Two citrus geranyl geranyl diphosphate synthetase coding genes and application thereof
By cloning and verifying the GGPP synthetase gene from citrus and regulating its expression through RNAi technology, the problem of insufficient synthesis flux of terpene precursor substances in citrus is solved, significantly reducing the content of carotenoids, and providing technical support for increasing the yield of citrus terpenes.
Patent Information
- Application Number
- CN202510235485.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-28
- Publication Date
- 2025-05-30
AI Technical Summary
The lack of effective research and verification of the GGPP synthetase gene in citrus in the prior art has led to insufficient synthesis flux of terpene precursor substances in citrus, affecting the yield of terpene substances.
CsGGPPS1 and CsGGPPS2 genes were cloned from Lunwan navel orange, and expressed in E. coli by constructing a recombinant vector, their enzyme activity was verified, and their localization in the plastid was determined by citrus protoplast subcellular localization. The content of carotenoids was further determined by RNAi technology to interfere with the expression of CsGGPPS2 gene in citrus callus.
The gene of GGPP synthetase in citrus was successfully cloned and verified, indicating that CsGGPPS2 plays an important role in the biosynthesis of carotenoids in citrus. It significantly reduces the content of carotenoids by interfering with its expression, providing technical support for increasing the yield of citrus terpenes.
Smart Images

Figure CN120060296A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering and relates to the coding genes of the precursor substances for the biosynthesis of citrus terpenoids. Background Art
[0002] Terpenoids are a class of plant secondary metabolites with the most reported functions and the most diverse structures so far, and are widely involved in the growth and development processes of plants such as photosynthesis, respiration, stress response, and information exchange. At present, the structures and chemical characteristics of more than 80,000 terpenoid members have been determined (Chen et al., 2011; Zhou et al., 2020). All currently known terpenoids are derived from the same five-carbon (C 5 ), initial precursor, isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate (DMAPP). The further combination of the two can form geranyl pyrophosphate (GPP) with a C 10 structure, farnesyl pyrophosphate (FPP) with a C 15 structure, and geranylgeranyl pyrophosphate (GGPP) with a C 20 structure (Barja et al., 2021), which become the direct precursors for the synthesis of terpenoids with different chain lengths in plants. These direct precursors are catalyzed by enzyme proteins encoded by the trans-isoprenyl transferase (TPTs) gene family such as GPP synthase, FPP synthase, and GGPP synthase.
[0003] GGPP is a common precursor substance for multiple terpenoid metabolic pathways in plants. As the hub of terpenoid metabolism in plants, it participates in important metabolic processes of plants and plays an irreplaceable role. Carotenoids, chlorophyll, tocopherols, plastoquinones, etc. (Hemmerlin et al., 2012) absorb and transfer light energy in plants and participate in photosynthesis; various hormones in plants such as abscisic acid and gibberellin (Jiang et al., 2018) widely regulate the growth, development, and differentiation of plants. In particular, strigolactones isolated from plant roots in recent years, which are derived from the cleavage of carotenoids, are a type of plant hormone that regulates multiple growth and development processes (Alder et al., 2012).
[0004] Many substances derived from GGPP have been applied to human life and production due to their unique biological activities and various colors, possessing great economic value. The diterpenoid substance triptolide can inhibit tumors, ginkgolide can inhibit platelet activation, and tanshinone has good antibacterial and anti-inflammatory effects (Yixuan et al., 2019). In particular, paclitaxel, discovered in recent years, has been applied to the treatment of diseases such as breast cancer, ovarian cancer, and lung cancer, becoming one of the most prominent anti-cancer drugs (Yang et al., 2024). The conjugated double bonds contained in the molecular structure of the tetraterpenoid carotenoids make them rich in colors and are used by humans as important natural pigments; the essential vitamin A for the human body mainly comes from carotenoids. Lack of vitamin A will hinder human development, while lutein and zeaxanthin are beneficial to the health of the retina (Maoka et al., 2020).
[0005] Citrus fruits are rich in volatile and non-volatile terpene substances. In particular, the carotenoids rich in citrus fruits provide an important dietary source of vitamin A for the human body (Zhang et al., 2024). A large number of monoterpene and sesquiterpene substances also make it an important raw material for perfumes and fragrances. The metabolic pathway of carotenoids in citrus has long been widely studied, and most of the important structural genes have been identified (Kato et al., 2004). Currently, the research on the metabolic pathway of carotenoids in citrus mainly focuses on transcriptional regulation. Transcription factor modules such as CsERF110-CsERF53 (Sun et al., 2024), CsbZIP44-CsHB5 (Sun et al., 2024), etc. positively regulate carotenoid biosynthesis under ABA signaling, CrMYB68 inhibits the conversion of α- and β-carotenes and the biosynthesis of ABA (Zhu et al., 2017). The transcription factor CsMADS3 activates SGR , PSY1 , LCYb2 the promoters of structural genes, accelerating chlorophyll degradation, promoting the accumulation of ABA and carotenoids, and negatively affecting the synthesis of GA. ABA and GA, as plant hormones, further feedback regulate the terpene pathway, ultimately regulating citrus fruit ripening (Zhu et al., 2023).
[0006] Generally, plant genomes contain multiple genes encoding geranylgeranyl diphosphate synthase (GGPPS), but the enzyme activities and biological functions may vary. However, there are still few reports on studying the regulation of the carotenoid metabolic pathway by taking GGPPS as the entry point, and the key genes for synthesizing GGPP in citrus have not been verified. Searching for the key genes for synthesizing terpene precursors in citrus and increasing the metabolic flux of terpenoids have important reference significance for the directional breeding of citrus, and at the same time provide new insights for improving the synthesis of monoterpenoids, diterpenoids, and tetraterpenoids through genetic engineering. Summary of the Invention
[0007] The object of the present invention is to provide a gene capable of synthesizing geranylgeranyl diphosphate, namely the GGPP synthase gene.
[0008] To achieve the above objectives, the technical solution applied in the present invention is as follows: Two Citrus sinensis genes were cloned from 'Lanelate navel orange', CsGGPPS, and their nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2, with lengths of 1095 bp and 1083 bp respectively; their amino acids are shown in SEQ ID NO.3 and SEQ ID NO.4. The relative expression levels of the two CsGGPPS genes in citrus vary greatly, indicating that their functions in citrus may be different.
[0009] These two CsGGPPS genes were constructed into the Escherichia coli prokaryotic system. Through the experiment of adding substrates, the recombinant proteins produced GGPP products; through the subcellular localization of citrus protoplasts, it was found that both of these two genes were localized in plastids.
[0010] The present invention provides geranylgeranyl diphosphate synthase and its encoding gene derived from citrus. For the key gene CsGGPPS2 among them, stable genetic transformation was carried out in citrus. Using the pHellsgate8 vector, RNA interference (RNAi) was performed in citrus callus (Red Marsh grapefruit, RM33). The carotenoid content of transgenic citrus callus lines was measured by HPLC (High Performance Liquid Chromatograph), and it was found that the total carotenoid content in transgenic citrus callus lines decreased significantly. The two CsGGPPS provided in this study are important rate-limiting enzymes in the terpene synthesis pathway, providing substrates for the biosynthesis of carotenoids in citrus, and among them CsGGPPS2 is the key gene for synthesizing geranylgeranyl diphosphate. The present invention provides important technical support for improving the yield of terpene substances in citrus through genetic engineering.
[0011] The present invention also provides two CsGGPPSThe derived recombinant expression vectors, recombinant bacteria, transgenic plants or plant callus are also within the scope of protection of this patent.
[0012] The present invention further provides a method for in vitro synthesis of geranylgeranyl diphosphate (GGPP), comprising the following steps: a) Cloning the said CsGGPPS gene into a prokaryotic expression vector; b) Transforming the recombinant vector into Escherichia coli and inducing the expression of recombinant protein; c) In a reaction system containing isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP), using the purified recombinant protein to catalyze the generation of GGPP.
[0013] The present invention also provides a method for regulating terpene metabolism in plants, that is, by regulating the CsGGPPS expression level of the gene to change the accumulation amount of carotenoids in plants.
[0014] For more detailed technical solutions, please refer to the specific examples. Description of the Drawings
[0015] Figure 1 : Analysis of the conserved domains of the amino acid sequences of CsGGPPS1 and CsGGPPS2. Note: CXXXC and DDXXD are the conserved domains reported in the TPTs gene family.
[0016] Figure 2 : CsGGPPS1 , CsGGPPS2 Phylogenetic tree clustering analysis. Note: The reference sequences of other species used in the phylogenetic tree are all from the reported articles (Song et al., 2024). Slyc: Solanum lycopersicum ; Psom: Papaver somniferum ; Smil: Salvia miltiorrhiza ; Ntab: Nicotiana tabacum ; At: Arabidopsis thaliana ; Os: Oryza sativa ;Sync: Synechocystissp . PCC 6803.
[0017] Figure 3: Chromatograms of the recombinant CsGGPPS1 and CsGGPPS2 proteins catalyzing the formation of GGPP from IPP and DMAPP. Note: GPP, FPP, and GGPP generated in the reaction system were hydrolyzed into the corresponding GOH, FOH, and GGOH, and then detected by GC-MS; EV represents the blank control; GOH: Geraniol; FOH: Farnesol; GGOH: Geranylgeraniol.
[0018] Figure 4 : Subcellular localization of citrus protoplasts. Note: The figure shows CsGGPPS1, CsGGPPS2 the localization sites shown after transient expression in citrus leaf protoplasts after fusion with GFP. Chl: Fluorescence of chloroplasts themselves.
[0019] Figure 5 : CsGGPPS1 , CsGGPPS2 The relative expression levels of the gene in citrus seedlings with different degrees of chlorosis. Note: 0 d represents citrus chlorotic seedlings that have not been exposed to light at all, 3 d represents citrus chlorotic seedlings that have been exposed to light for 3 d on the basis of 0 d, 6 d represents citrus chlorotic seedlings that have been exposed to light for 6 d on the basis of 0 d, and Light represents seedlings that have not been treated to avoid light, that is, normal light cultivation. "**" indicates a highly significant difference between the two groups ( P < 0.01).
[0020] Figure 6 : CsGGPPS2 RNAi in citrus callus. Note: (A) Relative expression levels of CsGGPPS2 in different mutant lines (RNAi-1, RNAi-2, RNAi-29) of the wild type (WT) after interfering with the expression of CsGGPPS2 in citrus callus RM33 (Red Marsh grapefruit); (B) Phenotypic colors of the wild type and different mutant lines of RM33; (C) Total carotenoid contents in the wild type and different mutant lines of RM33. Note: "****" indicates a highly significant difference between the two groups ( P < 0.01), and WT represents the wild type of citrus callus RM33. Detailed implementation methods
[0021] The technical solution of the present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that the following embodiments are only used to illustrate the present invention rather than to limit the protection scope of the present invention. Various modifications or equivalent substitutions made by those skilled in the art based on the following embodiments should also be regarded as falling within the protection scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are usually carried out according to conventional conditions or reference books such as "Molecular Cloning: A Laboratory Manual" (New York: Cold Spring Harbor Laboratory, 2017), or according to the methods recommended in the operation manuals provided by the manufacturers. The materials without sources noted in the embodiments are all commonly used materials well-known in the art, and can be constructed by oneself according to the literature reports or obtained through commercial channels.
[0022] Example 1 Materials and Methods 1.1 Experimental Materials Plant materials: Fruits of Lunwan navel orange; Seedlings of Taoye orange.
[0023] Main reagents: The substrates used in the substrate addition experiment were isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). The standard products geraniol (GOH), farnesol (FOH), and geranylgeraniol (GGOH) were purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd.
[0024] Main vectors: pM999 subcellular localization vector: Used for plant subcellular localization to determine the precise positions of cell nuclei, cytoplasm, chloroplasts, endoplasmic reticulum, etc. in plant cells. The pM999 vector used carried green fluorescent protein (GFP), and the position of the target protein in the cell was determined by observing the green fluorescence through a laser confocal microscope.
[0025] pMAL-C6T protein expression vector: Used to express the target protein in the Escherichia coli system. pMAL-C6T contains both a 6×His tag and an MBP tag. The fusion expression of the tags with the target protein is beneficial to improving the solubility and stability of the recombinant protein, facilitating the detection and purification of the target protein.
[0026] 1.2 Experimental Methods 1.2.1 Gene Cloning and Vector Construction Using the cDNA of the pericarp tissue of mature Lunwan navel orange as the template for cloning genes, downloaded from the citrus database (http: / / citrus.hzau.edu.cn / index.php) Citrus sinensisThe genome sequence file of was used to design PCR primers for amplifying the gene coding region (CDS) using the software Snapgene, which was synthesized by Tianjin Qingke Biotechnology Co., Ltd. The primer sequences used are: CsGGPPS1- F:ATGGCAATCTCTGCAACCA CsGGPPS1 -R:TTAATGTTGTCTACTCGCAATGTAGT CsGGPPS2- F:ATGAGTTGCGTCAATCTTGC CsGGPPS2 -R: TCAATTCTGCCTATAAGCAATATAGTTAGC The PCR system and reaction procedure refer to the PhantaTM Super-Fidelity DNA Polymerase Kit, purchased from Nanjing Novogene Biotech Co., Ltd. After the reaction is completed, the PCR product is identified by agarose gel electrophoresis and the target band is recovered; the CDS fragment of the gene is connected to the pTOPO vector by ligation transformation, and the method refers to the pTOPO cloning kit Zero pTOPO-Blunt Simple Cloning Kit, purchased from Beijing Aidelai Biotechnology Co., Ltd. The transformed monoclonal bacterial solution was sent to Wuhan Tianyi Huayu Gene Technology Co., Ltd. for sequencing. After the sequence alignment is correct, the monoclonal bacterial solution containing CsGGPPS The plasmid of the gene fragment was stored at -20℃ for future use.
[0027] To determine CsGGPPS Subcellular localization of the gene, construct the cloned gene fragment into the vector pM999 for subcellular localization, and select the restriction site Xba I (TCTAGA), use the one-step vector construction kit ClonExpress®Entry (purchased from Nanjing Novozyme Biotechnology Co., Ltd.) to construct the vector plasmid. Refer to the kit instructions for specific steps. After sequencing to confirm that the gene fragment is correct, the plasmid is extracted and stored at -20°C for later use. The constructed subcellular localization vector plasmid is transformed into young citrus leaf protoplasts, and the fluorescence luminescence is observed using a confocal microscope. The primers required to construct the pM999 vector are as follows: CsGGPPS1 -pM999-F:GCAGATCTATCGATTCTAGAATGGCAATCTCTGCAACCA CsGGPPS1 -pM999-R:CCTTTGCCCATGGCTCTAGAATGTTGTCTACTCGCAATGTAGT CsGGPPS2 -pM999-F: GCAGATCTATCGATTCTAGAATGAGTTGCGTCAATCTTGC CsGGPPS2 -pM999-R: CCTTTGCCCATGGCTCTAGAATTCTGCCTATAAGCAATATAGTTAGC The vector required for the Escherichia coli prokaryotic expression system in this method is pMAL-C6T. Restriction enzyme sites BamH I and Hind III are selected. A vector plasmid is constructed using a one-step vector construction kit. The specific steps refer to the kit instructions. After sequencing to confirm the correct gene fragment, the plasmid is extracted and stored at -20 °C for later use. The primers required for constructing the pMAL-C6T vector are as follows: CsGGPPS1 -pMAL-C6T-F: ATATCGTCGACGGATCCATGGCAATCTCTGCAACCA CsGGPPS1 -pMAL-C6T-R: CGTTTTATTTGAAGCTTTTAATGTTGTCTACTCGCAATGTAGT CsGGPPS2 -pMAL-C6T-F: ATATCGTCGACGGATCCATGAGTTGCGTCAATCTTGC CsGGPPS2 -pMAL-C6T-R: CGTTTTATTTGAAGCTTTCAATTCTGCCTATAAGCAATATAGTTAGC 1.2.2 Protein purification and functional verification The constructed pMAL-C6T recombinant plasmid is transformed into Escherichia coli BL21(DE3) strain. The bacterial solution is subjected to positive detection. The bacterial solution is activated at 37 °C. 330 μL of the bacterial solution is pipetted into 330 mL of liquid LB medium containing ampicillin antibiotic (1:1000) and cultured at 37 °C for 3 - 4 h until the absorbance value of the bacterial solution at 600 nm reaches 0.4 - 0.6. After the bacterial solution cools down, 33 μL of 1 M Isopropyl β-D-1-thiogalactopyranoside (IPTG) is added to induce protein expression, and the expression is induced in a shaker at 16 °C with a rotation speed of 160 rpm for 16 - 20 h.
[0028] After centrifuging all the bacterial solutions at 4000 g for 15 min (at 4 °C), the supernatant was removed and the bacterial cells were left. The bacterial cells were resuspended with 30 mL of Lisys buffer (50 mM NaH 2 PO 4 , 300 mM NaCl, 10 mM β-mercaptoethanol, 10 mM imidazole), and protease inhibitor was added simultaneously. The resuspended solution was transferred to a 50 mL centrifuge tube, and the bacterial cells were sonicated for 30 min. The sample was centrifuged at 12000 rpm for 15 min at 4 °C. All the supernatants were used to purify the protein with an elution column containing Ni-NTA agarose resin. The purified protein solution was collected, and the target protein was identified by polyacrylamide gel electrophoresis, and then the protein was further purified and concentrated using a desalting column.
[0029] The in vitro enzyme activity verification system was as follows: 5 μg of the protein purification solution, 300 μM of IPP, 100 μM of DMAPP, 400 μL of the loading buffer (100 mM HEPES, 5 mM MgCl 2 , 10 mM KCl, 1 mM DTT, pH 7.5), and incubated at 28 °C for 10 h for sufficient reaction. After the reaction, 200 μL of bovine intestinal alkaline phosphatase (20 mg / mL, 0.2 M Tris-HCL, pH = 9.5) and 2 μL of shrimp phosphatase were added, and the enzyme activity products were hydrolyzed overnight in a 30 °C water bath (Song et al., 2023). An equal volume of MTBE (methyl tert-butyl ether) was added and vortexed for 10 min to extract the hydrolysis products to obtain the corresponding alcohols. After centrifuging at 12000 rmp for 10 min, the supernatant was aspirated, filtered through a 0.22 μm filter membrane, and transferred to an injection vial. The products were detected using a GC-MS instrument. The standards of GOH (geraniol), FOH (farnesol), and GGOH (geranyl geraniol) were dissolved in MTBE to identify the substances in the products.
[0030] 1.2.3 CsGGPPS Determination of relative expression levels in citrus yellowing seedlings Obtaining aseptic citrus yellowing seedlings: From mature Taoye Cheng fruits ( C. sinensisCollect seeds from [description in Chinese], rinse the vesicles on the seed surface thoroughly, soak the seeds in 2 mol / L NaOH solution for 10 min (stirring with a glass rod during soaking), pour out the NaOH solution, and rinse the seeds with running water for 10 - 20 min. The purpose of this treatment is to remove pectin. Secondly, the seeds need to be disinfected and sterilized. Prepare 70% sodium hypochlorite solution with sterile water in a laminar flow hood for later use. Immerse the seeds in an Erlenmeyer flask containing sodium hypochlorite solution, soak and shake for 5 min first, pour out the sodium hypochlorite solution and then shake and rinse with sterile water, and drain the water. Repeat the above steps more than three times (the last soaking and shaking time in sodium hypochlorite solution is 7 min, and rinse with sterile water 4 - 5 times until the color of the sterile water no longer turns yellow). Each time, the disinfectant and the sterile Erlenmeyer flask need to be replaced. After rinsing, pour the seeds onto a Petri dish containing sterilized filter paper to air-dry the surface moisture of the seeds. Sow the citrus seeds in a glass test tube containing solid MT medium, seal it, and place it in a dark culture room at 25 °C for 4 - 5 weeks.
[0031] To obtain etiolated seedlings at different degrees, randomly select citrus seedlings that have not been exposed to light, record them as samples at 0 d, with three biological replicates; samples of seedlings subjected to light culture for 3 d based on 0 d indicate being treated with light for 3 days; 6 d indicates samples treated with light for 6 days based on 0 d; Light indicates that the seedlings are not subjected to light avoidance treatment, that is, normal light culture (Barja et al., 2021). Samples at each stage are quickly frozen with liquid nitrogen and stored in a -80 °C ultra-low temperature freezer. Grind the samples with liquid nitrogen, weigh 0.1 g of the samples for RNA extraction, and the kit is FastPure Universal Plant Total RNA Isolation Kit; after extracting RNA, reverse transcribe it into cDNA, and the kit is HiScript II Q RT SuperMix for qPCR(+gDNA wiper). Both kits are purchased from Nanjing Novoprotein Scientific Co., Ltd. The cDNA obtained from the reaction can be used for subsequent experiments or stored at -80 °C for later use.
[0032] RT-qPCR analysis: RT-qPCR (Reverse-transcription quantitative PCR) is performed using a Roche LightCycler 480 II instrument (Roche Applied Science). For citrus Actin as the internal reference gene, design quantitative primers for each gene using the NCBI online website (https: / / www.ncbi.nlm.nih.gov / ). The primer sequences are as follows: RT-Actin-F: CCAAGCAGCATGAAGATCAA RT-Actin -R: ATCTGCTGGAAGGTGCTGAG RT-CsGGPPS1- F: TGCACATTCAGCTTTGGTGC RT-CsGGPPS1- R: TCGCAACTGCACTGTCTCAT RT-CsGGPPS2- F: TTTTGCTCGCTGTATTGGGC RT-CsGGPPS2- R: CGATTCTTCGATCCCCAGCA The kit for RT-qPCR experiment is Hieff qPCR SYBR Green Master Mix (No Rox), purchased from Yeasen Biotechnology Co., Ltd. The reaction mixture was prepared according to the operation instructions, and the reaction system was 10 μL. The data was statistically analyzed using Excel.
[0033] 1.2.4 Agrobacterium-mediated genetic transformation of citrus callus RNAi (RNA interference) vector construction: The vector used was pHellsgate8, and the vector construction method was Gateway. The appropriate interfering target fragment (SEQ ID NO.5) of the target gene was designed according to the siFi21 software. Primers were designed after adding the adapter sequence to the target fragment. The adapter sequences are as follows: attB- CsGGPPS2 -RNAi-F: AAAAAGCAGGCTCCACCAAGCTAGCAGTCGCAGATC attB- CsGGPPS2 -RNAi-R: AGAAAGCTGGGTTGGCTTGGTTGACGGTACTTGCTTT Amplify the interfering fragment using the plasmid with the target gene, and identify the correct target fragment by gel electrophoresis; use the PCR product of the first round as a template for the second round of PCR amplification. The primers for the second round of amplification are Adapter attB 1: GGGGACAAGTTTGTACAAAAAAGCAGGCT and Adapter attB 2: GGGGACCACTTTGTACAAGAAAGCTGGGT. Recover the target fragment by gel electrophoresis. Prepare the BP reaction system: 15 ng / 1K of the recovered product, 0.4 μL of the Pdonor 221 vector plasmid, 0.6 μL of the BP enzyme, 1 μL of 1×TE, and incubate in a water bath at 25 °C for 4 h. Heat shock and transform into Trans5α E. coli competent cells (kanamycin resistant), pick monoclonal colonies, send for sequencing after positive detection, and extract the plasmid. Prepare the LR reaction system: 15 ng / 1K of the plasmid with correct sequencing in the BP reaction, 0.4 μL of the pHellsgate8 vector plasmid, 0.6 μL of the LR enzyme, 1 μL of 1×TE, and incubate in a water bath at 25 °C for 4 h. Heat shock and transform into Trans5α E. coli competent cells (spectinomycin resistant), pick monoclonal colonies, send for sequencing with 35S primers after positive detection, and extract the plasmid. Take the Agrobacterium competent cells of EHA105, thaw at room temperature, add 2 μL of the plasmid to 100 μL of the Agrobacterium competent cells, incubate on ice for 5 min, in liquid nitrogen for 5 min, in a water bath at 37 °C for 5 min, and then on ice for 5 min. Add 400 μL of liquid LB medium, incubate in a shaker at 28 °C and 220 rpm / min for 2 - 3 h. Take 100 μL of the bacterial solution and spread it on solid LB medium containing antibiotics, and culture at 28 °C for 48 h. Pick monoclonal colonies into 400 μL of LB liquid medium for positive detection. Preserve the Agrobacterium solution.
[0034] Preparation of callus to be transformed: The callus (Red Marsh grapefruit, RM33) is cultured under light in MT solid medium. Select the well - grown callus 20 - 24 d after sub - culture, pick it up with forceps and transfer it to a conical flask containing LM liquid medium, and suspend - culture at 200 rpm / min for 4 - 5 d. Pour out the liquid medium in the conical flask in a laminar flow hood, transfer the callus to a petri dish lined with sterile filter paper with sterile forceps, spread it out, and wait for the callus to naturally air - dry the residual liquid medium on the surface for use.
[0035] Preparation of Agrobacterium infection solution: Pipette 500 μL of the Agrobacterium solution into 20 mL of LB liquid medium (containing antibiotics), and shake - culture in a shaker at 200 rpm / min for 1 d. Centrifuge to collect the bacterial cells, resuspend the bacterial cells with CM medium, pipette 1 mL of the bacterial solution, measure the OD value of the bacterial solution with a spectrophotometer, and adjust the OD value with CM medium. 600 of the value, and adjust the OD 600The OD of the Agrobacterium infection solution adjusted to 0.8 was placed in a sterile conical flask and activated at 28 °C for 40 min for later use.
[0036] Infection and co-culture: The air-dried callus was clamped and placed into the infection solution, cultured on a shaker at 28 °C for 5 min, and then subjected to vacuum infiltration for 5 min to better allow the bacterial solution to infect the callus. It was left to stand in the dark for 20 min. The callus was taken out and transferred to a petri dish with filter paper to dry; the callus was transferred to solid CM medium (lined with a piece of filter paper), and the callus was spread out as flat as possible. Co-cultured on CM medium at 28 °C for 3 days. After the co-cultured callus was dried on the filter paper, it was transferred to SM medium for screening culture and dark-cultured at 28 °C for 1 - 2 months. The interference vector pHellsgate8 contains a GFP fluorescent protein tag. During the culture period, a fluorescent lamp was used to observe the positive callus with fluorescence, and it was transferred to a new screening medium, and continuously subcultured and purified until the transgenic callus phenotype was stable for subsequent analysis.
[0037] The formula of the media used in the genetic transformation experiment is as follows: LB medium: Yeast extract + Tryptone + Sodium chloride + 15 g / L agar.
[0038] MT solid basal medium (MT): MT + 40 g / L sucrose + 8 g / L agar, pH 5.8.
[0039] MT liquid basal medium (LM): MT + 40 g / L sucrose + 8 g / L L - glutamine + 0.5 g / L malt extract, pH 5.8.
[0040] MT co-culture medium (CM): MT + 40 g / L sucrose + 8 g / L agar + 20 mg / L AS, pH 5.6.
[0041] MT screening medium (SM): MT + 40 g / L sucrose + 8 g / L agar + Hygromycin, pH 5.8.
[0042] 2 Results and Analysis 2.1 In Citrus CsGGPPS Cloning The coding region sequences of CsGGPPS1, CsGGPPS2 genes cloned from citrus fruit materials were 1095 bp and 1083 bp in length respectively, and both had two typical TPTs conserved domains (CXXXC and DDXXD), as Figure 1 shown. According to the phylogenetic tree analysis ( Figure 2 ), the 2 CsGGPPSs were related to the known TPTsGenes of the family can be clustered together, but CsGGPPS and CsGGPPS2 are relatively far apart, suggesting that the functions of these two genes in citrus may be different.
[0043] 2.2 Functional verification and subcellular localization of CsGGPPS in citrus In vitro, it was verified whether the recombinant proteins of CsGGPPS1 and CsGGPPS2 could convert IPP and DMAPP into GGPP. The results are as Figure 3 shown. It was found that both CsGGPPS1 and CsGGPPS2 proteins produced GGPP, and the function of CsGGPPS2 was stronger. The results of subcellular localization of citrus protoplasts are as Figure 4 shown, CsGGPPS1, CsGGPPS2 both located in plastids, which is consistent with the GGPPS localization sites in most species.
[0044] 2.3 Gene expression differences in citrus CsGGPPS The differences in the expression profiles of two were measured during the de-etiolation process of citrus seedlings. The results are as CsGGPPS shown. Figure 5 The expression level of CsGGPPS2 in etiolated seedlings at each stage was significantly higher than that of CsGGPPS1 , suggesting that it may play an important role in citrus terpene metabolism.
[0045] 2.4 Effect of CsGGPPS2 gene on carotenoid metabolism in citrus The CsGGPPS2 gene with higher expression level was selected for interference (RNAi) experiments in citrus callus RM33, and three stably inherited citrus callus lines (RNAi-1, RNAi-2, RNAi-29) were obtained. As Figure 6 shown, the expression level of the CsGGPPS2 gene in the citrus callus lines decreased significantly. Compared with the wild-type RM33 (the orange phenotype in the wild-type RM33 is caused by the accumulation of carotenoids), the color phenotype of the mutant lines became significantly lighter. After measurement, it was found that the carotenoid content decreased to 17.25% of the wild-type on average. The results indicate that CsGGPPS2 plays an important role in citrus terpene metabolism and affects the biosynthesis of carotenoids.
[0046] References 1. Yi Xuan, He Qingli, Liu Wen. Research on the biosynthesis of diterpenoids from plants [J]. Life Sciences, 2019, 31(05):458-472. 2. Li WY. Mechanistic study on the differential accumulation of flavanone rutinosides in citrus [D]. Huazhong Agricultural University, 2018. 3. Chen F, Tholl D, Bohlmann J, Pichersky E. The family of terpene synthases in plants: a mid‐size family of genes for specialized metabolism that is highly diversified throughout the kingdom. The Plant Journal. 2011, 66(1):212-29. 4. Zhou F, Pichersky E. More is better: the diversity of terpene metabolism in plants. Current opinion in plant biology. 2020, 55:1-0. 5. Barja MV, Ezquerro M, Beretta S, Diretto G, Florez‐Sarasa I, Feixes E, Fiore A, Karlova R, Fernie AR, Beekwilder J, Rodríguez‐Concepción M. Several geranylgeranyl diphosphate synthase isoforms supply metabolic substrates for carotenoid biosynthesis in tomato. New Phytologist. 2021, 231(1):255-72. 6. Hemmerlin A, Harwood JL, Bach TJ. A raison d’être for two distinct pathways in the early steps of plant isoprenoid biosynthesis?. Progress in lipid research. 2012, 51(2):95-148. 7. Jiang J, Rodriguez-Furlan C, Wang JZ, de Souza A, Ke H, Pasternak T, Lasok H, Ditengou FA, Palme K, Dehesh K. Interplay of the two ancient metabolites auxin and MEcPP regulates adaptive growth. Nature communications. 2018, 9(1):2262. 8. Alder A, Jamil M, Marzorati M, Bruno M, Vermathen M, Bigler P, Ghisla S, Bouwmeester H, Beyer P, Al-Babili S. The path from β-carotene to carlactone, a strigolactone-like plant hormone. Science. 2012, 335(6074):1348-51. 9. Yang C, Wang Y, Su Z, Xiong L, Wang P, Lei W, Yan X, Ma D, Zhao G, Zhou Z. Biosynthesis of the highly oxygenated tetracyclic core skeleton of Taxol. Nature Communications. 2024, 15(1):2339. 10. Maoka T. Carotenoids as natural functional pigments. Journal of natural medicines. 2020, 74(1):1-6. 11. Zhang Y, Jin J, Wang N, Sun Q, Feng D, Zhu S, Wang Z, Li S, Ye J, Chai L, Xie Z, Deng X. Cytochrome P450 CitCYP97B modulates carotenoid accumulation diversity by hydroxylating β-cryptoxanthin in Citrus. Plant Communications. 2024, 10;5(6). 12. Song S, Jin R, Chen Y, He S, Li K, Tang Q, Wang Q, Wang L, Kong M, Dudareva N, Smith BJ, Zhou F, Lu S. The functional evolution of architecturally different plant geranyl diphosphate synthases from geranylgeranyl diphosphate synthase. Plant Cell. 2023, 35(6):2293-2315. 13. Kato M, Ikoma Y, Matsumoto H, Sugiura M, Hyodo H, Yano M. Accumulation of carotenoids and expression of carotenoid biosynthetic genes during maturation in citrus fruit. Plant Physiology. 2004, 134(2):824-37. 14. Sun Q, He Z, Feng D, Wei R, Zhang Y, Ye J, Chai L, Xu J, Cheng Y, Xu Q, Deng X. The abscisic acid-responsive transcriptional regulatory module CsERF110–CsERF53 orchestrates citrus fruit coloration. Plant Communications. 2024, 5(11). 15. Sun Q, He Z, Wei R, Zhang Y, Ye J, Chai L, Xie Z, Guo W, Xu J, Cheng Y, Xu Q, Deng, X. The transcriptional regulatory module CsHB5‐CsbZIP44 positively regulates abscisic acid‐mediated carotenoid biosynthesis in citrus (Citrus spp.). Plant Biotechnology Journal, 2024, 22(3), 722-737. 16. Zhu F, Luo T, Liu C, Wang Y, Yang H, Yang W, Yang W, Zheng L, Xiao X, Zhang M, Xu R, Xu J, Zeng Y, Xu J, Xu Qiang, Guo W, Robert M, Deng X, Cheng, Y. An R2R3‐MYB transcription factor represses the transformation of α‐and β‐branch carotenoids by negatively regulating expression of CrBCH2 and CrNCED5 in flavedo of Citrus reticulate. New Phytologist, 2017, 216(1), 178-192. 17. Zhu K, Chen H, Mei X, Lu S, Xie H, Liu J, Chai L, Xu Q, Eleanorev T, Ye J, Deng X. Transcription factor CsMADS3 coordinately regulates chlorophyll and carotenoid pools in Citrus hesperidium. Plant Physiology, 2023, 193(1), 519-536.
Claims
1. A gene encoding geranylgeranyl diphosphate synthase, characterized in that: The gene is selected from the following nucleotide sequences: a) the nucleotide sequence shown in SEQ ID NO.1; b) the nucleotide sequence shown in SEQ ID NO.2; c) a nucleotide sequence having at least 90% sequence identity with SEQ ID NO.1 or SEQ ID NO.2 and encoding a polypeptide having geranylgeranyl diphosphate synthase activity.
2. The gene-encoded polypeptide according to claim 1, characterized in that The amino acid sequence of the polypeptide is selected from: a) the amino acid sequence shown in SEQ ID NO.3; b) the amino acid sequence shown in SEQ ID NO.4; c) a polypeptide having at least 90% sequence identity to SEQ ID NO. 3 or SEQ ID NO. 4 and having geranylgeranyl diphosphate synthase activity.
3. A recombinant expression vector, characterized in that: Comprising the gene according to claim 1, the vector is selected from a prokaryotic expression vector or a plant expression vector.
4. A recombinant strain, characterized in that: Comprising the recombinant expression vector according to claim 3, the strain is Escherichia coli or Agrobacterium.
5. A transgenic plant or plant callus, characterized in that: The method is obtained by introducing the gene or RNA interference sequence thereof according to claim 1 into a host plant cell, wherein the host plant is a citrus plant.
6. The transgenic plant or plant callus according to claim 5, characterized in that: The RNA interference sequence targets the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.2, resulting in a significant reduction in the carotenoid content in the host.
7. A method for synthesizing geranylgeranyl diphosphate (GGPP) in vitro, characterized in that: The following steps are involved: a) cloning the gene described in claim 1 into a prokaryotic expression vector; b) transforming the recombinant vector into Escherichia coli and inducing the expression of the recombinant protein; c) GGPP is produced by catalysis of the purified recombinant protein in a reaction system containing isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP).
8. A method for regulating terpenoid metabolism in plants, characterized in that: By regulating the expression level of the gene according to claim 1, the accumulation amount of carotenoids in the plant is changed.
Citation Information
Cited By
Application of CsC3 'H gene in increasing contents of rutin, hesperidin and / or didymoside in citrus pomelo peel
CN120905285A
Use of CsC3'H gene to increase content of naringin, hesperidin and / or jaceosidin in citrus
CN120905285B
CsSSU I protein and application thereof in regulation and control of citrus terpene metabolism
CN122356247A