type Arabidopsis, and the seedlings were slightly larger than wild-type. Physiological and biochemical data showed that down-regulation of the AtERG1 gene reduced the contents of total chlorophyll, chlorophyll a, and chlorophyll b in the plant leaves. The mutation led to a significant decrease in the electron transfer rate ETR and the maximum photochemical quantum yield Fv / Fm of PS II in the plant, and a significant increase in non-photochemical quenching qN. Chloroplast ultrastructure showed that down-regulation of the AtERG1 gene affected chloroplast development, and the grana and stroma thylakoid structures were incomplete.

[0013] In summary, the present invention used artificial microRNA technology to elaborate on the genetic function of the AtERG1 gene, clarified the effect of the AtERG1 gene on chloroplast development and photosynthetic efficiency, demonstrated that it can regulate the leaf color of plants, can be used for leaf color improvement of horticultural plants, and at the same time laid a foundation for further understanding the action mechanism of the AtERG1 protein and chloroplast genetic development. Brief Description of the Drawings

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, obtaining other drawings based on these drawings still belongs to the scope of the present invention.

[0015] Figure 1 For the tissue expression characteristics of Arabidopsis AtERG1 gene;

[0016] Figure 2 For the light response characteristics of Arabidopsis AtERG1 gene;

[0017] Figure 3 For the heat response characteristics of Arabidopsis AtERG1 gene;

[0018] Figure 4 For the resistance screening of Arabidopsis AtERG1-amiRNA; (A) Green seedlings are AtERG1-D1-amiRNA positive plants; (B) Green seedlings are AtERG1-D2-amiRNA positive plants;

[0019] Figure 5 For the expression level analysis of Arabidopsis AtERG1 gene knockdown and overexpression mutants;

[0020] Figure 6 For the seedling phenotypes of Arabidopsis AtERG1 gene knockdown and overexpression mutants;

[0021] Figure 7 For the adult plant phenotypes of Arabidopsis AtERG1 gene knockdown mutants;

[0022] Figure 8 For the chlorophyll content analysis of Arabidopsis AtERG1 gene mutants; (A) Total chlorophyll content; (B) Total chlorophyll a content; (C) Total chlorophyll b content;

[0023] Figure 9 For the representative chlorophyll fluorescence imaging map of Arabidopsis AtERG1 gene knockdown mutants;

[0024] Figure 10 For the chlorophyll fluorescence parameters of Arabidopsis AtERG1 gene knockdown mutants; (A) Fv / Fm value; (B) Non-photochemical quenching, qN; (C) Electron transport rate ETR;

[0025] Figure 11 For the chloroplast ultrastructure diagrams of Arabidopsis wild type and AtERG1 gene knockdown mutant leaves;

[0026] Figure 12Analysis diagram of the contents of AtpB and D1 proteins in the Arabidopsis AtERG1 gene knockdown mutant. Specific implementation mode

[0027] To make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings.

[0028] To make the above objectives, features and advantages of the present invention more obvious and understandable, the specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. Unless otherwise specified in the following embodiments, they are all conventional methods. The materials, reagents, enzymes, competent cells, plasmids, etc. used, unless otherwise specified, can all be obtained from commercial channels. The present invention will be described in detail below through specific embodiments.

[0029] Example 1 Bioinformatics analysis of plant ERG1 gene

[0030] Arabidopsis genomic DNA was extracted, and the target gene DNA fragment, the Arabidopsis AtERG1 gene, was obtained by gel recovery extraction. The sequence of the Arabidopsis AtERG1 gene is shown in SEQ ID No.1, with a full length of 2859bp. The AtERG1 gene contains 9 exons and 8 introns, and the full length of the CDS is 1284bp.

[0031] The amino acid sequence of the protein encoded by the Populus trichocarpa gene PtrMYBR069 is shown in SEQ ID No.2, with a total of 427 amino acids. The secondary structure of the AtERG1 protein was analyzed online using the InterPro tool. The AtERG1 protein contains a 39bp transit peptide and contains a GTP binding domain and a KH (type II) domain (KH domain). It is known that the KH domain is a conserved RNA binding domain of about 70 amino acids, which exists in most nucleic acid binding proteins (RNA binding protein) and is essential for its RNA binding activity.

[0032] Example 2 Analysis of the expression characteristics of the Arabidopsis AtERG1 gene:

[0033] (1) To study the tissue expression characteristics of the AtERG1 gene and thus explore its function, the transcription levels of the AtERG1 gene in 5 different tissues of Arabidopsis stems, leaves, fruits, flowers and roots were detected using semi-quantitative PCR method and real-time fluorescence quantitative PCR method, and the expression status and expression quantity differences of this gene were analyzed. As Figure 1The results showed that the expression of the AtERG1 gene was detected in stems, leaves, fruits and flowers, but not in roots. High expression was observed in leaves and flowers. The results of fluorescence quantitative PCR also showed that the transcriptional level was relatively the highest in leaves, followed by flowers. The results of tissue expression analysis were consistent with the expression characteristics of genes related to photosynthesis. Therefore, it was speculated that the function of the AtERG1 gene might be related to photosynthesis.

[0034] (2) Based on the characteristic of high expression of the Arabidopsis AtERG1 gene in plant leaves, semi-quantitative and fluorescence quantitative methods were used to detect the response characteristics of the Arabidopsis AtERG1 gene to light and heat. Arabidopsis seedlings were cultured under light for 0.5 h, 1 h, 3 h, 6 h, 12 h and 24 h respectively. Total RNA was extracted and reverse transcribed into cDNA. Using the cDNA treated with different light exposure times as templates, semi-quantitative and real-time fluorescence quantitative analyses were carried out, as Figure 2 The results showed that there was no significant change in the gene between 0.5 h and 3 h of light treatment, and the relative expression level was relatively low. However, when the light exposure time was 6 h and 12 h, the transcriptional level of the AtERG1 gene changed significantly, increasing by 2 to 3 times. This indicated that the transcriptional expression of the AtERG1 gene responded to light.

[0035] (3) To further understand the characteristics of the AtERG1 gene to heat, the expression of the AtERG1 gene in Arabidopsis seedlings after being treated at 8 °C, 23 °C, 37 °C and 42 °C for 1 h was detected by semi-quantitative PCR method and real-time fluorescence quantitative PCR method. The results were as Figure 3 shown: When 23 °C was used as a reference, the expression of the AtERG1 gene decreased significantly under the conditions of 8 °C and 37 °C. When treated at 8 °C, the relative expression level of the AtERG1 gene was the lowest, about 1 / 4 of that under the condition of 23 °C. However, when the temperature increased to 45 °C, the transcriptional expression of the AtERG1 gene hardly changed. This indicated that Arabidopsis responded to heat shock stress and was more sensitive to low temperature.

[0036] Example 3 Obtaining and identification of Arabidopsis AtERG1 gene down-regulated mutant plants

[0037] (1) Construction of AtERG1 gene microRNA mutants

[0038] Two down-regulated mutants of this gene, AtERG1-D1-amiRNA and AtERG1-D2-amiRNA, were constructed by using artificial microRNA technology. The specific construction process was as follows:

[0039] The target gene sequences of two microRNAs of the AtERG1 gene designed through the WMD3 bioinformatics platform were named D1 and D2, namely 470mi-A: CACCCTGCAAGGCGATTAAGTTGGGTAAC (SEQ ID No.3), 470mi-B: GCGGATAACAATTTCACACAGGAAACAG (SEQ ID No.4). Based on the two target gene sequences, 8 overlapping PCR primers were designed online, with four in each group (1 to 4), and the primer sequences are shown as follows:

[0040]

[0041] RS300 is the pBSK plasmid containing the miR319a precursor. Using the KOD enzyme, after four rounds of PCR, the target gene containing the target gene was finally cloned into the miR319a precursor. The PCR reaction mixture is as follows:

[0042]

[0043] Gel extraction was used to recover the recombinant miR319a containing the target sequence and ligated it to the pENTR TM / SD / D-TOPO vector. After the PCR detection of the bacterial liquid showed that the target fragment was correct, the plasmid was extracted and then the plasmid size was detected by agarose gel electrophoresis. The constructed AtERG1-D1-TOPO and AtERG1-D2-TOPO vectors were sent to the company for sequencing. The AtERG1-D1-TOPO and AtERG1-D2-TOPO vectors were recombined into the pGWB2 plant expression vector through the LR reaction. The recombinant reaction solution was transferred into Escherichia coli competent cells. Through resistance screening, positive clones were picked. After extracting the plasmid, agarose gel electrophoresis detection showed that the size of the target fragment was about 15000bp, which met the expectation. Then, PCR detection of the recombinant plasmid was carried out, and the fragment size was about 750bp, confirming the successful construction of the recombinant plasmid.

[0044] The correctly constructed AtERG1-D1-amiRNA and AtERG1-D2-amiRNA recombinant vectors were transformed into Agrobacterium cells, spread on plates, and positive clones were screened for use in transgenic Arabidopsis wild-type plants.

[0045] The harvested transgenic seeds were dried for 24 - 48h, placed in a lightless environment for after-ripening for about 15 days, and after seed disinfection treatment, they were screened on kanamycin-resistant plates. As Figure 4 shown, Figures A and B are the resistance screening of AtERG1-D1-amiRNA transgenic seedlings and AtERG1-D2-amiRNA transgenic seedlings of Arabidopsis thaliana respectively. Green seedlings can be seen among the yellow Arabidopsis thaliana seedlings in the figures, indicating that two types of transgenic plants were successfully screened.

[0046] (2) Expression level and phenotypic analysis of AtERG1 gene microRNA mutants

[0047] Semi - quantitative PCR and fluorescence quantitative PCR were used to detect the expression level of AtERG1 - amiRNA in transgenic plants. Four lines of gene - down - regulated mutant plants obtained by artificial microRNA technology were selected, namely AtERG1 - amiRNA1 - 2 and AtERG1 - amiRNA1 - 5 of the AtERG1 - D1 - amiRNA mutant, and AtERG1 - amiRNA2 - 5 and AtERG1 - amiRNA2 - 6 of the AtERG1 - D2 - amiRNA mutant. Compared with the wild - type Arabidopsis thaliana of the same period, the results are as Figure 5 shown: The expression level of the AtERG1 gene in the transgenic plants with gene down - regulation is relatively low, down to about 20%, that is, a decrease of 80%.

[0048] The wild - type Arabidopsis thaliana (WT) and the mutant plants AtERG1 - amiRNA1 - 2, AtERG1 - amiRNA1 - 5, AtERG1 - amiRNA2 - 5, AtERG1 - amiRNA2 - 6 with down - regulated AtERG1 gene, which were germinated and cultured under the same conditions and transplanted into nutrient soil for 12 days, were observed. As Figure 6 shown: Significantly different from the green wild - type, the down - regulated mutants all showed light yellow and slow growth. In addition, the seedling phenotypes of the mutant plants with down - regulated AtERG1 gene are as Figure 7 shown. Compared with the wild - type green plants, the mutant plants (25 days) showed short plants, and the plant tissues such as stems, leaves and pods were yellow - green. The phenotypic analysis of the mutant plants implies that the AtERG1 gene affects the growth and development of Arabidopsis thaliana plants.

[0049] Example 4 Obtaining and identification of Arabidopsis thaliana AtERG1 gene up - regulated mutant plants

[0050] (1) Construction of AtERG1 - TOPO - pGWB2 over - expression mutant

[0051] To study the genetic function of the AtERG1 gene, an AtERG1 - TOPO - pGWB2 over - expression mutant was constructed. According to the characteristics of the TOPO vector, the cloning primers containing CACC were designed as follows:

[0052]

[0053] Total RNA of Arabidopsis thaliana was extracted and reverse - transcribed into cDNA. Using the high - fidelity enzyme KOD kit, with Arabidopsis thaliana cDNA as the template, the AtERG1 gene was cloned.

[0054] Table 1 PCR Amplification Reaction System

[0055]

[0056] Set the reaction program of the PCR instrument as follows:

[0057]

[0058] Gel-purify the target fragment and ligate it to the TOPO vector. The reaction system is as follows:

[0059]

[0060] The product after the reaction is transformed into Escherichia coli DH5α competent cells. Positive clones are screened by resistance. After correct identification, the plasmid is extracted to complete the construction of the AtERG1-TOPO vector.

[0061] Using the LR reaction, recombine the AtERG1-TOPO vector and the plant expression vector pGWB2. The LR reaction system is as follows:

[0062]

[0063] The reaction solution is transferred into Escherichia coli competent cells for resistance screening. The constructed plasmid is called the AtERG1-pGWB2 plasmid.

[0064] Transform the AtERG1-pGWB2 vector into Agrobacterium cells for infecting wild-type Arabidopsis thaliana plants. Harvest the transgenic seeds, dry them for 24 - 48 h, place them in a lightless environment for after-ripening for about 15 days. After seed disinfection treatment, spread them on a kanamycin-resistant plate to screen transgenic seedlings. The obtained transgenic plants are named AtERG1-OE.

[0065] (2) Phenotypic Analysis of the AtERG1-TOPO-pGWB2 Overexpression Mutant

[0066] Use semi-quantitative PCR and fluorescence quantitative PCR to detect the transgenic plant AtERG1-OE and compare and analyze it with wild-type Arabidopsis thaliana of the same period. The results are as Figure 5 shown: The expression level of the overexpressed mutant plants increased by about 20%.

[0067] Observe wild-type Arabidopsis thaliana (WT) and overexpressed plants AtERG1-OE germinated and cultured under the same conditions and transplanted into nutrient soil for 12 days. As Figure 6 shown: The color of AtERG1-OE plants did not change significantly, grew well, and were slightly larger than wild-type plants.

[0068] Example 5 Downregulation of AtERG1 Mutations Affect the Function and Development of Arabidopsis Chloroplasts

[0069] (1)Downregulation of the AtERG1 gene affects the photosynthetic physiological functions of Arabidopsis thaliana

[0070] The Arabidopsis thaliana AtERG1 mutant plants showed a light yellow color, which might be related to the chlorophyll content. Therefore, the chlorophyll content of the plants was detected using the conventional spectrophotometry method. As Figure 8 shown, compared with the wild-type Arabidopsis thaliana, the total chlorophyll, chlorophyll a, and chlorophyll b contents in the leaves of the AtERG1 gene-downregulated mutant plants AtERG1-amiRNA1-2, AtERG1-amiRNA1-5, AtERG1-amiRNA2-5, and AtERG1-amiRNA2-6 all decreased significantly. The reduction in the chlorophyll content of the AtERG1-downregulated mutants was consistent with the light yellow phenotype of the downregulated mutant plants.

[0071] Furthermore, the effects of AtERG1 mutation on the photosynthesis of Arabidopsis thaliana were explored by measuring the chlorophyll fluorescence parameters. The results are as Figure 9 and 10 shown: Downregulation of the AtERG1 gene decreased the two parameters of the maximum photochemical efficiency (Fv / Fm) and electron transport rate (ETR), and increased the value of non-photochemical quenching (qN). The results of the chlorophyll fluorescence parameters imply that the AtERG1 gene mutation affects the photosynthetic physiological functions of Arabidopsis thaliana.

[0072] (2)Downregulation of the AtERG1 gene affects the chloroplast development of Arabidopsis thaliana

[0073] Since the leaves of the AtERG1 mutants showed a yellow phenotype, and the chlorophyll content and chlorophyll fluorescence parameters decreased, the transmission electron microscopy (TEM) technique was used to study the chloroplast development of the true leaves of 10-day-old Arabidopsis thaliana seedlings with AtERG1 mutation. As Figure 11 shown: The leaves of the wild type contained mature chloroplasts, and a complete double-membrane structure could be observed in the chloroplasts, as well as the internally stacked grana thylakoids and stroma thylakoids, with obvious thylakoid stacking, starch grains, and osmiophilic granules; the mutants showed blurred stroma lamellae, reduced numbers, and unclear demarcation, and the thylakoid stacks were ruptured, unable to form stacked grana thylakoids and stroma thylakoids, showing the absence of structures such as grana stroma thylakoids. These results indicate that AtERG1 plays a key role in the chloroplast development of Arabidopsis thaliana seedlings at the early stage.

[0074] To further study the effects of AtERG1 mutation on chloroplast development, the changes in the protein content encoded by Arabidopsis thaliana chloroplasts were detected using the conventional Western blotting method. The results are as Figure 11Shown as follows: The contents of ATP synthase subunit AtpB and PS II reaction center protein D1 in mutant plants are lower than those in wild-type plants. The results of Western blotting suggest that the AtERG1 mutation affects the contents of some chloroplast-encoded proteins, thereby affecting the development of Arabidopsis chloroplasts.

[0075] The above-disclosed are only the preferred embodiments of the present invention. Of course, the scope of the rights of the present invention cannot be limited thereby. Therefore, equivalent changes made according to the claims of the present invention still fall within the scope covered by the present invention.

Claims

1. Application of AtERG1 gene to regulate plant chloroplast development, characterized in that: The nucleotide sequence of the AtERG1 gene is shown in SEQ ID No.

1.

2. The use of the AtERG1 gene for regulating plant chloroplast development according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the AtERG1 gene is shown in SEQ ID No.

2.

3. The use of the AtERG1 gene for regulating plant chloroplast development according to claim 1, characterized in that: By down-regulating the AtERG1 gene, the plant exhibits a yellowing phenotype, slow growth, abnormal chloroplast development, abnormal thylakoid membrane development, reduced content of chloroplast-encoded photosynthetic proteins and / or decreased chlorophyll content.

4. The use of the AtERG1 gene for regulating plant chloroplast development according to claim 3, characterized in that: A plant expression vector for down-regulating the AtERG1 gene was constructed and transformed into wild-type plants using Agrobacterium-mediated transgenic plants. The transgenic plants showed yellowing phenotypes, slow growth, abnormal chloroplast development, abnormal thylakoid membrane development, reduced content of chloroplast-encoded photosynthetic proteins and / or decreased chlorophyll content.

5. The use of the AtERG1 gene for regulating plant chloroplast development according to claim 4, characterized in that: Artificial microRNA technology is used to construct a plant expression vector for down-regulating the AtERG1 gene. The target gene sequence of the microRNA of the AtERG1 gene is shown in SEQ ID No.3 or SEQ ID No.

4.

6. The use of the AtERG1 gene for regulating plant chloroplast development according to any one of claims 1 to 5, characterized in that: The plants are horticultural plants.

7. The use of the AtERG1 gene in regulating plant chloroplast development according to any one of claims 1 to 5, characterized in that: The plant is Arabidopsis thaliana.

Images