Recombinant NMNAT 1 and application thereof in NAD + synthesis

Abstract

The invention provides a recombinant NMNAT 1 and application thereof in NAD + synthesis, and belongs to the technical field of genetic engineering. According to the invention, a conventional NMNAT 1 gene sequence is subjected to codon optimization and then is transformed into escherichia coli, so that the expression quantity of NMAT1 can be obviously improved. After expression in an NAD < + > production strain, the production capacity of NAD < + > can also be improved, the accumulation amount of NAD < + > in 24-hour shake flask fermentation can reach 23.5 umol / g DCW, the production intensity and yield of NAD < + > can be remarkably improved, and better industrial application prospects are achieved.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to a recombinant NMNAT 1 and its application in NAD + synthesis. Background Art

[0002] NAD + Namely nicotinamide adenine dinucleotide, is an important coenzyme, participating in physiological functions such as oxidation-reduction and DNA repair, and has medical potential in aspects such as anti-aging, treating metabolic diseases and neurological diseases.

[0003] In the current technology of synthesizing NAD + by biological fermentation method, the key enzymes, cofactors, terminal metabolic pathways and energy metabolic pathways in the NAD + synthesis pathway are mainly optimized by using technologies such as DNA recombination and CRISPR / Cas9-mediated gene editing, in order to improve the production efficiency of the NAD + producing strain. The main problem existing in the synthesis of NAD + by fermentation method is that the catalytic efficiency of the endogenous NAD + key enzyme is low. Therefore, strategies such as simply increasing the supply of precursors and knocking out the terminal metabolism are difficult to significantly improve the yield.

[0004] Yang et al. constructed an NAD + synthesis pathway in Escherichia coli BL21 with nicotinic acid as a precursor. First, the genes related to terminal metabolism ushA , nudE , mazG , nudC were knocked out to block the degradation pathway and increase the accumulation of NAD + . Secondly, the key enzyme genes pncB and nadE involved in NAD+ synthesis were overexpressed. Finally, the precursor supply and energy metabolism were optimized to construct an NAD + high-yield strain, and the intracellular NAD + concentration reached 26.9 μmol / g DCW. Huang et al. screened out the key enzyme NAMPT and constructed a high-yield strain of the important intermediate NMN in the NAD + synthesis pathway. Wang et al. tried to mutate the endogenous NAD + synthetase NadD in Escherichia coli so that it could directly use NMN as a substrate to generate NAD + , however, the mutation of this enzyme affected the original metabolic network of the bacteria and inhibited the growth of the bacteria.

[0005] Currently, the biosynthesis of NAD + mainly adopts the metabolic pathway using NA or NAM as a precursor. In contrast, NAM as a precursor has low cost, and the synthesis of NAD+ Only two-step catalytic reactions are required, which have important research value. However, the catalytic efficiency of the key synthase of NAD + is low, and its weak activity is the main problem restricting the efficient synthesis of NAD + . Therefore, overexpressing or mutating the key synthase for endogenous NAD + synthesis has little effect on increasing the NAD + yield, and it is difficult to meet the requirements of industrial production. Therefore, screening for efficient key synthases for NAD + synthesis is the key to solving the problem. Summary of the Invention

[0006] The present invention provides a method for expressing an efficient nicotinamide mononucleotide adenylyltransferase and increases the NAD + yield, enabling efficient transcription in Escherichia coli and catalytically converting NMN into NAD in one step + .

[0007] The present invention retrieves, through a machine learning algorithm, a nicotinamide mononucleotide adenylyltransferase with high catalytic activity in Mus musculus , which can catalyze the adenylation of NMN to generate NAD + , and its coding gene is NMNAT 1 (Gene ID: 66454). When this gene is codon-optimized, it is successfully expressed in Escherichia coli and the ability to synthesize NAD + is correspondingly increased, effectively increasing the NAD + yield. Therefore, it has good application value in industrial production, and the specific operation method is as follows: Optimize and synthesize the Mus musculus gene according to the codon preference of the NMNAT 1 strain, add a HindIII restriction site (AAGCTT) and UTR (SEQ ID No. 2: TCTAGAGAAAGAGGAGAAATACTAG) at the 5', and integrate the gene into the vector pET-28a- Escherichia coli ( nadV ), and control the expression of this gene with a T7 promoter to obtain the plasmid pET-28a- Figure 1 as shown in Figure 2 . Transform pET-28a- nadV-NMNAT 1 and pET-28a- nadV into wild-type Escherichia coli BL21 respectively to obtain nadV-NMNAT 1 NS01 and E. coli NS02 strains. E. coli NS02 strains.

[0008] Using E. coli NS01 and E. coliThe NS02 strain was used for shake flask fermentation to produce NAD + The specific operations are as follows: Slant culture: The preserved strain at -80°C was streaked and inoculated on the activated slant, cultured at 37°C for 12 h, and subcultured once; Seed culture: One loop of slant seeds was scraped with an inoculation loop and inoculated into a shaking flask containing 5 mL of seed medium, cultured at 37°C and 220 rpm for 8 - 10 h; Shake flask fermentation culture: 1 mL of seed liquid was inoculated into a 250 mL baffled shake flask containing fermentation medium (final volume was 30 mL), sealed with a sealing film, cultured at 37°C and 220 rpm with shaking. During the fermentation process, 20 μL of 1M IPTG inducer and 1 mL of 30 g / L nicotinamide (NAM) solution were added. The fermentation cycle was 24 - 26 h.

[0009] The composition of the activation medium was: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar, the rest was water, pH 7.0 - 7.2, sterilized in a 121°C autoclave for 20 min; The composition of the seed medium was: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, the rest was water, pH 7.0 - 7.2, sterilized in a 121°C autoclave for 20 min; The composition of the fermentation medium was: 20 g / L glucose, (NH 4 ) 2 SO 4 5 g / L, KH 2 PO 4 12 g / L, MgSO 4 1 g / L, 5 g / L yeast extract, 1 g / L NaCl, 1.1 g / L citric acid, 10 g / L MOPS, the rest was water, pH 7.0 - 7.2, sterilized in a 115°C autoclave for 15 min.

[0010] After the culture was completed, the expression level was tested by the Bradford method, and the yield of NAD in the medium was detected by liquid chromatography. The results showed that NMNAT 1 the accumulation amount of NAD of the NS 02 strain during the 24 h fermentation process was 23.5 umol / g DCW, which was + 646.03% higher than that of NS 01. The experimental results proved that the E. coli gene optimized by codons could effectively increase the yield of NAD + . E. coli NS 01. The experimental results proved that the NMNAT 1 gene optimized by codons could effectively increase the yield of NAD + .

[0011] The gene involved in the present invention, after codon optimization of the gene sequence, its expression level in Escherichia coli increased by 1.51 times relatively. After expression in the NAD Mus musculus production strain, the production capacity of NAD NMNAT 1 was improved. The 24-hour shake flask fermentation results showed that the accumulation amount of NAD + could reach 23.5 umol / g DCW. The accumulation amount of NAD + in the control strain without introducing this gene was 3.15 umol / g DCW after 24-hour shake flask fermentation. In contrast, after introducing the + gene, the production intensity and yield of NAD + of the engineered strain were higher, and it had better industrial application prospects. NMNAT 1 gene + BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 is the plasmid map of pET-28a- nadV ; Figure 2 is the plasmid map of pET-28a- nadV-NMNAT 1 ; Figure 3 is NMNAT 1 the enzyme expression levels before and after codon optimization; Figure 4 is the liquid phase standard curve for NAD + concentration detection; Figure 5 is the fermentation yield graph of NAD + . DETAILED DESCRIPTION OF THE INVENTION

[0013] In order to further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they cannot be understood as limiting the protection scope of the present invention.

[0014] Example 1: NMNAT 1 Synthesis of nadV-NMNAT 1 and construction and transformation of the expression plasmid pET-28a- 1. Method for constructing the pET-28a- nadV-NMNAT 1 plasmid The Mus musculus gene sequence after codon optimization was directly synthesized by Genewiz (Suzhou) Inc. from NMNAT 1A gene with a gene sequence of SEQ ID No. 1. Add a HindIII restriction site (AAGCTT) and a ribosome binding site sequence (TCTAGAGAAAGAGGAGAAATACTAG) at the 5' end, and integrate it into the pET-28a- nadV plasmid to obtain pET-28a- nadV-NMNAT 1 , and the plasmid map is as shown in Figure 2 ; 2. E. coli NS 01 and E. coli Construction method of NS 02 strain Culture the BL21 strain in LB medium at 37 °C until OD E. coli = 0.5 - 0.6 to prepare chemically competent cells. Add 100 ng of pET-28a- 600 and pET-28a- nadV and pET-28a- nadV-NMNAT 1 plasmids to 100 μL of E. coli BL21 chemically competent cells. Gently mix and incubate on ice for 20 min, heat shock at 42 °C for 45 - 90 s, immediately incubate on ice for 2 - 3 min, add 900 μL of SOC, and recover at 37 °C for 1 h. Centrifuge at 8000 rpm for 2 min, discard part of the supernatant, leave about 200 μL, resuspend the cell pellet, and spread it on a plate containing 100 mg / L kanamycin. Invert the plate and culture it overnight at 37 °C. After single colonies grow on the plate, identify them by colony PCR, select positive recombinants to obtain E. coli NS 01 and E. coli NS 02.

[0015] Example 2: NMNAT 1 Determination of gene expression level Collect the Escherichia coli broth after induction culture, centrifuge at 4 °C and 5000 rpm for 10 min to collect the bacterial cells, and wash them twice with pre-cooled PBS; then add cell lysis buffer to resuspend, incubate at room temperature for 20 - 30 min for cell lysis, and use ultrasonic assistance if necessary; subsequently, centrifuge at 4 °C and 12000 rpm for 20 min, and take the supernatant to obtain a soluble protein extract.

[0016] Take appropriate samples of the protein extracts before and after optimization, add Coomassie Brilliant Blue G - 250 staining solution respectively, mix quickly and place at room temperature for 5 - 15 min to allow the protein to fully bind to the dye. Use a spectrophotometer to measure the absorbance of the samples before and after optimization and the uninduced group at a wavelength of 595 nm. By comparing the relative changes in the absorbance of the samples before and after optimization at 595 nm, the change in the expression level of the key enzyme is reflected, and the results are as shown in NMNAT 1 , and the results are as shown in Figure 3As shown, after optimized expression NMNAT 1 The absorbance at 595 nm is 1.51 times that of the non-optimized one.

[0017] Example 3: Shake flask fermentation of NAD using genetically engineered Escherichia coli + Shake flask fermentation of NAD using genetically engineered Escherichia coli + A specific operation is as follows: Slant culture: Take the preserved strain at -80°C and streak inoculate it on the activated slant, culture at 37°C for 12 h, and subculture once; Seed culture: Use an inoculation loop to scrape a loop of slant seeds and inoculate them into a shaking tube containing 5 mL of seed medium, culture at 37°C and 220 rpm for 8 - 10 h; Shake flask fermentation culture: Take 1 mL of seed liquid and inoculate it into a 250 mL baffled shake flask containing fermentation medium (final volume is 30 mL), seal it with a sealing film, culture at 37°C and 220 rpm with shaking. During the fermentation process, add 20 μL of 1M IPTG inducer and 1 mL of 30 g / L nicotinamide (NAM) solution. The fermentation period is 24 - 26 h; NAD in cells + Extraction: Take 900 μL of fermentation broth, add it to an EP tube containing 50 μL of KOH, invert and mix well, incubate on ice for 5 min. Add 50 μL of 1 mol HCl for neutralization. Centrifuge at 12000 rpm for 3 min. Aspirate the supernatant with a syringe, filter it through a 0.2 μm filter membrane and add it to a liquid phase tube for testing. The chromatographic conditions are as follows: Chromatographic column: Kromasil C18 column (250 mm×460 mm, 5 μm), mobile phase: 5 mM ammonium acetate solution and acetonitrile solution, flow rate: 1.0 mL / min, column temperature: 30°C, detection wavelength: 254 nm, injection volume: 20 μL, retention time is about 5 min. Calculate the concentration of NAD in cells according to the standard curve drawn based on its peak area; + concentration; NAD + Drawing of the standard curve: Respectively take solutions with NAD + concentrations of 20 μmol / L, 30 μmol / L, 40 μmol / L, 50 μmol / L, and 60 μmol / L, and determine the corresponding peak areas of NAD with the above chromatographic conditions by liquid phase measurement, and draw the relevant standard curve of the NAD + concentration and its peak area as + shown. Figure 4 shown.

[0018] Using the above constructed E. coli NS 01 andE. coli NS 02 was subjected to shake flask fermentation, and the experimental results are shown in Figure 5. NAD + engineered strain E. coli NS01 accumulated NAD + up to 3.15 umol / g DCW, E. coli NS 02 accumulated NAD + up to 23.5 umol / g DCW, compared with E. coli NS01, an increase of 646.03%.

[0019] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A method for increasing the yield of nicotinamide mononucleotide adenylyltransferase 1 in prokaryotic expression, characterized in that: The method comprises codon-optimizing a gene encoding nicotinamide mononucleotide adenylyltransferase 1, and then adding a restriction site and a ribosome binding site sequence to one end of the optimized fragment to obtain a recombinant nicotinamide mononucleotide adenylyltransferase 1 gene; the nucleotide sequence of the optimized fragment is shown in SEQ ID No. 1; The nicotinamide mononucleotide adenylyltransferase 1 recombinant gene is transformed into a prokaryotic expression cell, and purified after expression to obtain nicotinamide mononucleotide adenyltransferase 1.

2. The method according to claim 1, characterized in that: This includes adding restriction enzyme sites and ribosome binding site sequences to the 5' end of the optimized fragment.

3. The method according to claim 2, characterized in that: The restriction site includes a HindIII restriction site; the nucleotide sequence of the ribosome binding site sequence is shown in SEQ ID No.

2.

4. An expression vector for expressing a recombinant gene of nicotinamide mononucleotide adenylyltransferase 1, characterized in that: The nicotinamide mononucleotide adenylyltransferase 1 recombinant gene comprises a restriction site and a ribosome binding site sequence modified at one end of the sequence shown in SEQ ID No.

1.

5. An engineered bacterium comprising the expression vector of claim 4 and capable of producing high levels of nicotinamide mononucleotide adenylyltransferase 1.

6. The engineered bacteria according to claim 5, characterized in that: The chassis cells of the engineered bacteria include Escherichia coli cells.

7. The engineered bacteria according to claim 6 produce NAD + Application in.

8. A method for producing NAD using the engineered bacteria described in claim 6 + The method is characterized in that The following steps are involved: The seed liquid containing the engineered bacteria is inoculated into the fermentation medium for shaking fermentation, and IPTG and nicotinamide are added during the fermentation process. The obtained fermentation product contains NAD + .

9. The method according to claim 8, characterized in that: The fermentation medium contains components with the following concentrations: glucose 20 g / L, (NH4)2SO4 5 g / L, KH2PO4 12 g / L, MgSO4 1 g / L, yeast extract 5 g / L, NaCl 1 g / L, citric acid 1.1 g / L, MOPS 10 g / L, and the rest is water, with a pH of 7.0-7.

2.

10. The method according to claim 8, characterized in that: The frequency of the shaking culture is 220 rpm, the temperature is 37° C., and the time is 24 to 26 hours.

Images