Engineering bacterium for in-situ biosynthesis of immune checkpoint blocking agent based on blood circulation lung and application of engineering bacterium

Abstract

The invention discloses an engineering bacterium for in-situ biosynthesis of an immune checkpoint blocking agent based on blood circulation lungs and application of the engineering bacterium, and belongs to the technical field of biotechnology and medicine. The invention discloses an engineering bacterium for in-situ biosynthesis of an immune checkpoint blocking agent on the basis of blood circulation lungs. The engineering bacterium contains a p15A-J23119-csgA-anti-PD-L1nanobody plasmid, and is characterized in that the p15A-J23119-csgA-anti-PD-L1nanobody plasmid is used as a carrier; the engineering bacterium shows anti-PD-L1nanobody on the surface of the bacterium, so that the combination of PD-L1 and PD-1 on the surface of a T cell is blocked, an immunosuppression signal is relieved, and the killing function of the T cell on a tumor cell is recovered. And the natural hypoxia tropism of the engineering probiotics is utilized to enhance the targeting to the lung tumor part, so that precise treatment is realized.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology and medicine, and more particularly to an engineered bacterium that biosynthesizes an immune checkpoint blocker in situ in the blood circulation lungs and its application. Background Art

[0002] The application of immune checkpoint blockers (ICB) in cancer treatment has made significant progress, especially in the treatment of lung cancer. Studies have shown that for the treatment of non-small cell lung cancer, the median overall survival (OS) of the nivolumab group was 12.2 months, which was significantly improved compared with 9.4 months in the chemotherapy group; the median overall survival of the pembrolizumab group was 30.0 months, which was significantly improved compared with 14.2 months in the chemotherapy group. Immune checkpoints are important molecules that regulate immune responses. By inhibiting these checkpoints, the immune system's ability to attack tumor cells can be enhanced. However, as a full-length antibody, traditional ICB has a complex production process and high cost. Although it has good stability, its large size may affect its ability to penetrate into tissues. Traditional ICB treatment also faces the problems of imprecise drug delivery and large side effects.

[0003] Both nanobodies and traditional ICBs have highly specific affinity. Nanobodies are single-chain antibody fragments produced by camelids that are highly stable and specific. Due to their simple structure and ease of modification, nanobodies have broad application potential in biomedical research and treatment, such as targeted therapy and diagnosis. ICBs typically target immune checkpoint molecules such as PD-1, PD-L1 or CTLA-4, while nanobodies can be designed to target specific tumor antigens or immune checkpoints. Their small size enables them to penetrate tissues and contact targets more effectively, have high stability and a long half-life in the body, and have low production costs, providing a new approach for the development of antibody drugs.

[0004] The research and clinical application of microorganisms in cancer treatment are making continuous progress. Among these advances, engineered microbial agents, engineered through synthetic biology techniques, can effectively predict the host immune response and have achieved significant breakthroughs. E. coli Nissle 1917 (EcN), a non-pathogenic strain of Escherichia coli first isolated in 1917, possesses significant probiotic properties. It colonizes the intestine, maintaining microecological balance and inhibiting the growth of harmful pathogens. In addition to treating and preventing intestinal diseases such as inflammatory bowel disease, E. coli Nissle 1917 has also demonstrated potential anti-tumor effects by modulating the tumor microenvironment, alleviating immunosuppression, and enhancing the ability of immune cells to recognize and eliminate tumors. Through genetic engineering, this strain can release specific anti-tumor molecules or drugs within the tumor microenvironment, enhancing anti-tumor immune responses. Engineered bacteria can be engineered to produce and display nanobodies within the specific lung microenvironment. This approach not only increases the local concentration of nanobodies and reduces systemic side effects, but also leverages the bacteria's natural chemotaxis to enhance targeting to tumor sites, enabling personalized and precise treatment.

[0005] Therefore, providing an engineered bacterium that biosynthesizes immune checkpoint blockers in situ in the blood circulation lungs and its application is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0006] In light of this, the present invention provides an engineered bacterium that biosynthesizes immune checkpoint blockers in situ within the bloodstream and lungs, and its application. This system addresses the high production costs, time-consuming production, imprecise delivery, and significant side effects faced by traditional antibodies. This engineered bacterial production system offers advantages such as low cost, rapid production, high yield, highly precise tumor targeting, and reduced systemic side effects, significantly reducing the production cost of anti-PD-L1 nanobodies.

[0007] Combining the latest advances in synthetic biology and immunotherapy, the present invention has designed a modified probiotic. This probiotic can locally and controllably release anti-PD-L1 nanobodies (anti-PD-L1 nanobody) at the site of lung tumors, thereby effectively intervening in the tumor immune escape mechanism. Specifically, the present invention combines immunotherapy strategies with optimized drug release mechanisms, enabling these probiotics to transport nanobodies to the hypoxic core area of ​​the tumor. In this way, the accumulation of anti-PD-L1 nanobodies at the tumor site can be significantly increased, thereby enhancing the anti-tumor immune response and inhibiting tumor growth. The innovation of this strategy is that the engineered bacterial live drug can continue to exert its effect in the tumor microenvironment, optimize the therapeutic effect, and reduce systemic side effects.

[0008] The applicant envisions developing an engineered bacterial biological preparation based on the in situ biosynthesis of immune checkpoint blockers in the blood circulation lungs, reducing the nonspecific aggregation of anti-PD-L1 nanoantibodies in normal tissues and increasing their enrichment in tumor tissues, thereby enhancing the anti-tumor effect of anti-PD-L1 nanoantibodies. After genetic engineering, EcN colonizes in tumor lesions through lung targeting and hypoxia tropism, constructing engineered bacteria with the ability to inhibit lung tumor lesions. (1) As a new type of biotherapeutic carrier, engineered bacteria enter the host body through intravenous injection, allowing these engineered bacteria to effectively reach the lungs through blood circulation, achieve specific colonization, and thus achieve the purpose of local drug delivery.

[0009] (2) After the engineered bacteria successfully colonize the lungs, due to their unique hypoxic properties, they can preferentially tend to the tumor tissue in the lungs, especially the hypoxic area in the tumor core, thereby achieving highly precise tumor targeting. Through genetic engineering, these engineered bacteria express the display protein csgA, which is tightly bound to the surface of the engineered bacteria. The display protein csgA and the anti-PD-L1 nanobody are fused, and the anti-PD-L1 nanobody can be displayed on the bacterial surface, thereby achieving precise drug release.

[0010] (3) The engineered bacteria use the anti-PD-L1 nanobody displayed by csgA to block the PD-L1 checkpoint on tumor cells, preventing the binding of PD-L1 to PD-1 on the surface of T cells, releasing the immunosuppressive signal, and restoring the T cell's ability to kill tumor cells. This process not only enhances the immunogenicity of the tumor, but also improves the body's immune response to the tumor, making tumor treatment more efficient and precise.

[0011] In order to achieve the above object, the present invention adopts the following technical solutions:

[0012] A p15A-J23119-csgA-anti-PD-L1 nanobody plasmid, comprising the replicon p15A, the constitutive promoter J23119, the gene encoding the bacterial surface display protein csgA, a flexible linker peptide sequence, and the target gene of the immune checkpoint inhibitor anti-PD-L1 nanobody;

[0013] The coding gene sequence of the bacterial surface display protein csgA is shown in SEQ ID NO.1;

[0014] The target gene sequence of the immune checkpoint inhibitor anti-PD-L1 nanobody is shown in SEQ ID NO.2;

[0015] The flexible connecting peptide sequence is: 5'-GSGGGGS-3';

[0016] The coding gene of the display protein csgA is connected to the target gene of the immune checkpoint inhibitor anti-PD-L1 nanobody through a flexible linker peptide.

[0017] Furthermore, an engineered bacterium is provided for biosynthesis of an immune checkpoint blocker in situ in the blood circulation lungs, wherein the engineered bacterium contains the p15A-J23119-csgA-anti-PD-L1 nanobody plasmid.

[0018] The engineered bacteria display and express csgA display protein tightly bound to the surface of the engineered bacteria. The csgA display protein and the anti-PD-L1 nanobody are fused to display the anti-PD-L1 nanobody on the bacterial surface.

[0019] The particle size of the engineered bacteria is 3-6 μm.

[0020] The engineered bacteria can be administered by intravenous injection and accumulated in the lungs through blood circulation; the engineered bacteria has the dual functions of lung targeting and hypoxia tropism.

[0021] The engineered bacteria can effectively and locally colonize the host's lungs with exogenous engineered bacterial drugs, achieving precise targeted colonization of the exogenous engineered bacterial drugs in the host's lungs. This effectively colonizes the engineered bacterial drugs in lung tissue, further improving their targeting to lung tumor areas, thereby enhancing the tumor-suppressing effects of the exogenous engineered bacterial drugs and ensuring their maximum therapeutic effect.

[0022] Furthermore, the plasmid or the engineered bacteria are used to secrete anti-PD-L1 nanobody.

[0023] Furthermore, the plasmid or the engineered bacteria are used in the preparation of drugs for the targeted treatment of lung tumors.

[0024] Furthermore, a lung delivery system based on blood circulation drug delivery engineered bacteria contains the engineered bacteria.

[0025] Furthermore, the lung delivery system based on blood circulation drug delivery engineered bacteria is administered by intravenous injection.

[0026] Furthermore, the lung delivery system based on blood circulation drug delivery engineered bacteria is used in lung colonization.

[0027] The present invention provides an engineered probiotic that specifically displays and expresses anti-PD-L1 nanoantibodies in the lung tumor microenvironment. The use of engineered bacteria to produce antibodies can further optimize their stability, allowing them to maintain their functions in both in vitro and in vivo environments. By directly blocking the action of PD-L1, local immune responses are enhanced, improving the targeting and effectiveness of treatment. An engineered bacterial biological preparation based on the in situ biosynthesis of immune checkpoint blockers in the blood circulation lungs reduces the ability of anti-PD-L1 nanoantibodies to block the binding of PD-L1 to PD-1 on the surface of T cells, relieves immunosuppressive signals, and restores the killing function of T cells against tumor cells. This process not only enhances the immunogenicity of the tumor, but also improves the body's immune response to the tumor, making tumor treatment more efficient and precise.

[0028] It can be seen from the above technical solutions that, compared with the prior art, the present invention discloses an engineered bacterium that biosynthesizes immune checkpoint blockers in situ in the blood circulation lungs and its application, which has the following beneficial effects:

[0029] (1) The present invention is based on the local delivery of engineered bacteria to the lungs through intravenous injection. By local positioning and precise release of immune target inhibitors, the exogenous engineered bacteria drugs can be used to treat lung diseases in situ and inhibit the course of the disease, further achieving the relief and treatment of lung tumor diseases.

[0030] (2) The present invention is based on local lung delivery of intravenous engineered bacteria, effectively directing the engineered bacteria drug to the lung tissue, further improving its targeting in the lung tumor area, and achieving the precise release of immune target blockers in exogenous engineered bacteria through the "display platform", thereby enhancing the inhibitory effect of exogenous engineered bacteria drugs on tumors and ensuring that the drugs exert their maximum therapeutic effect.

[0031] (3) The engineered bacteria of the present invention can be designed to specifically display anti-PD-L1 nanobodies in the tumor microenvironment. This localized treatment method can reduce the side effects caused by the systemic distribution of antibodies and improve the safety and effectiveness of the treatment. This invention innovatively integrates synthetic biology and immunotherapy technologies. It can be used not only for cancer treatment, but also for immunotherapy of other diseases and biopharmaceutical fields, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0033] Figure 1The accompanying figure is a plasmid map of the p15A-J23119-csgA-anti-PD-L1 nanobody of the present invention (promoter-display platform-nanobody);

[0034] Figure 2 The accompanying figure shows the plasmid map of pMUT1-pRE112;

[0035] Figure 3 The accompanying figure shows the plasmid map of pMUT2-pRE112;

[0036] Figure 4 The accompanying figure is an SDS-PAGE protein electrophoresis gel verification diagram of the anti-PD-L1 nanobody expressed by the engineered bacteria EcNΔΔ-nb of the present invention;

[0037] Among them, 1: DH5α; 2: anti-PD-L1 nanobody;

[0038] Figure 5 The accompanying figure is a process diagram for preparing the engineered bacteria EcNΔΔ-nb of the present invention; A represents the plasmid transfer of the engineered bacteria, and B represents the tail vein injection of the engineered bacteria into an animal;

[0039] Figure 6 The accompanying figure is a diagram showing the activity verification of the engineered bacteria EcNΔΔ-nb of the present invention;

[0040] Figure 7 The accompanying figure is a diagram verifying the colonization of the lungs by the blood circulation-based local lung delivery system of the present invention. DETAILED DESCRIPTION

[0041] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0042] Unless otherwise specified, the raw materials used in the present invention are conventional commercial products; the methods used in the present invention are conventional methods in the art unless otherwise specified.

[0043] Example 1

[0044] A pulmonary delivery system based on blood circulation drug delivery engineered bacteria, wherein the engineered bacteria are strains containing the p15A-J23119-csgA-anti-PD-L1 nanobody plasmid;

[0045] The csgA display protein expressed by the engineered bacteria is tightly bound to the surface of the engineered bacteria. The csgA display protein is fused with the anti-PD-L1 nanobody, which can display the anti-PD-L1 nanobody on its bacterial surface;

[0046] The particle size of the engineered bacteria is 3-6 μm;

[0047] Engineered bacteria can deliver drugs to the lungs via intravenous injection, achieving precise, targeted colonization of exogenous engineered bacteria drugs within the host's lungs. This effectively colonizes engineered bacteria drugs within lung tissue, further enhancing their targeting of lung tumors, thereby enhancing the tumor-suppressing effects of exogenous engineered bacteria drugs and ensuring their maximum therapeutic effect.

[0048] Application of local lung delivery system based on intravenous injection of engineered bacteria in the preparation of drugs for preventing lung diseases.

[0049] The method for constructing an engineered bacterial strain capable of displaying anti-PD-L1 nanobody is as follows:

[0050] Plasmid p15A-J23119-csgA-anti-PD-L1 nanobody (map see Figure 1 ), containing the replicon p15Aori, the constitutive promoter J23119, the gene encoding the bacterial surface display platform csgA, a flexible linker peptide sequence, the target gene of the immune checkpoint inhibitor anti-PD-L1 nanobody, and a chloramphenicol resistance gene.

[0051] The csgA (SEQ ID NO. 1) and anti-PD-L1 nanobody (SEQ ID NO. 2) gene sequences were obtained from the public database RSCB PDB.

[0052] csgA gene sequence:

[0053] 5’-ATGAAACTTTTAAAAGTAGCAGCAATTGCAGCAATCGTATTCTC CGGTAGCGCTCTGGCAGGTGTTGTTCCTCAGTACGGCGGCGGCGGTAACCACGGTGGTGGCGGTAATAATAGCGGCCCAAATTCTGAGCTGAACATTTACCAGTACGGTGGCGGTAACTCTGCACTTGCTCTGCAAACTGATGCCCGTAACTCTGACTTGACTATTACCCAGCATGGCGGCGGTAATGGTGCAGATGTTGGTCAGGGCTCAGATGACAGCTCAATCGATCTGACCCAACGTGGCTTCGGTAACAGCGCTACTCTTGATCAGTGGAACGGCAAAAATTCTGAAATGACGGTTAAACAGTTCGGTGGTGGCAACGGTGCTGCAGTTGACCAGACTGCATCTAACTCCTCCGTCAACGTGACTCAGGTTGGCTTTGGTAACAACGCGACCGCTCATCAGTAC-3’; SEQ ID NO.1.

[0054] anti-PD-L1 nanobody gene sequence:

[0055] 5’-GCGCAAGTGCAGTTAGTGGAAACCGGCGGTGGCTTAGTGCAGC CGGGCGGTAGCCTGCGCCTGAGCTGCACCGCGAGCGGCTTTACCTTTAGCATGCATGCGATGACCTGGTATCGCCAAGCGCCGGGCAAACAGCGCGAACTGGTGGCGGTGATTACGAGCCATGGCGATCGCGCGAACTATACCGATAGCGTGCGCGGCCGCTTTACCATTAGCCGCGATAACACCAAAAACATGGTGTATCTGCAGATGAACAGCCTGAAACCGGAAGATACCGCGGTGTATTATTGCAACGTGCCGCGCTATGATAGCTGGGGCCAAGGCACCCAAGTGACCGTGAGCAGCGGCGGCCTGCCGGAAACGGGCGGC-3’; SEQ ID NO.2.

[0056] The above components are connected by a flexible connecting peptide, the sequence of which is: 5'-GSGGGGS-3'; SEQ ID NO.3.

[0057] Construction method of plasmid p15A-J23119-csgA-anti-PD-L1 nanobody:

[0058] Escherichia coli DH5α strain was used as the host for plasmid construction and amplification. First, the DNA fragment containing the display protein csgA encoding gene and the anti-PD-L1 nanobody (anti-PD-L1 nb) target gene were PCR amplified respectively.

[0059] The PCR amplification reaction system and PCR amplification procedure for the DNA fragment containing the csgA encoding gene are as follows:

[0060] The PCR amplification reaction system consisted of 10 μL of high-fidelity polymerase 2× PrimeSTARMAX Premix, 7 μL of ddH₂O, 1 μL of forward primer (csgA-F), 1 μL of rear primer (TY-csgA-R), and 1 μL of Escherichia coli DH5α genomic DNA, for a total reaction volume of 20 μL. The PCR amplification program was as follows: initial denaturation at 98°C for 300 s; 33 cycles of denaturation at 98°C for 10 s, annealing at 55°C for 5 s, and extension at 72°C for 15 s, with a final extension of 30 s. All primers were synthesized by Genwizi (Suzhou, China).

[0061] The PCR amplification reaction system and PCR amplification procedure for the anti-PD-L1 nanobody target gene DNA fragment are as follows:

[0062] The PCR amplification reaction system consisted of 10 μL of high-fidelity polymerase 2× PrimeSTARMAX Premix, 7 μL of ddH₂O, 1 μL of forward primer (YS-PD-L1-F), 1 μL of rear primer (TY-PD-L1-R), and 1 μL of anti-PD-L1 nanobody DNA fragment (synthesized by GeneWeiZ (Suzhou, China)) for a total reaction volume of 20 μL. The PCR amplification program was as follows: initial denaturation at 98°C for 10 s; 33 cycles of denaturation at 98°C for 10 s, annealing at 57°C for 5 s, and extension at 72°C for 5 s, with a final extension of 30 s. All primers and DNA fragments were synthesized by GeneWeiZ (Suzhou, China).

[0063] The specific primer sequences are as follows:

[0064] csgA-F: 5'-TGACTGCTGCCACCGC-3'; SEQ ID NO.4;

[0065] TY-csgA-R:

[0066] 5'-GAACCACCGCCTCCAGACCCGTACTGATGAGCGGTCGCG-3'; SEQ ID NO.5;

[0067] YS-PD-L1-F:

[0068] 5'- GGGTCTGGAGGCGGTGGTTCT GCGCAAGTGCAGTTAGTGGAAAC-3'; SEQ ID NO.6; the underlined portion is the connecting peptide sequence;

[0069] TY-PD-L1-R:

[0070] 5'-CTCAGCGGTGGCAGCAGTCAATGGTGATGGTGATGGTGGCC-3'; SEQ ID NO. 7.

[0071] Next, 5 μL of 2× MultiF Seamless Assembly Mix, 3.5 μL of PCR amplification product containing the DNA fragment encoding the display protein csgA, and 1.5 μL of PCR amplification product containing the DNA fragment encoding the anti-PD-L1 nanobody target gene were incubated in a PCR instrument at 50°C for 30 minutes to synthesize the target gene module of the display protein csgA and the anti-PD-L1 nanobody (anti-PD-L1 nb) into the plasmid p15A-J23119-csgA-anti-PD-L1 nanobody. The constructed plasmid was chemically transformed into the DH5α competent strain and sent to Genwizi (Suzhou, China) for Sanger sequencing. Positive results were screened based on the sequencing results. The two cryptic plasmids pMUT1 and pMUT2 in the wild-type Escherichia coli Nissle 1917 (EcN) were knocked out to obtain the Escherichia coli Nissle 1917ΔΔ (EcNΔΔ) strain.

[0072] The preparation process of Escherichia coli Nissle 1917ΔΔ (EcNΔΔ) strain is as follows:

[0073] Wild-type Escherichia coli Nissle 1917 (WT EcN) contains two cryptic plasmids, pMUT1 and pMUT2. By introducing the suicide plasmid pRE112, the cryptic plasmids in WT EcN were knocked out to facilitate the subsequent introduction of functional plasmids.

[0074] Acquisition of cryptic plasmid plasmid maps: The complete sequence maps of pMUT1 and pMUT2 were obtained by searching NCBI. The NCBI reference sequences are NZ_MW240712.1 and NZ_CP023342.1, respectively.

[0075] Obtaining suicide plasmid pRE112: The suicide plasmid pRE112 was kindly provided by Professor Liu Jing from the School of Life Sciences, Tianjin University.

[0076] Obtaining the cryptic plasmid of WT EcN: WT EcN was inoculated into antibiotic-free LB liquid medium and cultured overnight before plasmid extraction. The obtained plasmid solution was a mixture containing two cryptic plasmids, pMUT1 and pMUT2. After the concentration was determined, it was stored at -4°C / -20°C for future use.

[0077] Construction of pMUT1-pRE112 plasmid (map see Figure 2 ) For knockout of cryptic plasmid pMUT1: pMUT1-pRE112 plasmid was constructed by homologous recombination.

[0078] PCR was performed using the pMUT1 plasmid as a template to obtain the backbone; PCR was performed using the pRE112 plasmid as a template to obtain the fragment. The specific steps and details are as follows:

[0079] Step 1: Perform PCR using pMUT1 as a template using primers pMUT1-F: caaagccaattactcctgacagtgg (SEQ ID NO. 8); pMUT1-R: cctgtaatgggttcatcgcttcaca (SEQ ID NO. 9). A 3317-bp nucleic acid sequence was obtained. After concentration determination, the sequence was stored at -4°C / -20°C until use.

[0080] Step 2: PCR was performed using pRE112 as a template using primers pRE112-F1: aactatataaaagcaggcaaatggctaaccgg (SEQ ID NO. 10); pRE112-R1: catatgggattcacctttatgttgataagaaataaaagaaaatg (SEQ ID NO. 11). A 6516-bp nucleic acid sequence was obtained, which was then concentrated and stored at -4°C / -20°C until use.

[0081] Step 3: Perform homologous recombination using the reaction system in Table 1 and the reaction procedure in Table 2:

[0082] Table 1 Homologous recombination reaction system

[0083]

[0084] Table 2 Homologous recombination reaction procedure

[0085]

[0086] Step 4: The recombinant product obtained in step 3 was chemically transformed into the DH5α competent strain and sent to GENEWIZ (Suzhou, China) for Sanger sequencing. The positive results were screened based on the sequencing results.

[0087] Step 5: Transform the sequenced plasmid into WT EcN competent cells to verify the correct positive clone (WT EcN with pMUT1-pRE112). First, subculture three times in LB liquid medium containing chloramphenicol (Cm) resistance. Spread an appropriate amount of the bacterial suspension onto a non-resistant LB plate and perform colony PCR to verify the presence of pMUT1. The primers used are: F1: caaacaatcaacgtttgcgccc (SEQ ID NO. 12); R1: cgagaaaaagctaacttcagtggcc (SEQ ID NO. 13). If pMUT1 is present, repeat the above steps. If pMUT1 is absent, eliminate the pMUT1-pRE112 plasmid in LB liquid medium containing 10% sucrose. After EcNΔpMUT1 withpMUT1-pRE112 was passaged three times in LB liquid medium containing 10% sucrose, colony PCR verification was performed using primers F1 / R1. If pMUT1-pRE112 was present, the above operation was repeated; if pMUT1-pRE112 was not present, the bacteria were shaken to obtain the Escherichia coli Nissle1917Δ (EcNΔ) strain, and the competent state was subsequently prepared.

[0088] Construction of pMUT2-pRE112 plasmid (map see Figure 3 ) For knockout of cryptic plasmid pMUT2: pMUT2-pRE112 plasmid was constructed by homologous recombination.

[0089] Perform PCR using the pMUT2 plasmid as a template to obtain the backbone; perform PCR using the pRE112 plasmid as a template to obtain the fragment. The specific steps and details are as follows:

[0090] Step 1: Perform PCR using pMUT2 as a template using primers pMUT2-F: gccatgtcattccgactaagcg (SEQ ID NO. 14); pMUT2-R: tgtacagcctggcattaagtggg (SEQ ID NO. 15). A 5514 bp nucleic acid sequence was obtained, which was then concentrated and stored at -4°C / -20°C until use.

[0091] Step 2: PCR was performed using pRE112 as a template using primers pRE112-F2: aactatataaaagcaggcaaatggctaaccg (SEQ ID NO. 16); pRE112-R2: catatgggattcacctttatgttgataagaaataaaagaaaatg (SEQ ID NO. 17). A 4760-bp nucleic acid sequence was obtained, which was then concentrated and stored at -4°C / -20°C until use.

[0092] Step 3: Perform homologous recombination using the reaction system in Table 3 and the reaction procedure in Table 4:

[0093] Table 3 Homologous recombination reaction system

[0094]

[0095]

[0096] Table 4 Homologous recombination reaction procedure

[0097]

[0098] Step 4: The recombinant product obtained in step 3 was chemically transformed into the DH5α competent strain and sent to GENEWIZ (Suzhou, China) for Sanger sequencing. The positive results were screened based on the sequencing results.

[0099] Step 5: Transform the sequenced plasmid into EcNΔ competent cells to verify the correct positive clone (WT EcNΔ with pMUT2-pRE112). First, subculture the clone three times in LB medium containing chloramphenicol (Cm) resistance. Then, perform colony PCR using primers F2: gccatgtcattccgactaagcg (SEQ ID NO. 18); R2: tgtacagcctggcattaagtggg (SEQ ID NO. 19) to check for the presence of the cryptic plasmid pMUT2. If pMUT2 is present, repeat the above steps. If pMUT2 is absent, eliminate the pMUT2-pRE112 plasmid in LB medium containing 10% sucrose. After subculture of EcNΔ pMUT1Δ pMUT2 with pMUT2-pRE112 three times in LB medium containing 10% sucrose, perform colony PCR using primers F2 / R2. If pMUT2-pRE112 is present, repeat the above steps; if pMUT2-pRE112 is not present, perform shake-incubation treatment to obtain Escherichia coli Nissle 1917ΔΔ (EcNΔΔ) strain, then prepare competent cells, introduce the exogenous plasmid, and perform functional verification.

[0100] Using a plasmid sample returned by GENEWIZ, the synthesized plasmid was chemically transformed into Escherichia coli Nissle 1917ΔΔ, a cryptic plasmid-deleted strain, to generate an engineered bacterium (EcNΔΔ-nb) capable of displaying the anti-PD-L1 nanobody on its surface. The primers used were synthesized by GENEWIZ (Suzhou, China).

[0101] The activated engineered bacteria (EcNΔΔ-nb) solution was mixed with 80% glycerol at a ratio of 1:1 and stored at -20°C.

[0102] Example 2

[0103] The engineered bacteria (EcNΔΔ-nb) were cultured in LB medium at 37°C and 220 rpm to express the anti-PD-L1 nanobody. The specific steps are as follows: the activated bacterial solution was inoculated into a shaker tube containing 6 mL of LB medium at a volume ratio of 1%, 100 mg / mL chloramphenicol was added to the medium at a ratio of 1:1000, and the culture was continued at 37°C and 220 rpm until the OD 600=0.6-1.2. When the OD600 of the bacterial solution is 1.0, 150 μL of overnight activated bacterial culture solution (containing chloramphenicol) is inoculated into a centrifuge tube containing 15 mL of culture medium and cultured at 37 ° C for 16 hours. 100 μL of bacterial suspension is drawn at 0, 1, 2, 3, ..., 12, 13, 14, 15, and 16 hours respectively, and the bacterial solution concentration (OD value) is measured at a wavelength of 600 nm to prepare a bacterial growth curve. According to the bacterial growth curve, the bacterial solution is cultured for 12 hours and the bacterial growth concentration enters the plateau phase. Take 1 mL of the bacterial solution at the plateau phase and dilute it 10 -7 , 10 -8 , 10 -9 The number of bacteria in the growth plate phase was 1×10 9 indivual.

[0104] The anti-PD-L1 nanobody protein was obtained by entrusting Aikesong Biotechnology Co., Ltd. (Tianjin, China) with protein purification services. The purified anti-PD-L1 nanobody protein was verified by SDS-PAGE protein electrophoresis gel. Figure 4 The molecular size of the purified protein is consistent with the size range of the target protein. Lane 1: DH5α; Lane 2: anti-PD-L1 nanobody (anti-PD-L1 nb).

[0105] Example 3

[0106] Construction of a lung local delivery system based on blood system engineered bacteria: According to the given culture conditions, the engineered bacteria with anti-PD-L1 nanobody display platform function were cultured in a shaker (37°C, 220 rpm) for 12-16 h to obtain the OD 600 =0.6-1.2 engineering bacteria liquid. Take 1mL of bacterial liquid and centrifuge (4000r / min, 1min), discard the supernatant; resuspend with 1mL PBS, let it stand for 5-10min, centrifuge the PBS bacterial suspension (4000r / min, 1min), discard the supernatant, repeat 2-3 times; after the last wash and centrifugation, discard the supernatant, resuspend with 1mL PBS, draw up the bacterial liquid with a 1mL insulin syringe, and inject it into the mouse through the tail vein ( Figure 5 ).

[0107] The functional assay techniques for evaluating the p15A-J23119-csgA-anti-PD-L1 nanobody plasmid are as follows:

[0108] The recombinant positive plasmid p15A-J23119-csgA-anti-PD-L1 nanobody was chemically transformed into Escherichia coli Nissle 1917ΔΔ to obtain the engineered bacterial strain (EcNΔΔ-nb). Escherichia coli Nissle 1917ΔΔ (EcNΔΔ) was used as a control group and inoculated into 15 mL of LB liquid medium at a ratio of 1:100 and cultured until the logarithmic phase (OD 600 =1.0), the bacterial solution was centrifuged at 12000r / min for 20min, and the supernatant and precipitate of the control group strain were collected; the engineered bacterial strain containing the p15A-J23119-csgA-anti-PD-L1 nanobody plasmid was inoculated into 15mL of LB liquid culture medium at a ratio of 1:100, and chloramphenicol was added to the culture medium at a ratio of 1:1000, and the culture was cultured to the logarithmic phase (OD 600 =1.0), the bacterial solution was centrifuged at 12000r / min for 20min, and the anti-PD-L1 nanobody strain supernatant and anti-PD-L1 nanobody strain precipitate were collected. The biological activity of the anti-PD-L1 nanobody protein was detected by Elisa. The secretion amount of anti-PD-L1 nanobody was relatively stable and reached 600pg / mL after 12h of culture. The results are shown in Figure 6 .

[0109] To evaluate the lung colonization efficiency of a localized lung delivery system based on intravenous injection of engineered bacteria via the blood circulation, the experimental techniques are as follows:

[0110] Four male C57BL / 6J mice aged 6 to 8 weeks were randomly divided into two groups, with two mice in each group: a control group and an EcNΔΔ-nb group. The control group received a tail vein injection of 1 mL of 0.01 M PBS solution, while the other group received a tail vein injection of 1 mL of 1×10 9 CFU / mL of engineered bacteria solution, the mice were returned to the cage, and after 30 minutes, the mice were killed by dislocating the neck. The heart, liver, spleen, lungs, and kidneys were removed from the body and placed in a small animal in vivo imager (IVIS Lumina S5). Appropriate imaging parameters were selected (generally excitation light wavelength 488nm, emission light wavelength 507nm), and imaging was started to record the distribution and intensity of the fluorescence signal in the mouse lungs. It can be clearly seen that the fluorescence signal is enriched in the mouse lungs, indicating that the engineered bacteria have successfully colonized the lungs. The results are shown in Figure 2. Figure 7 . Figure 7 From the organ imaging diagram, we can see that the engineered probiotics only colonize the lungs and metabolize in the liver, while important organs such as the heart and kidneys do not appear in the imaging.

[0111] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A p15A-J23119-csgA-anti-PD-L1 nanobody plasmid, characterized in that: Contains the coding gene sequence of bacterial surface display protein csgA, the flexible connecting peptide gene sequence, and the target gene sequence of immune checkpoint inhibitor anti-PD-L1 nanoantibody; The coding gene sequence of the bacterial surface display protein csgA is shown in SEQ ID NO.1; The target gene sequence of the immune checkpoint inhibitor anti-PD-L1 nanobody is shown in SEQ ID NO.2; The flexible connecting peptide sequence is: 5'-GSGGGGS-3'; The coding gene of the display protein csgA is connected to the target gene of the immune checkpoint inhibitor anti-PD-L1 nanobody through a flexible connecting peptide.

2. An engineered bacterium that biosynthesizes immune checkpoint blockers in situ in the blood circulation lungs, characterized in that: The engineered bacteria contains the p15A-J23119-csgA-anti-PD-L1 nanobody plasmid described in claim 1.

3. Use of the plasmid described in claim 1 or the engineered bacteria described in claim 2 in displaying anti-PD-L1 nanobody.

4. Use of the plasmid according to claim 1 or the engineered bacteria according to claim 2 in the preparation of drugs for targeted treatment of lung tumors.

5. A lung delivery system based on blood circulation drug delivery engineered bacteria, characterized in that: Contains the engineered bacteria according to claim 2.

6. A lung delivery system based on blood circulation drug delivery engineered bacteria according to claim 5, characterized in that: It is given by injection into a vein.

7. Use of a lung delivery system based on blood circulation drug delivery engineered bacteria as described in claim 5 or 6 in lung colonization.

Images