Prokaryotically expressed I group 8b type fowl adenovirus agar diffusion antigen as well as preparation method and application of prokaryotically expressed I group 8b type fowl adenovirus agar diffusion antigen

Abstract

The invention discloses a prokaryotically expressed I group 8b type fowl adenovirus agar diffusion antigen as well as a preparation method and application thereof, and belongs to the technical field of biological diagnosis. According to the invention, a primary antigen Fiber protein of I group 8b type aviadenovirus is expressed by prokaryotic expression, and the purified Fiber protein is used as an agar diffusion antigen to establish the agar diffusion detection method of the I group 8b type aviadenovirus antibody. Under the condition that FAdV-8b whole virus is used as the antigen in the early stage and different serotype antibodies cannot be distinguished, the expressed and purified Fiber protein is creatively used as the agar diffusion antigen, and an excellent effect is obtained.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological diagnosis, and specifically relates to a group I type 8b avian adenovirus agar gel immunodiffusion antigen expressed in prokaryotes, a preparation method thereof, and an application thereof. Background Art

[0002] Disclosing the information of this background art section is only intended to increase some understanding of the overall background of the present invention, and is not necessarily regarded as an admission or an implication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] Fowl adenovirus (FAdV) can cause a series of comprehensive symptoms, including inclusion body hepatitis, hydropericardium syndrome, gizzard erosion, etc., bringing huge economic losses to the poultry breeding industry in China. Fowl adenovirus belongs to the family Adenoviridae, genus Avadenovirus, and is a non-enveloped double-stranded DNA virus. According to antigenic differences, it can be divided into group I, group II, and group III. Among them, group I fowl adenovirus can be further divided into 12 serotypes (1-7, 8a, 8b, 9-11), and there is no cross-protection between serotypes. Serum type 8b avian adenovirus mainly causes inclusion body hepatitis in chickens, manifested as yellowing and brittleness of the liver. In severe cases, the liver ruptures and bleeds, resulting in a decline in the resistance of the chicken flock, making it easy to secondary infection with other pathogens and a decline in production performance. It is an important disease affecting the poultry industry in China. Summary of the Invention

[0004] Aiming at the deficiencies of the prior art, the present invention uses prokaryotic expression of the main antigen Fiber protein of group I type 8b avian adenovirus, and uses the purified Fiber protein as an agar gel immunodiffusion antigen to establish an agar gel immunodiffusion detection method for group I type 8b avian adenovirus antibodies.

[0005] The technical solution adopted by the present invention is as follows:

[0006] In the first aspect of the present invention, there is provided a gene encoding a group I type 8b avian adenovirus agar gel immunodiffusion antigen expressed in prokaryotes, and its nucleotide sequence is as shown in SEQ ID NO: 1.

[0007] In the second aspect of the present invention, there is provided a preparation method of a group I type 8b avian adenovirus agar gel immunodiffusion antigen expressed in prokaryotes, and the method includes the following steps:

[0008] (1) Optimization and synthesis of the target gene, and the optimized gene nucleotide sequence is as shown in SEQ ID NO: 1; (2) Primer design; (3) Amplification of the target gene; (4) Recovery and digestion of the target gene; (5) Digestion of the vector; (6) Cloning and sequencing of the target gene; (7) Expression of the target gene; (8) Purification and determination of the target protein.

[0009] In one or some embodiments of the present invention, in step (2), the primers include an upstream primer P1 and a downstream primer P2. An endonuclease HindⅢ site and protective bases are added to the 5'-end of the upstream primer P1, and an endonuclease NotI site and protective bases are added to the 5'-end of the downstream primer P2. The amplified fragment size is 1563bp, and the nucleotide sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3 respectively.

[0010] In the third aspect of the present invention, there is provided a prokaryotically expressed agar gel immunodiffusion antigen of group I avian adenovirus type 8b prepared by the above method.

[0011] In one or some embodiments of the present invention, the protein content of the agar gel immunodiffusion antigen is 0.5 - 0.75 mg / mL; preferably 0.75 mg / mL.

[0012] In the fourth aspect of the present invention, there is provided a prokaryotically expressed agar gel immunodiffusion antigen reagent of group I avian adenovirus type 8b, and this agar gel immunodiffusion antigen reagent is prepared by the following method:

[0013] (1) Antigen inactivation: Mix the above-mentioned agar gel immunodiffusion antigen and formaldehyde solution for inactivation to obtain an inactivated antigen;

[0014] (2) Preparation of freeze-drying protectant: Weigh sucrose, trehalose and skimmed milk powder, make up the volume to 100 ml with purified water, fully dissolve and then perform sterilization treatment to obtain a freeze-drying protectant;

[0015] (3) Mix the inactivated antigen and the freeze-drying protectant according to a set ratio, and after freeze-drying, obtain a prokaryotically expressed agar gel immunodiffusion antigen reagent of group I avian adenovirus type 8b.

[0016] In one or some embodiments of the present invention, the specific steps of antigen inactivation: Add a formaldehyde solution with a final concentration of 0.8 - 1.2‰ to the agar gel immunodiffusion antigen with a concentration of 0.5 - 0.75 mg / mL, and place it in a shaker at 35 - 40 °C and 100 - 150 rpm for 18 - 36 h for inactivation.

[0017] In one or some embodiments of the present invention, in step (2), to ensure the stability of the antigen, the feeding ratio of sucrose, trehalose and skimmed milk powder is 12.5:3:5. The preferred example is 12.5 g of sucrose, 3 g of trehalose and 5 g of skimmed milk powder, and make up the volume to 100 ml with purified water.

[0018] In one or some embodiments of the present invention, in step (3), to ensure the stability of the antigen, the ratio of the inactivated antigen to the freeze-drying protectant is 1.5 ml:0.5 mL. The preferred example is: Each vial of freeze-dried agar gel immunodiffusion antigen contains 1.5 ml of inactivated antigen and 0.5 ml of freeze-drying protectant.

[0019] In the fourth aspect of the present invention, there is provided an AGP detection method established with a prokaryotic-expressed group I avian adenovirus type 8b agar diffusion antigen, and the method includes the following steps:

[0020] The group I avian adenovirus type 8b agar diffusion antigen reagent is fully dissolved with PBS, and the dissolved antigen reagent is added to the middle well of the agarose plate, and the serially diluted samples to be tested are added to the surrounding wells in turn, placed in a wet box, and placed in an incubator for 24 - 36 h, and then the results are observed.

[0021] Compared with the related technologies known to the inventors of the present invention, one of the technical solutions of the present invention has the following beneficial effects:

[0022] The present invention has artificially optimized the Fiber protein sequence of serotype 8b group I avian adenovirus, achieving soluble and highly efficient expression. Initially, the inventors directly amplified the Fiber-2 gene from group I avian adenovirus type 8b for expression, but most of the expressed proteins were in the form of insoluble inclusion bodies and could not be directly used for the AGP test. Later, the Fiber-2 protein sequence of serotype I group 8b avian adenovirus was artificially optimized, and finally the gene sequence shown in SEQ ID NO: 1 was selected, achieving soluble and highly efficient expression, and successfully establishing an AGP detection method; the Fiber-2 protein sequences of other optimized group I avian adenovirus type 8b have been experimentally verified to have low expression levels and / or low solubility, and an AGP detection method could not be successfully established.

[0023] Currently, the antigens used in the agar gel diffusion test (AGP) for animal diseases are all whole viruses or whole bacteria, and there is no report of using expressed proteins as AGP antigens. In the early stage of the present invention, when using the FAdV-8b whole virus as an antigen and being unable to distinguish antibodies of different serotypes, the present invention pioneered the use of the expressed and purified Fiber protein as an agar diffusion antigen and achieved excellent results.

[0024] The prokaryotic-expressed group I avian adenovirus type 8b agar diffusion antigen reagent of the present invention has excellent stability, can be stored at 4 °C for 12 months, and can be stored at -18 °C for 24 months. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] The specification drawings forming a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation to the present invention.

[0026] Figure 1 It is the SDS-PAGE electrophoresis diagram of the prokaryotic-expressed group I avian adenovirus type 8b Fiber protein of the present invention; wherein, M is the protein Marker, 1 is the supernatant after disruption of the expression product, and 2 is the precipitate after disruption of the expression product;

[0027] Figure 2The agar diffusion result of the positive serum for detecting the agar diffusion antigen of group I avian adenovirus type 8b with a concentration of 1 mg / mL according to the present invention;

[0028] Figure 3 The agar diffusion result of the positive serum for detecting the agar diffusion antigen of group I avian adenovirus type 8b with a concentration of 0.75 mg / mL according to the present invention;

[0029] Figure 4 The agar diffusion result of the positive serum for detecting the agar diffusion antigen of group I avian adenovirus type 8b with a concentration of 0.5 mg / mL according to the present invention;

[0030] Figure 5 The agar diffusion result of the positive serum for detecting the agar diffusion antigen of group I avian adenovirus type 8b with a concentration of 0.25 mg / mL according to the present invention. Detailed implementation manners

[0031] It should be noted that the following detailed description is exemplary and is intended to provide further illustration of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which the present invention belongs.

[0032] It should be noted that the terms used herein are only for describing specific implementation manners and are not intended to limit the exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular forms are also intended to include the plural forms. In addition, it should be understood that when the terms "comprise" and / or "include" are used in this specification, they specify the presence of features, steps, operations, and / or combinations thereof.

[0033] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0034] Example 1 Preparation method of prokaryotic-expressed group I avian adenovirus type 8b agar diffusion antigen

[0035] 1. Optimization and synthesis of target gene

[0036] Download the Fiber gene sequence of group I avian adenovirus type 8b (FAdV-8b) from NCBI, optimize the Fiber gene according to the codon preference of Escherichia coli and the tendency of protein soluble expression, and send it to a gene company for artificial synthesis.

[0037] 2. Primer design

[0038] According to the optimized Fiber gene sequence (shown in SEQ ID NO: 1), a pair of amplification primers was designed. An endonuclease HindⅢ site and protective bases were added to the 5' end of the upstream primer P1, and an endonuclease NotI site and protective bases were added to the 5' end of the downstream primer P2. The size of the amplified fragment is 1563 bp, and the sequence is as follows:

[0039] P1: 5'-GTCAAAGCTTATGGCAACCTCTACCCCG-3' (shown in SEQ ID NO: 2) P2: 5'-TTGTGCGGCCGCTGGCGCGTTAGCAGTAGAC-3' (shown in SEQ ID NO: 3)

[0040] SEQ ID NO: 1 sequence:

[0041] ATGGCAACCTCTACCCCGCACGCTTTCAGCTTTGGTCAAATTGGCTCTCGTAAACGTCCGGCTGGCG

[0042] GTGATGGTGAACGCGACGCATCTAAGGTTCCGAAAATGCAGACGCCGGCCCCGTCCGCGACTGCTA

[0043] ACGGTAACGACGAACTGGATCTGGTCTATCCGTTCTGGCTGCAGAATGGTTCTACCGGTGGTGGCGG

[0044] TGGTGGTTCTGGTGGCAACCCGAGCCTGAACCCGCCGTTTCTGGATCCGAACGGTCCACTGGCTGTG

[0045] CAGAACTCTCTGCTGAAGGTCAATACCGCTGCGCCGATCACCGTAACCAACAAGGCGCTGACTCTGG

[0046] CGTATGAACCGGAGAGCCTGGAACTGACCAACCAACAGCAGCTGGCCGTAAAAATCGACCCGGAAG

[0047] GTCCGCTGAAGGCCACCACCGAAGGTATTCAACTGTCTGTGGACCCGACCACTCTGGAAGTCGACG

[0048] ATGTTGACTGGGAACTGACCGTGAAACTGGACCCAGACGGTCCGCTGGATTCTTCCGCAGCGGGTAT

[0049] CACCGTGCGTGTCGACGAAACCCTGCTGATTGAAGACGACGTGTCCGGTCAGGGTAAAGAACTGGG

[0050] CGTTAACCTGAACCCGGCAGGTCCAATCACCGCAGATGAACAGGGTCTGGATCTGGAGATCGACAA

[0051] TCAGACCCTGAAAGTCAACTCTGTTACTGGTGGTGGCGTTCTGGCGGTCCAGCTGAAATCTCAGGGT

[0052] GGCCTGACCGTGCAGACCGATGGTATCCAGGTGAACACCCAGAACAGCATTACGGTGACCAATGGT

[0053] GCGCTGGATGTTAAGGTCGCGGCCAACGGTCCGCTGGAATCTACCGACACTGGTCTGACTCTGAACT

[0054] ATGATCCGGGCGATTTTACCGTGAATGCTGGCACCCTGTCCATTATTCGTGATCCGGCTCTGGTGGCC

[0055] AACGCGTACCTGACCTCTGGTGCCAGCACGCTGCAGCAGTTCACCGCTAAATCCGAAAACTCTTCTC

[0056] AGTTCAGCTTCCCGTGCGCTTACTACCTGCAGCAGTGGCTGTCCGATGGCCTGATTGTTTCCTCCCTG

[0057] TATCTGAAACTGGACCGTGCACAATTCACCAACATGCCGACCGGCGCGAACTACCAGAACGCTCGTT

[0058] ATTTCACCTTCTGGGTTGGTGCTGGCACGTCTTTTAACCTGAGCGCTCTGACCGCACCGACCATTACC

[0059] CCGAACACTACTCAGTGGAACGCTTTCGCGCCGGCGCTGGATTACAGCGGTGCCCCGCCATTCATCT

[0060] ACGATGCGAGCTCCGTAGTTACCATTTATTTCGAACCGACCTCTGGTCGTCTGGAGTCTTACCTGCCG

[0061] GTACTGACCGATAACTGGAGCCAGACCTACAACCCGGGCACCGTGACGCTGTGCGTCAAAACTGTA

[0062] CGTGTTCAACTGCGCTCCCAGGGTACTTTCTCCACCCTGGTTTGTTATAACTTTCGCTGCCAGAACAC

[0063] CGGCATCTTCAACAACAACGCAACTGCGGGTACCATGACCCTGGGCCCGATCTTCTTCTCTTGCCCA

[0064] GCACTGTCTACTGCTAACGCGCCA

[0065] 3. Amplification of the target gene

[0066] Using the synthesized Fiber gene as a template, perform the following PCR reaction with a high-fidelity enzyme.

[0067] The reaction system (50 μL) includes: ddH 2 O 34 μL, 5×PCR buffer 10 μL, 10 mM dNTP 1 μL, 1 μL each of 10 pmol / μL primers P1 / P2, 1 μL of Super-Fidelity DNA Polymerase, and 2 μL of sample nucleic acid.

[0068] The reaction program is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 20 sec, annealing at 55°C for 20 sec, extension at 72°C for 40 sec, for a total of 30 cycles; extension at 72°C for 5 min.

[0069] 4. Recovery and digestion of the target gene

[0070] The amplified PCR products were subjected to 1.2% agarose gel electrophoresis. The agarose gel was prepared as follows: Weigh 0.72 g of agarose and place it in an Erlenmeyer flask. Add 60 mL of TAE electrophoresis buffer, mix well, and melt it in a microwave oven. After slightly cooling, add 3 μL of nucleic acid dye, mix well, and pour the gel. After the gel has cooled and solidified, add the PCR products and the standard molecular weight 2000 DNA Marker to the sample wells in sequence, place it in the electrophoresis tank, and perform electrophoresis at 120 V for 25 min. After observing the separation with a UV analyzer, excise the target fragment and recover and purify it using a DNA gel recovery kit.

[0071] The recovered and purified target gene was double-digested with restriction enzymes HindⅢ and NotI. The reaction system and reaction program are as follows:

[0072] The reaction system (50 μL) includes: 5 μL of 10×buffer H, 5 μL of 0.1% BSA, 1 μL of HindⅢ, 1 μL of NotI, 20 μL of the target gene, ddH 2 O 18 μL.

[0073] The reaction program is: Incubate in a water bath at 37°C for 3 h.

[0074] 5. Vector digestion

[0075] Streak the PET-32a plasmid bacteria on a solid LB medium containing 1‰ ampicillin (50 mg / mL), and incubate overnight at 37°C. Pick a single colony and inoculate it into a liquid LB medium containing 1‰ ampicillin (50 mg / mL), and incubate overnight at 37°C in a shaker at 160 rpm. Extract the plasmid from the bacterial solution according to the plasmid extraction kit instructions. Double-digest it with restriction enzymes HindⅢ and NotI. The reaction system and reaction program are as follows:

[0076] The reaction system (50 μL) includes: 5 μL of 10×buffer H, 5 μL of 0.1% BSA, 1 μL of HindⅢ, 1 μL of NotI, 20 μL of the PET-32a vector, ddH 2 O 18 μL.

[0077] The reaction program is: Incubate in a water bath at 37°C for 3 h.

[0078] 6. Target gene cloning and sequencing

[0079] 6.1 Ligation

[0080] Ligate the above double-digested target gene and PET-32a vector. The ligation system and program are as follows:

[0081] The reaction system (10 μL) includes: 1 μL of 10×T4 DNA ligase buffer, 0.5 μL of the double-digested vector, 4 μL of the double-digested target gene, 0.5 μL of T4 DNA ligase, and 4 μL of ddH 2 O 4 μL.

[0082] The reaction procedure is: ligate overnight at 16°C.

[0083] 6.2 Transformation

[0084] Take 5 μL of the ligation product and add it to DH5α competent cells. After ice-bathing for 20 - 30 min, heat-shock at 42°C for 45 sec, immediately ice-bathe for 2 min, add 1 mL of LB medium, place it in an oscillating incubator, and incubate at 37°C and 180 rpm for 1 h. Take 100 μL and spread it evenly on an LB plate containing 1‰ ampicillin (50 mg / mL). Incubate in a 37°C incubator for 16 - 18 h, and pick a single colony into a PCR tube containing 10 μL of sterile normal saline.

[0085] 6.3 Identification and Sequencing

[0086] Using the single colony picked above as a template, perform amplification and identification with the corresponding primers.

[0087] The reaction system (20 μL) includes: 10 μL of 2×PCR Mix, 1 μL each of 10 pmol / μL primers P1 / P2, 1 μL of the bacterial solution, and 7 μL of ddH 2 O 7 μL.

[0088] The reaction procedure is: pre-denature at 95°C for 5 min; denature at 94°C for 30 sec, anneal at 55°C for 30 sec, extend at 72°C for 1 min, for a total of 30 cycles; extend at 72°C for 5 min.

[0089] After the PCR reaction is completed, add the product to a 1.2% agarose gel for nucleic acid electrophoresis. Expand and culture the positively identified colonies, then extract the plasmids and send them to a sequencing company for sequencing.

[0090] 7. Expression of the Target Gene

[0091] The correctly sequenced plasmid was transformed into the expression host bacteria BL21 (DE3), and a single colony was picked and placed in liquid LB containing 1‰ ampicillin (50mg / mL) for shaking culture. When the OD600 value of the bacterial solution reached 0.6-0.8, ITPG (1mmol / mL) inducer was added at a dose of 1‰, and the expression was induced at 30°C and 120rpm for 5h. The expressed bacterial solution was centrifuged at 8000rpm for 5min, and the precipitate was resuspended with an appropriate amount of PBS and crushed with an ultrasonic crusher, then centrifuged at 8000rpm for 5min, and the supernatant and precipitate were subjected to SDS-PAGE electrophoresis respectively. The results showed that about half of the target protein was expressed in the supernatant, about 75kDa, and the size was correct. Figure 1 .

[0092] 8. Purification and content determination of target protein

[0093] The expressed protein supernatant was purified using a His-tag protein purification kit, and the protein content was detected.

[0094] 9. Protein agar expansion test at different concentrations

[0095] The purified target protein was diluted to 1 mg / mL, 0.75 mg / mL, 0.5 mg / mL and 0.25 mg / mL, respectively, and formaldehyde solution with a final concentration of 1‰ was added, and the mixture was inactivated for 24 hours in a shaker at 37°C and 120 rpm. FAdV-8b positive serum was determined by agar diffusion method, 25 μL / well. Results: When the target protein was 0.75 mg / mL and 0.5 mg / mL, the agar diffusion titer, precipitation line position and clarity were the best. Considering the antigen titer degradation factor, 0.75 mg / mL was selected as the agar diffusion test concentration. Figure 2 , Figure 3 , Figure 4 and Figure 5 .

[0096] 10. Specificity test

[0097] The expressed FAdV-8b agar antigen was used to measure the positive sera of common avian adenoviruses such as FAdV-1, FAdV-4, FAdV-8a, FAdV-8b and FAdV-11. The results showed that only the FAdV-8b positive serum had a precipitation line, while the other sera had no precipitation line.

[0098] 11. Preparation of FAdV-8b agar antigen

[0099] 11.1 Antigen inactivation: Add formaldehyde solution with a final concentration of 1‰ to the expressed and purified serum type 8b fiber protein with a concentration of 0.75 mg / mL, and place it in a shaker at 37°C and 120 rpm for 24 hours for inactivation.

[0100] 11.2 Preparation of lyophilization protectant: Weigh 12.5 g of sucrose, 3 g of trehalose, and 5 g of skim milk powder, and make up to 100 mL with purified water. After complete dissolution, autoclave at 121 °C for 20 min and set aside.

[0101] 11.3 Lyophilization: Mix each vial of lyophilized AGP antigen with the lyophilization protectant at a feeding ratio of 1.5 mL of antigen to 0.5 mL of protectant, and then carry out lyophilization.

[0102] 12. Determination of the shelf life of FAdV-8b AGP antigen

[0103] Store the lyophilized antigen at 4 °C and -18 °C respectively. Take out the antigen at the 3rd month, 6th month, 12th month, 18th month, 24th month, and 30th month after storage respectively, and perform AGP detection on the positive serum. Results: For the antigen stored at 4 °C, the titer of the positive serum was consistent with that before storage during the detection at the 3rd month, 6th month, and 12th month, and the titer decreased by one dilution during the detection at the 18th month. For the antigen stored at -18 °C, the titer of the positive serum was consistent with that before storage during the detection at the 3rd month, 6th month, 12th month, 18th month, and 24th month, and the titer decreased by one dilution during the detection at the 30th month.

[0104] Example 2 AGP detection method for group I avian adenovirus type 8b

[0105] The specific steps of this example are as follows:

[0106] Prepare a 1% agarose gel (1 g of agarose: 100 ml of PBS) with a phosphate buffer solution (PBS) at a concentration of 0.01 mol / L and a pH value of 7.4. After melting, pour it onto a plate to prepare an agarose plate with an agarose gel thickness between 5 - 6 mm. Punch holes with a seven-hole plum blossom puncher; Dilute each vial of lyophilized AGP antigen with 1.5 mL of PBS, take 25 μL and add it to the middle hole of the seven holes, perform serial dilution on the antibody to be tested, and take 25 μL of each dilution and add it to the surrounding 6 holes in turn. Place the AGP plate in a warm box and react in an incubator at 37 °C for 24 - 36 h, then read the AGP antibody titer. The presence of a precipitation line is judged as antibody positive, and the absence of a precipitation line is judged as antibody negative.

[0107] Example 3 Application and comparison of the AGP detection method for group I avian adenovirus type 8b

[0108] In this embodiment, a total of 110 chicken sera from five chicken farms diagnosed with FAdV-8b infection and 20 chicken sera from two healthy chicken farms were collected clinically. The detection methods in Example 2 and the classical chicken embryo neutralization test method were used for detection respectively. Results: The results of both detection methods for the 20 sera from the healthy chicken farms were negative. Among the 110 sera infected with FAdV-8b, 81 were positive by the detection method in Example 2, with a positive rate of 73.6%; 85 were positive by the chicken embryo neutralization test, with a positive rate of 77.3%. Comparing the two methods, the chicken embryo neutralization test method is slightly more sensitive, but the detection method in Example 2 takes less time, has lower costs, is more convenient to operate, and has lower instrument requirements. Therefore, it has more advantages than the classical chicken embryo neutralization test method and is especially suitable for use in grass-roots laboratories.

[0109] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A gene encoding a prokaryotically expressed avian adenovirus group I type 8b adenovirus antigen, characterized in that: The nucleotide sequence thereof is shown in SEQ ID NO:

1.

2. A method for preparing a prokaryotically expressed avian adenovirus group I type 8b adenovirus antigen, characterized in that: The method comprises the following steps: (1) Optimization and synthesis of the target gene. The nucleotide sequence of the optimized target gene is shown in SEQ ID NO: 1; (2) Primer design; (3) Target gene amplification; (4) Target gene recovery and enzyme digestion; (5) Vector enzyme digestion; (6) Target gene cloning and sequencing; (7) Target gene expression; (8) Target protein purification and determination.

3. The method for preparing the prokaryotically expressed group I type 8b avian adenovirus agar antigen according to claim 2, characterized in that: In step (2), the primers include an upstream primer P1 and a downstream primer P2. The 5' end of the upstream primer P1 is added with an endonuclease HindⅢ site and a protective base, and the 5' end of the downstream primer P2 is added with an endonuclease NotI site and a protective base. The size of the amplified fragment is 1563 bp, and the nucleotide sequences are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

4. A prokaryotically expressed group I type 8b avian adenovirus agar antigen prepared by the method of claim 2 or 3.

5. A prokaryotically expressed avian adenovirus group I type 8b agar antigen reagent, characterized in that: The agar expansion antigen reagent is prepared by the following method: (1) Antigen inactivation: mixing the agar-expanded antigen and formaldehyde solution to inactivate the antigen to obtain an inactivated antigen; (2) Preparation of lyophilized protective agent: Weigh sucrose, trehalose and skimmed milk powder, add purified water to make up to 100 ml, fully dissolve and sterilize to obtain lyophilized protective agent; (3) The inactivated antigen and the lyophilization protective agent are mixed according to a set ratio, and after lyophilization, a prokaryotic expressed group I type 8b avian adenovirus agar amplification antigen reagent is obtained.

6. The prokaryotically expressed avian adenovirus group I type 8b agar antigen reagent as claimed in claim 5, characterized in that: The specific steps of antigen inactivation are as follows: add formaldehyde solution with a final concentration of 0.8-1.2‰ to agar antigen with a concentration of 0.5-0.75 mg / mL, and place in a shaker at 35-40°C and 100-150 rpm for 18-36 hours for inactivation.

7. The prokaryotically expressed avian adenovirus group I type 8b agar antigen reagent according to claim 5, characterized in that: In step (2), the feed ratio of sucrose, trehalose and skimmed milk powder is 12.5:3:

5.

8. The prokaryotically expressed group I type 8b avian adenovirus agar antigen reagent according to claim 5, characterized in that: In step (3), the ratio of inactivated antigen to lyophilized protective agent is 1.5 ml:0.5 mL.

9. A method for detecting AGP using a prokaryotically expressed adenovirus group I type 8b adenovirus agar antigen, characterized in that: The method comprises the following steps: The group I type 8b avian adenovirus agar antigen reagent according to any one of claims 5 to 8 is fully dissolved with PBS, the dissolved antigen reagent is added to the middle well, and the test samples diluted in multiples are added to the surrounding wells in sequence, placed in a wet box, and placed in an incubator for 24 to 36 hours before observing the results.

Images