Indicator gene HpbHLH48 of pitaya VIGS system and application

By developing the new indicator gene HpbHLH48 of the Dragon Fruit VIGS system and constructing the TRV2-HpbHLH48 recombinant vector, the problem that the PDS gene in the prior art cannot be used as an indicator gene during the development period of the dragon fruit fruit in the dragon fruit is solved, and the gene silencing effect of keeping the green peel of the dragon fruit is achieved.

CN120060279AActive Publication Date: 2025-05-30GUIZHOU UNIV

Patent Information

Application Number
CN202510284859.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-11
Publication Date
2025-05-30
Estimated Expiration
2045-03-11

AI Technical Summary

Technical Problem

The existing PDS gene cannot be used as an indicator gene for the VIGS system during the development period of dragon fruit, because the accumulation of beet melanin covers the albinism.

Method used

A new indicator gene HpbHLH48 of the dragon fruit VIGS system was developed, and a TRV2-HpbHLH48 recombinant vector was constructed, which was injected into the dragon fruit peel. If the peel remains green, it indicates that the HpbHLH48 gene has been silenced.

Benefits of technology

The HpbHLH48 gene is effectively silent, and the beet pigment of the dragon fruit peel cannot be synthesized, so the peel remains green, proving that HpbHLH48 can be used as an effective indicator gene for the dragon fruit VIGS system.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060279A_ABST
    Figure CN120060279A_ABST
Patent Text Reader

Abstract

The invention discloses an indicator gene HpbHLH48 of a pitaya VIGS system and application of the indicator gene HpbHLH48, and belongs to the technical field of molecular biology. According to the invention, a TRV2-HpbHLH48 recombinant vector is constructed, and the TRV2-HpbHLH48 recombinant vector is applied to a pitaya fruit VIGS experiment. Results show that after the TRV1-TRV2 empty carrier is injected, the pitaya peel in the injection area only scabs, and the normal color is red; and after the TRV2-HpbHLH48 recombinant vector is injected, the pitaya peel in the injection area is kept green and does not turn color. Meanwhile, the expression level of the HpbHLH48 gene in the pitaya peel area injected with the TRV2-HpbHLH48 recombinant vector is obviously lower than that of a TRV1-TRV2 empty vector. Therefore, the HpbHLH48 can be used as an indicator gene of a pitaya VIGS system. Technical reserve is provided for functional verification of the pitaya fruit development gene in the future.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and particularly relates to a reporter gene for the VIGS system of pitaya HpbHLH48 and its application. Background Art

[0002] Virus-induced gene silencing (VIGS) is a method for studying plant gene functions, which has advantages such as a short cycle, simple operation, and low cost. The virus infection of the VIGS technology is local and time-limited. Therefore, it is very necessary to use a reporter gene to mark the silenced region and the time when silencing occurs. The phytoene desaturase gene ( PDS ), is a commonly used reporter gene, which is a key gene in the carotenoid synthesis pathway and has the function of protecting chlorophyll from photo-bleaching. When PDS the gene is silenced, its mRNA level is significantly reduced, resulting in the blockage of the carotenoid synthesis pathway, so that the newly emerged leaves of the infected plants show an albino effect, which can be directly observed with the naked eye. Therefore PDS the gene has been applied to the VIGS systems of various plants such as cotton, rice, Miscanthus sinensis, and loofah. However, with the development of pitaya fruits, betacyanin gradually accumulates in the pericarp and pulp as the fruits expand, and the formed red-purple color will cover PDS the albino phenomenon caused by silencing, making PDS the gene unable to be used as a reporter gene for the VIGS system during the fruit development period of pitaya. Therefore, it is necessary to develop a new reporter gene for the VIGS system of pitaya. Summary of the Invention

[0003] In order to solve the above-mentioned deficiencies existing in the prior art, the purpose of the present invention is to provide a reporter gene for the VIGS system of pitaya HpbHLH48 and its application, so as to provide a new reporter gene for the VIGS system of pitaya.

[0004] The technical solution of the present invention for solving the above technical problems is as follows: Provide a reporter gene for the VIGS system of pitaya HpbHLH48 , and the nucleotide sequence of the coding region of the reporter gene HpbHLH48 is shown in SEQ ID NO.1.

[0005] The present invention provides an application of the above-mentioned reporter gene HpbHLH48 in the preparation of the TRV2-HpbHLH48 recombinant vector.

[0006] The present invention provides a TRV2-HpbHLH48 recombinant vector, which comprises a TRV2 vector and the above-mentioned reporter geneHpbHLH48 。

[0007] The present invention provides a method for preparing the above-mentioned TRV2-HpbHLH48 recombinant vector, comprising the following steps: (1) Amplification HpbHLH48 The non-conserved fragment at the 3' end of the gene CDS: Using HpbHLH48-F and HpbHLH48-R as primers respectively, and using the HpbHLH48 coding region nucleotide sequence as a template for PCR amplification, and recovering and purifying the PCR product; (2) Select BamH I and Sac I restriction enzyme digestion sites to design primers, using the product obtained in step (1) as a template for PCR amplification, recovering and purifying the PCR product, and preparing a target fragment containing BamH I and Sac I these two restriction enzyme digestion sites; (3) Use BamH I and Sac I to digest the TRV2 vector, recover the digested product, and prepare a TRV2 digested fragment; then ligate the TRV2 digested fragment with the target fragment obtained in step (2) and transform Escherichia coli to obtain.

[0008] Furthermore, in step (1), the nucleotide sequence of the non-conserved fragment at the 3' end of the HpbHLH48 gene CDS is shown in SEQ ID NO.2.

[0009] Furthermore, in step (1), the nucleotide sequences of HpbHLH48-F and HpbHLH48-R are shown in SEQ ID NO.3 and SEQ ID NO.4 respectively.

[0010] Furthermore, in step (2), the primers are BamH I-F and Sac I-R, and their nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6 respectively.

[0011] Furthermore, in step (3), the digestion system is: 10 μL of TRV2, 1 μL of BamH I, 1 μL of Sac I, 1 μL of 5×K buffer, and 7 μL of double-distilled water; the ligation system is: 3 μL of the target fragment, 2 μL of the TRV2 double-digested fragment, and 5 μL of 2×Seamless cloning Master Mix.

[0012] The present invention also provides an application of the above-mentioned TRV2-HpbHLH48 recombinant vector in the VIGS injection of pitaya. If the pitaya peel remains green after injecting the TRV2-HpbHLH48 recombinant vector, it indicates that HpbHLH48 the gene has been silenced.

[0013] The present invention has the following beneficial effects: The present invention discovers that HpbHLH48 the gene is a related gene for the synthesis of betalains in pitaya, which can regulate the expression of the promoter of the key gene for betalain synthesis, and thus participate in the synthesis of betalains. The experiments of the present invention show that after injecting the TRV1-TRV2 empty vector (TRV: Tobacco Rattle Virus) into the pericarp of pitaya, only scabs appear in the area injected with the TRV1-TRV2 empty vector, and it normally turns red; while after injecting the TRV2-HpbHLH48 recombinant vector (pTRV2-HpbHLH48), the pericarp color of the injected area of pitaya remains green and no color change occurs. This shows that the betalain synthesis regulatory gene HpbHLH48 has been silenced, HpbHLH48 the inability of the gene to express results in the inability to synthesize betalains in the pericarp of pitaya, so the phenotype of the pericarp of pitaya is green. From Figure 3 it can be seen that the expression level of the HpbHLH48 gene in the pericarp area of pitaya injected with the TRV2-HpbHLH48 recombinant vector (pTRV2-HpbHLH48) is significantly lower than that in the pericarp area of pitaya injected with the TRV1-TRV2 empty vector (pTRV2), indicating that the indicator gene HpbHLH48 has been effectively silenced. The above results show that HpbHLH48 can be used as an indicator gene for the VIGS system of pitaya. The present invention also provides a technical reserve for the functional verification of genes related to the fruit development of pitaya in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 is a schematic diagram for constructing the TRV2-HpbHLH48 recombinant vector; Figure 2 is a phenotypic diagram of the silencing of the indicator gene HpbHLH48 ; Figure 3 is the expression level of the HpbHLH48 gene in the injected area of the pericarp of pitaya after injecting the TRV2-HpbHLH48 recombinant vector. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0015] The following examples are only used to explain the present invention and are not intended to limit the scope of the present invention. For those not specified in the examples, they are carried out according to the conventional conditions or the conditions recommended by the manufacturer. For the reagents or instruments not specified for the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0016] Example 1: Construction of the TRV2-HpbHLH48 Recombinant Vector (1)The HpbHLH48 gene was obtained from the pitaya RNA-seq database, and then the CDS sequence (SEQ ID NO.1) of the HpbHLH48 gene was analyzed using the NCBI online website (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi). The non-conserved sequence at the 3' end of the HpbHLH48 gene (SEQ ID NO.2) was selected for primer design, and PCR amplification was performed using the cDNA of "Zihonglong" pitaya fruit as a template. The target fragment was recovered, and the specific method was as follows: Using HpbHLH48-F and HpbHLH48-R as primers respectively, PCR amplification was performed with the cDNA of "Zihonglong" pitaya fruit as a template (RNA extraction was carried out according to the instructions of the E.Z.N.A.® Plant RNA Kit (Omega Bio-tek, USA)), and the first strand of cDNA was synthesized according to the reverse transcription kit (TaKaRa, Japan). The PCR product was subjected to agarose gel electrophoresis, and the HpbHLH48 DNA fragment was purified using a gel extraction kit (TaKaRa, Japan) according to the kit method. After detecting the concentration and purity using a full wavelength scanning microplate reader (MULTISKANA GO, THermo), it was used for ligation or stored at -20°C for later use.

[0017] Among them, the PCR reaction conditions were: 98°C for 5 min, 98°C for 10 s, 60°C for 10 s, 72°C for 10 s, 72°C for 5 min, and 35 cycles for steps 2 - 4; The reaction system was 10 μL: 1 μL of cDNA template, 1 μL each of the upstream and downstream primers (100 μM), 5 μL of high-fidelity Premix (TaKaRa, Japan), and 2 μL of double-distilled water; The nucleotide sequences of HpbHLH48-F and HpbHLH48-R are shown as follows: HpbHLH48-F: 5'-AGCTGCAGCTGAAAGCA-3' (SEQ ID NO.3); HpbHLH48-R: 5'-TGGGAGGTATCGAGCAC-3' (SEQ ID NO.4).

[0018] (2)Select BamH I and Sac I (TaKaRa, Japan) restriction enzyme digestion sites to design primers BamHI-F and SacI-R. Using the product obtained in step (1) as a template, PCR amplification was performed (the reaction system and reaction program were the same as in step (1)) to obtain a target fragment containing BamH I and Sac I these two restriction enzyme digestion sites. UsingBamH I and Sac I double-digested the TRV2 vector, gel-extracted the TRV2 digested fragment, then ligated the target fragment with the TRV2 digested fragment and transformed it into Escherichia coli DH5α competent cells (Beijing TransGen Biotech Co., Ltd.). After overnight culture at 37°C, positive clones were identified and sent to a Shanghai biological company for sequencing. After correct sequencing, the plasmid was extracted to obtain the TRV2-HpbHLH48 recombinant vector. The schematic diagram of vector construction is shown in Figure 1 .

[0019] Among them, the nucleotide sequences of primers BamHI-F and SacI-R are shown as follows: BamHI-F: 5’-AGAAGGCCTCCATGGGGATCCAGCTGCAGCTGAAAGCA-3’ (SEQ ID NO.5, containing BamH I restriction site); SacI-R: 5’-GGCCTCGAGACGCGTGAGCTCTGGGAGGTATCGAGCAC-3’ (SEQ ID NO.6, containing Sac I restriction site); The double-digestion system (20 μL) was: 10 μL of TRV2 plasmid, 1 μL of BamH I, 1 μL of Sac I, 1 μL of 5×K buffer, and 7 μL of double-distilled water; the digestion conditions were: 37°C, 4 h; The ligation system (10 μL) was: 3 μL of target fragment, 2 μL of TRV2 double-digested fragment, and 5 μL of 2×Seamlesscloning Master Mix (Shanghai Sangon Biotech); the ligation conditions were: 50°C, 30 min.

[0020] Example 2: VIGS injection of pitaya (1) Transformation of vector plasmid into Agrobacterium: 5 μL of TRV1, TRV2, and TRV2-HpbHLH48 plasmids were respectively added to 100 μL of GV3101 Agrobacterium competent cells. After placing on ice for 30 min, they were quickly frozen in liquid nitrogen for 5 min, then heat-shocked at 37°C for 5 min, and then placed on ice for 2 min. Finally, 800 μL of LB liquid medium without antibiotics was added, and they were shaken in a shaker at 28°C for 3 h. Then, 150 μL of the bacterial solution was evenly spread on LB solid medium (containing 20 mg / L Rif and 50 mg / L Kana), and after culturing at 28°C for 2 days, single colonies were picked for PCR identification, and then the bacteria were shaken and injected into the pericarp of the "Zihonglong" pitaya at the color-changing stage; (2)Preparation of pitaya: The pitaya is planted in Luodian County, Qiannan Bouyei and Miao Autonomous Prefecture, Guizhou Province, China, and is used for Agrobacterium injection when it is in the color-changing period; (3)VIGS injection of pitaya: Pick the successfully transformed monoclonal into 50 mL of LB liquid medium (containing 20 mg / L Rif and 50 mg / L Kana) and culture it overnight. Centrifuge to collect the bacteria, and resuspend the bacteria with the resuspension solution (500 mM MES, 1 M MgCl 2 and 100 mM As). After washing 3 times, adjust the OD 600 value of the bacterial solution to 1.0, then place the bacterial solution in an incubator at 28 °C for 3 hours, and inject it into the pericarp of the color-changing pitaya according to the volume ratio of TRV1:TRV2 = 1:1 and TRV1:TRV2-HpbHLH48 = 1:1 until it is appropriate to see the bacterial solution penetrate into the pericarp. Observe the phenotype and detect the gene expression level one week after injection. Among them, the nucleotide sequence of the primer for quantitative PCR detection is: HpbHLH48-q-F: 5’-TGTATAAGGGTCAAGGAAACAAG-3’ (SEQ ID NO.7); HpbHLH48-q-R: 5’-TCCACTGCCACATCGGGAAC-3’ (SEQ ID NO.8).

[0021] As Figure 2 can be seen, after injecting the pericarp of pitaya with the TRV1-TRV2 empty vector (pTRV2), only scabs appeared in the area injected with the TRV1-TRV2 empty vector, and no other phenotypes appeared in the pericarp of pitaya, and it still normally turned red; while after injecting the TRV2-HpbHLH48 recombinant vector (pTRV2-HpbHLH48), the color of the pericarp of the injected area remained green. This shows that the betalain synthesis regulatory gene HpbHLH48 has been silenced, and the inability of the HpbHLH48 gene to express results in the inability of the betalain in the pericarp of pitaya to be synthesized, so the pericarp of pitaya does not turn color and still remains green. As Figure 3 can be seen, the expression level of the HpbHLH48 gene in the pericarp area of the pitaya injected with the TRV2-HpbHLH48 recombinant vector (pTRV2-HpbHLH48) is significantly lower than that in the pericarp area of the pitaya injected with the TRV1-TRV2 empty vector (pTRV2), indicating that the indicator gene HpbHLH48 has been effectively silenced. The above results show that HpbHLH48 can be used as an indicator gene for the VIGS system of pitaya.

[0022] The nucleotide sequence of the coding region of the indicator gene HpbHLH48 in the present invention is shown as follows: ATGGACCCATTTCAGGTTGATGAGTACATCTGCTGGAATGGACTTGGTGATTATTACACTTCCTTCATGGATTTTGATGCCTCTGATTTATGCTGGACCTCCCCCACCCCCAGGGCAAGTGGAACACCTGGTATGTCTCTGACAAGCAATGTTTTCACAGAAAAAGGGATGAAAAGAGGGAGGGAGCAGAAGAGGAGTCCTCAATCAGAGTCCAAGGCTTGTAGAGAGAAGCTGCGAAGAGAGAAGATGAATGATAAGTTCTCGGAGTTGTGCCTGTTTCTGCATCCTGAAAGACCTGCTAAAGCTGATAAATCTACCGTCCTTGGTGACGCGATTTGTGCCTTAAACAACTTGCAGTCTGAGCTTCAAGAGCTAAAAGAGAAGAAGAGGAAGCTTCAAGATGACATTCAAAATCTAAAATCAGAGAAGAATAAGCTGAAGGAAGAGAAGCTGCAGCTGAAAGCAAGAAAAGAAAACATGGAAGCAGGGTTTGTGCCGGTACAACCAGCAGTGTATAAGGGTCAAGGAAACAAGTTGATGGCTTTTTCAGGGTATGGAGGGTTCCCGATGTGGCAGTGGAGCTCACCTGCAGTGCTCGATACCTCCCAAGATCACGTCCTCAGGCCGCCTGTTGCCTGA (SEQ ID NO.1).

[0023] The non-conserved nucleotide sequence at the 3' end of the coding region of the indicator gene HpbHLH48 in the present invention is as follows: AGCTGCAGCTGAAAGCAAGAAAAGAAAACATGGAAGCAGGGTTTGTGCCGGTACAACCAGCAGTGTATAAGGGTCAAGGAAACAAGTTGATGGCTTTTTCAGGGTATGGAGGGTTCCCGATGTGGCAGTGGAGCTCACCTGCAGTGCTCGATACCTCCCA (SEQ ID NO.2).

[0024] The above are only the preferred embodiments of the present invention, and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included in the protection scope of the present invention.

Claims

1. An indicator gene for the pitaya VIGS system HpbHLH48 , characterized in that, The indicator gene HpbHLH48 The nucleotide sequence of the coding region is shown in SEQ ID NO.

1.

2. The indicator gene according to claim 1 HpbHLH48 In the preparation of TRV2- HpbHLH48 Application in recombinant vectors.

3. A TRV2-HpbHLH48 recombinant vector, characterized in that: Comprising a TRV2 vector and the indicator gene of claim 1 HpbHLH48 .

4. The method for preparing the TRV2-HpbHLH48 recombinant vector according to claim 3, characterized in that: The following steps are involved: (1) Amplification HpbHLH48 The 3' non-conserved fragment of the gene CDS: HpbHLH48-F and HpbHLH48-R were used as primers, respectively. HpbHLH48 The coding region nucleotide fragment is used as a template for PCR amplification, and the PCR product is recovered and purified; (2) Selection Bm I and Sac I restriction enzyme cutting site design primers, use the product obtained in step (1) as a template for PCR amplification, recover and purify the PCR product, and obtain Bm I and Sac I: The target fragment of these two restriction sites; (3) Adoption Bm I and Sac I digests the TRV2 vector, recovers the digestion product, and obtains the TRV2 digestion fragment; then connects the TRV2 digestion fragment with the target fragment obtained in step (2) and transforms Escherichia coli to obtain.

5. The preparation method according to claim 4, characterized in that: As described in step (1) HpbHLH48 The nucleotide sequence of the 3'-end non-conservative fragment is shown in SEQ ID NO.

2.

6. The preparation method according to claim 4, characterized in that: The nucleotide sequences of HpbHLH48-F and HpbHLH48-R in step (1) are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

7. The preparation method according to claim 4, characterized in that: The primers in step (2) are BamHI-F and SacI-R, and their nucleotide sequences are shown in SEQ ID NO.5 and SEQ ID NO.6 respectively.

8. The preparation method according to claim 4, characterized in that: The enzyme digestion system in step (3) is: 10 μL TRV2, 1 μL Bm I. 1 μL Sac I. 1 μL 5×K buffer, 7 μL double distilled water; the ligation system is: 3 μL target fragment, 2 μL TRV2 enzyme-cut fragment, 5 μL 2×Seamless cloning Master Mix.

9. The TRV2-HpbHLH48 recombinant vector of claim 3 is used in pitaya VIGS injection, characterized in that: If the dragon fruit peel is green after injection of the TRV2-HpbHLH48 recombinant vector, it indicates HpbHLH48 The gene has been silenced.

Citation Information

Patent Citations

  • Screening method of reference genes in different developmental stages of pitaya fruits and application thereof

    CN109706260A

  • Gene HuDOPA for controlling synthesis of hylocereus undatus beet pigment

    CN113322262A

  • Hylocereus undatus ZxPDS gene VIGS silencing system as well as construction method and application thereof

    CN115927403A

Cited By

  • Pitaya U6 gene promoter and application thereof

    CN120905231A

  • A dragon fruit u6 gene promoter and application thereof

    CN120905231B