Genetic transformation method and application of polygonatum kingianum
By introducing the target gene into Agrobacterium rhizobium and using specific liquid culture medium and infiltration solution to treat the rhizobium vol. The growth of hairy roots was successfully induced, and the problem of lack of genetic transformation methods for Polygonum vol. was solved, and efficient gene function identification was achieved.
Patent Information
- Application Number
- CN202510181469.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-19
- Publication Date
- 2025-05-30
AI Technical Summary
The lack of genetic transformation methods of Polygonatum lobes has hindered the progress of research on gene function and molecular breeding in medicinal plants.
By transforming the target gene into Agrobacterium rhizobacterium, recombinant Agrobacterium bacteria solution is obtained, and the rhizomes of Polygonatum are scratched and stained using specific liquid culture medium and dipping solution to induce the growth of hairy roots and achieve the introduction and expression of genes.
This method can efficiently and stably obtain transgenic hairy roots of Polygonatum glutinosa, without the need for sterile tissue culture, simplify the operation process and improve the efficiency of gene function identification.
Smart Images

Figure CN120060331A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a genetic transformation method and application of Polygonatum kingianum var. grandifolium, belonging to the technical field of genetic transformation. Background Art
[0002] Polygonatum kingianum was first recorded in "Shennong's Herbal Classic". It is flat in nature and sweet in taste, and has the effects of moistening the lungs and promoting the production of body fluids, benefiting the spleen and stomach, tonifying the kidney, and dispelling wind and dampness. Taking it for a long time can make the body light, prolong life, and not feel hungry. It is a traditional classic substance that is both food and medicine, and has great potential for solving hidden hunger. The original species of Polygonatum kingianum include three species: Polygonatum sibiricum, Polygonatum kingianum, and Polygonatum cyrtonema. As a variety of Polygonatum kingianum, Polygonatum kingianum var. grandifolium is widely cultivated as the medicinal material Polygonatum kingianum due to its large biomass, strong adaptability, good taste, etc. At present, there is no complete genetic transformation system for Polygonatum kingianum var. grandifolium to verify gene functions, which severely restricts its application development.
[0003] Hairy roots are a pathological state produced after Agrobacterium rhizogenes infects plants, characterized by strong biosynthesis ability and fast growth. Agrobacterium rhizogenes is a type of Gram-negative soil bacterium in the genus Agrobacterium of the family Rhizobiaceae. It can infect most dicotyledonous plants, a few monocotyledonous plants, and even gymnosperms, and induce plants to produce hairy roots. After the Ri plasmid in Agrobacterium rhizogenes is modified, its T-DNA fragment region can insert the target gene into the genome of the host plant, thus generating transgenic hairy roots. Due to the advantages of rapid growth, short cycle, no need for exogenous plant hormones, strong and stable ability to synthesize secondary metabolites, etc., hairy roots are widely used in the basic research of medicinal plants, providing broad prospects for the industrial production of secondary metabolites of medicinal plants. However, there is currently a lack of genetic transformation methods, and genes cannot be introduced into plants to verify their functions, seriously hindering the progress of gene function and molecular breeding research of medicinal plants. Summary of the Invention
[0004] Aiming at the deficiencies of the above-mentioned prior art, the present invention provides a genetic transformation method and application of Polygonatum kingianum var. grandifolium, aiming to solve the technical problem that the lack of genetic transformation methods currently seriously hinders the progress of gene function and molecular breeding research of medicinal plants.
[0005] The first technical solution provided by the present invention is a genetic transformation method of Polygonatum kingianum var. grandifolium, and the method includes the following steps:
[0006] (1) Transform the target gene into Agrobacterium to obtain a recombinant Agrobacterium liquid culture.
[0007] (2) Collect the recombinant Agrobacterium and resuspend it using a 1 / 2MS liquid medium containing acetosyringone, 2-(N-morpholino)ethanesulfonic acid, magnesium chloride, and surfactant SilWet to obtain an infection solution.
[0008] (3) Spread the recombinant Agrobacterium liquid culture from step (1) onto a TY plate containing the corresponding resistance and culture until the petri dish is covered with a uniform bacterial layer.
[0009] (4) Use the rhizome of Polygonatum kingianum as an explant, make surface scratches and / or superficial punctures on the explant, and infect the explant with the recombinant Agrobacterium liquid culture from step (1), the infection solution from step (2), and / or the bacterial layer on the plate from step (3).
[0010] (5) After the infection, transplant the explant into the pre-mixed vermiculite with 80% high humidity (the humidity of the vermiculite is such that when squeezed tightly by hand after mixing, no water drips), and at the same time pour the bacterial liquid and the infection solution after soaking in step (4) into the vermiculite to culture the explant.
[0011] (6) Perform fluorescence observation on the hairy roots growing at the wound sites, and obtain transgenic hairy roots after screening.
[0012] In some embodiments, in step (1), the Agrobacterium is Agrobacterium rhizogenes K599.
[0013] In some embodiments, in step (1), the target gene is the PkFT gene, and the nucleotide sequence of the PkFT gene is as shown in SEQ ID NO.1.
[0014] In some embodiments, in step (4), the concentration of acetosyringone is 29 - 30 μg / L, the concentration of 2-(N-morpholino)ethanesulfonic acid is 1 - 2 g / L, the concentration of magnesium chloride is 0.5 - 1 g / L, and the concentration of surfactant SilWet is 150 - 200 μL / L.
[0015] In some embodiments, in step (4), the method of infecting with the recombinant Agrobacterium liquid culture from step (1) is to soak the explant in the recombinant Agrobacterium liquid culture for 15 - 20 min.
[0016] In some embodiments, in step (4), the method of infecting with the infection solution from step (2) is to soak the explant in the infection solution for 15 - 20 min.
[0017] In some embodiments, in step (4), the method of using the bacterial layer on the plate in step (3) for infection treatment is to smear the explant with the bacterial layer.
[0018] In some embodiments, in step (5), the explant is cultured in an incubator at a temperature of 26°C / 22°C (day / night), with a light intensity of 16 h / 8 h of darkness, and a light intensity of 50 μmol·m-2·s-1.
[0019] In some embodiments, the method comprises the following steps: (1) Take out the Agrobacterium rhizogenes K599 bacterial liquid stored in a -80°C ultra-low temperature refrigerator, add a certain amount of the bacterial liquid to a liquid tryptone yeast extract mineral medium (TY) containing kanamycin and streptomycin, shake and activate the bacteria in a shaker at 28°C and 200 r, and take out the bacterial liquid when the bacterial concentration reaches 0.6-1.0 to obtain the bacterial liquid; transform the target gene into Agrobacterium rhizogenes to obtain a recombinant Agrobacterium rhizogenes bacterial liquid;
[0020] (2) After centrifuging the bacterial liquid at 4000 rpm for 30 min to obtain a precipitate and discarding the supernatant, resuspend it with a 1 / 2 MS liquid medium containing acetosyringone AS (29.88 μg / L), 2-(N-morpholino)ethanesulfonic acid MES (1.95 g / L), magnesium chloride MgCl 2 (0.95 g / L) and surfactant SilWet (200 μL / L) to obtain an infection solution:
[0021] (3) Take 700 μL of the recombinant Agrobacterium rhizogenes bacterial liquid in step (1) and evenly coat it on a TY plate with corresponding resistance, and culture it overnight at 28°C (for more than 24 h until the culture dish is covered with a uniform bacterial layer);
[0022] (4) Using the rhizome of two-year-old Polygonatum kingianum as an explant, make surface scratches and surface punctures on the explant, first soak it in the bacterial liquid in step (1) for 20 min, then soak it in the infection solution in step (2) for 15 min, and then smear it with the bacterial layer obtained in step (3);
[0023] (5) After the infection is completed, transplant the explant into the well-mixed high-humidity vermiculite (the humidity of the vermiculite is such that no water droplets drip when the vermiculite is tightly held by hand), and at the same time pour the bacterial liquid and the infection solution after soaking in step (4) into the vermiculite; and culture it in an incubator at a temperature of 26°C / 22°C (day / night), with a light intensity of 16 h / 8 h of darkness, and a light intensity of 50 μmol·m -2 ·s -1 -1;
[0024] (6) Perform fluorescence observation on the hairy roots growing at the wound, and obtain transgenic hairy roots after screening.
[0025] The second technical solution provided by the present invention is the application of the genetic transformation method described in the first technical solution in the identification of the gene function of Polygonatum kingianum.
[0026] The technical effects of the present invention are as follows:
[0027] The present invention provides a genetic transformation method for Polygonatum kingianum, an efficient genetic transformation system mediated by hairy roots. The explants of Polygonatum kingianum are infected with the engineering bacteria solution, and transgenic hairy roots are obtained. The infection process is simple and easy to learn, and the results are efficient and intuitive. Transgenic hairy roots of Polygonatum kingianum can be stably obtained. In the genetic transformation method of the present invention, scratches are made at the tender parts of the rhizome while preserving most of the fibrous roots during the induction method. Subsequently, the combined method of soaking and smearing can be used for the infection method to improve the induction efficiency, and the induction efficiency reaches 20%. Using the genetic transformation method of the present invention, transgenic roots can be obtained through the optimized hairy root system without sterile tissue culture. The obtained hairy roots can be applied to the identification of the gene function of Polygonatum kingianum (including the detection of the expression level of the transformed gene and the detection of the expression level of other target genes, etc.), laying a foundation for the genetic transformation system of Polygonatum kingianum. Description of the Drawings
[0028] Figure 1 It is the explant material of two-year-old Polygonatum kingianum.
[0029] Figure 2 Optimal treatment method for explant materials (scratches and punctures are made at the tender parts of the rhizome while preserving the fibrous roots).
[0030] Figure 3 It is the Polygonatum kingianum material after being infected with Agrobacterium tumefaciens K599 for 15 minutes.
[0031] Figure 4 It is the Agrobacterium rhizogenes-mediated transgenic system of Polygonatum kingianum (a): Agrobacterium rhizogenes induces hairy roots on the stem segments; (b): transgenic hairy root rooting system under natural light; (c) roots under fluorescence (GFP gene).
[0032] Figure 5 It is the PCR positive detection. Detailed Embodiments
[0033] The following are the preferred embodiments of the present invention. It should be understood that the embodiments are for better explaining the present invention and are not used to limit the present invention.
[0034] Raw materials used in the embodiments:
[0035] 1. The competent cells of Agrobacterium rhizogenes K599 are purchased from Shanghai Weidi Biotechnology Co., Ltd.
[0036] 2. TY Liquid Medium (1 L): 5 g of Tryptone + 3 g of Yeast extract, make up to 1 L with water. After complete dissolution, sterilize at 121 °C for 20 min. Prepare 1 M calcium chloride aqueous solution and sterilize at 121 °C for 20 min. Add 10 ml of sterile 1 M calcium chloride aqueous solution to each 1 L of sterilized TY liquid nutrient solution.
[0037] TY Solid Medium (1 L): 5 g of Tryptone + 3 g of Yeast extract + 15 g of agar powder, make up to 1 L with water. After complete dissolution, sterilize at 121 °C for 20 min. Prepare 1 M calcium chloride aqueous solution and sterilize at 121 °C for 20 min. Add 10 ml of sterile 1 M calcium chloride aqueous solution to each 1 L of sterilized TY liquid nutrient solution.
[0038] 3. 1 / 2 MS Liquid Medium (1 L): 2.2 g of MS powder + 15 g of sucrose, make up to 1 L with ddH2O. After complete dissolution, sterilize at 121 °C for 20 min.
[0039] Example 1 Establishment of an efficient genetic transformation system for the hairy roots of Polygonatum kingianum
[0040] The present invention provides a genetic transformation method for Polygonatum kingianum, comprising the following steps:
[0041] (1) Transform the target gene (PkFT gene) into Agrobacterium rhizogenes K599. The specific steps are as follows: Insert the target gene PkFT gene between the two restriction enzyme cleavage sites of XbalⅠ and StuⅠ of the pCAMBIA1380 vector (purchased from Shanghai Zeye Biotechnology Co., Ltd.) to obtain the recombinant plasmid pCAMBIA1380-PkFT. Transform the recombinant plasmid pCAMBIA1380-PkFT into the competent cells of Agrobacterium rhizogenes K599 to obtain recombinant Agrobacterium rhizogenes.
[0042] Perform bacterial inspection on the recombinant Agrobacterium rhizogenes: Use a 2 ml centrifuge tube, add 1 ml of liquid TY medium and add antibiotics (kan and str) at a concentration ratio of 1:1000; Pick single colonies from the plate and place them in the above 2 ml centrifuge tube, and culture overnight at 28 °C on a shaker; Use the bacterial liquid after overnight culture as a template and perform bacterial liquid PCR inspection with the primers in the following table.
[0043] Table 1 Primers for bacterial inspection
[0044] Primer Name Primer Sequence (5-3) EGFP-F ATGGTGAGCAAGGGCGAGGA EGFP-R AGCAGGACTCTAGGGACTAGTTCACTTGTACAGCTCGTCCAT
[0045] The PCR uses a 25 μL system (1 μL of template + 1 μL of upstream primer + 1 μL of downstream primer + 22 μL of S4 enzyme), and the amplification program is shown in the following table.
[0046] Table 2 Amplification System
[0047]
[0048] The detection results are as Figure 5 shown. The target band was detected by PCR, indicating that the gene has been successfully transferred into the hairy roots.
[0049] Select the bacterial solution with correct bacterial inspection and perform small-scale shaking. After small-scale shaking, take 700 μL of the bacterial solution and evenly coat it on the TY plate containing the corresponding resistance, and culture it overnight at 28 °C (for more than 24 h until the culture dish is covered with a uniform bacterial layer) for smearing the large-scale shaking bacterial solution cultured overnight at 28 °C. The OD600 of the large-scale shaking bacterial solution should be greater than 1.
[0050] (2) Preparation of the infection solution: After the large-scale shaking is completed, divide the large-scale shaking recombinant Agrobacterium bacterial solution into 12 50-ml tubes, centrifuge at 4000 rpm for 20 min, add 0.5 ml of 1 M MgCl 2 + 1 ml of 0.5 M MES for preparation + 83 μL of 100 μmol / L acetosyringone, and resuspend it to 50 ml with 1 / 2 MS culture solution to obtain the infection solution for soaking.
[0051] (3) Take 700 μL of the recombinant Agrobacterium bacterial solution and evenly coat it on the TY plate containing the corresponding resistance, and culture it overnight at 28 °C (for more than 24 h until the culture dish is covered with a uniform bacterial layer).
[0052] (4) Treatment of the explants: Select the rhizomes of Polygonatum kingianum that have grown for two years as the explants (as Figure 1 shown), make wounds on the surface of Polygonatum kingianum with a blade, and focus on scratching in the relatively tender white area (as Figure 2 shown). At the same time, cut the roots of Polygonatum kingianum to ensure there is space for scratching. Soak the wounded Polygonatum kingianum in the recombinant Agrobacterium bacterial solution prepared in step (1) for 15 - 20 min (as Figure 3 shown). Or smear it on the plate covered with bacteria at the cutting site so that the wound site is evenly smeared with Agrobacterium.
[0053] (5) Insert the Polygonatum kingianum that has completed the above treatment into the well-mixed high-humidity vermiculite (the humidity of the vermiculite is based on the standard that no water droplets drip when the vermiculite is tightly held by hand after mixing), and at the same time pour the infection solution back into the pot.
[0054] Cultivate the inoculated explants in the greenhouse (inductive culture of hairy roots), with the conditions of temperature 26 °C / 22 °C (day / night), light 16 h / dark 8 h, and light intensity 50 μmol·m -2 ·s -1 . During the induction period, cover it with a transparent moisture-proof plastic cover throughout the process for moisture retention, and at the same time make holes to prevent the death of Polygonatum kingianum due to excessive moisture. Dig it out after white new roots grow.
[0055] Example 2
[0056] Other conditions or parameters are the same as those in Example 1. The difference lies in step (4), where wounds are made on the surface of the polygonatum with a blade, focusing on scratching in the relatively tender white area. At the same time, a method of needle pricking is adopted to create small wounds on the surface of the polygonatum explant. Meanwhile, the roots of the polygonatum are cut to ensure there is space for scratching and needle pricking.
[0057] The polygonatum with wounds is soaked in the mixed solution of the recombinant agrobacterium liquid prepared in step (1) and acetosyringone for 30 min, and the cut part is smeared on the plate covered with bacteria, so that the wound part is evenly smeared with an agrobacterium bacterial layer.
[0058] Example 3
[0059] Other conditions or parameters are the same as those in Example 1. The difference lies in step (4), where wounds are made on the surface of the polygonatum with a blade, focusing on scratching in the relatively tender white area. At the same time, a method of needle pricking is adopted to create small wounds on the surface of the polygonatum explant. Meanwhile, a small amount of the roots of the polygonatum are cut to ensure there is space for scratching and needle pricking, and 2 - 4 roots are retained.
[0060] The polygonatum with wounds is soaked in the mixed solution of the recombinant agrobacterium liquid prepared in step (1) and acetosyringone for 30 min, and the cut part is smeared on the plate covered with bacteria, so that the wound part is evenly smeared with an agrobacterium bacterial layer.
[0061] Example 4
[0062] Other conditions or parameters are the same as those in Example 1. The difference lies in step (4), where wounds are made on the surface of the polygonatum with a blade, focusing on scratching in the relatively tender white area. Meanwhile, a small amount of the roots of the polygonatum are cut to ensure there is space for scratching, and 2 - 4 roots are retained.
[0063] The polygonatum with wounds is soaked in the mixed solution of the recombinant agrobacterium liquid prepared in step (1) and acetosyringone for 15 min.
[0064] Example 5
[0065] Other conditions or parameters are the same as those in Example 1. The difference lies in step (4), where wounds are made on the surface of the polygonatum with a blade, focusing on scratching in the relatively tender white area. Meanwhile, a small amount of the roots of the polygonatum are cut to ensure there is space for scratching, and 5 - 10 roots are retained.
[0066] The polygonatum with wounds is soaked in the infection solution prepared in step (2) for 15 min.
[0067] Example 6
[0068] Other conditions or parameters are the same as those in Example 1. The difference lies in step (4), where wounds are made on the surface of the polygonatum with a blade, focusing on scratching in the relatively tender white areas, and at the same time, the roots of the polygonatum are cut to ensure there are spaces for scratching.
[0069] The polygonatum with wounds is soaked in the impregnation solution prepared in step (2) for 15 minutes.
[0070] Example 7
[0071] Other conditions or parameters are the same as those in Example 1. The difference lies in step (4), where wounds are made on the surface of the polygonatum with a blade, focusing on scratching in the relatively tender white areas, and at the same time, the roots of the polygonatum are cut to ensure there are spaces for scratching and needle pricking.
[0072] The polygonatum with wounds is soaked in the impregnation solution prepared in step (2) for 15 minutes.
[0073] Example 8
[0074] Other conditions or parameters are the same as those in Example 1. The difference lies in step (4), where wounds are made on the surface of the polygonatum with a blade, focusing on scratching in the relatively tender white areas, and at the same time, the roots of the polygonatum are cut to ensure there are spaces for scratching.
[0075] The polygonatum with wounds is smeared on a plate covered with bacteria, so that the wound area is evenly smeared with an agrobacterium bacterial layer, and then soaked in the impregnation solution prepared in step (3) for 20 minutes.
[0076] Example 9
[0077] Other conditions or parameters are the same as those in Example 1. The difference lies in step (4), where wounds are made on the surface of the polygonatum with a blade, focusing on scratching in the relatively tender white areas, and at the same time, the roots of the polygonatum are cut to ensure there are spaces for scratching and needle pricking.
[0078] The polygonatum with wounds is soaked in the impregnation solution prepared in step (2) for 20 minutes.
[0079] Example 10
[0080] Other conditions or parameters are the same as those in Example 1. The difference lies in step (4), where wounds are made on the surface of the polygonatum with a blade, focusing on scratching in the relatively tender white areas, and at the same time, the roots of the polygonatum are cut to ensure there are spaces for scratching.
[0081] The polygonatum with wounds is soaked in the impregnation solution prepared in step (2) for 20 minutes, and the wound area is smeared on a plate covered with bacteria, so that the wound area is evenly smeared with an agrobacterium bacterial layer.
[0082] Example 11
[0083] Other conditions or parameters are the same as those in Example 1. The difference lies in step (4), where wounds are made on the surface of polygonatum with a blade, focusing on scratching in the relatively tender white area, and at the same time, the roots of polygonatum are cut to ensure there are vacancies for scratching.
[0084] The polygonatum with wounds is smeared on a plate covered with bacteria, so that the wound area is evenly smeared with an agrobacterium bacterial layer, and then it is soaked in the infection solution prepared in step (2) for 15 min.
[0085] Example 12
[0086] Other conditions or parameters are the same as those in Example 1. The difference lies in step (4), where wounds are made on the surface of polygonatum with a blade, focusing on scratching in the relatively tender white area, and at the same time, a method of pricking with a needle is used to create small wounds on the surface of the polygonatum explant. At the same time, a small amount of the roots of polygonatum are cut to ensure there are vacancies for scratching and pricking, and more than 15 roots are retained.
[0087] First, it is soaked in the bacterial solution in step (1) for 20 min, then soaked in the infection solution in step (2) for 15 min, and then the wound area is smeared on the plate covered with bacteria in step (3) so that the wound area is evenly smeared with an agrobacterium bacterial layer.
[0088] Test example
[0089] It takes 2 months for polygonatum to grow new roots and then fluorescence is observed under a microscope. During the growth induction period, the root-promoting nutrient solution is irrigated once a week. The root-promoting nutrient solution is 1 / 4 Hoagland's nutrient solution (weigh 0.945 g of reagent A, add it to 4 L of distilled water and dissolve it fully, then add 1.24 g of reagent B and dissolve it. Reagents A and B must not be directly contacted or mixed to avoid precipitation and inactivation). Take the lateral roots of the explants after 2 months and observe the fluorescence under a microscope (as Figure 4 shown).
[0090] And the infection rate is calculated, and the results are shown in Table 3.
[0091] Table 3 Experimental results
[0092]
[0093] In summary, the present invention provides the establishment of an efficient genetic transformation system for the hairy roots of Polygonatum kingianum PkFT. Through the described method, transgenic hairy roots of Polygonatum kingianum can be obtained simply, quickly, and efficiently without the need for aseptic conditions. The described method has obtained appropriate numbers of retained roots, infection solutions, infection methods, and soaking times through experiments, and then induced hairy roots containing the target gene by appropriate methods, and detected them by fluorescence observation and PCR, etc., laying a foundation for constructing a simple and efficient efficient genetic transformation system for the hairy roots of Polygonatum kingianum PkFT.
[0094] Although the present invention has been disclosed above in its preferred embodiments, it is not intended to limit the present invention. Any person skilled in this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.
Claims
1. A genetic transformation method of Polygonatum cyrtonema, characterized in that: The method comprises the following steps: (1) Transforming the target gene into Agrobacterium to obtain recombinant Agrobacterium bacterial solution; (2) collecting the recombinant Agrobacterium, and resuspending it in 1 / 2MS liquid culture medium containing acetosyringone, 2-morpholineethanesulfonic acid, magnesium chloride, and surfactant SilWet to obtain an infection solution; (3) Spreading the recombinant Agrobacterium solution from step (1) onto a TY plate containing the corresponding resistance, and culturing until the culture dish is covered with a uniform bacterial layer; (4) using the rhizome of Polygonatum cyrtonema as an explant, scratching and / or puncturing the surface of the explant, and using the recombinant Agrobacterium solution of step (1), the infection solution of step (2), and / or the bacterial layer on the plate of step (3) to perform an infection treatment on the explant; (5) After the infection is completed, the explants are transplanted into vermiculite that has been mixed with 80% humidity. At the same time, the bacterial solution and the infection solution soaked in step (4) are poured into the vermiculite to culture the explants.
2. The method according to claim 1, characterized in that In step (1), the Agrobacterium is Agrobacterium rhizogenes K599.
3. The method according to claim 1, characterized in that The target gene is the PkFT gene, and the nucleotide sequence of the PkFT gene is shown in SEQ ID NO.
1.
4. The method according to claim 1, characterized in that: In step (4), the concentration of acetosyringone is 29-30 μg / L, the concentration of 2-morpholineethanesulfonic acid is 1-2 g / L, the concentration of magnesium chloride is 0.5-1 g / L, and the concentration of surfactant SilWet is 150-200 μL / L.
5. The method according to claim 1, characterized in that: In step (4), the infection treatment using the recombinant Agrobacterium solution of step (1) is performed by soaking the explants in the recombinant Agrobacterium solution for 15 to 20 minutes.
6. The method according to claim 1, characterized in that In step (4), the impregnation treatment is performed using the impregnation solution of step (2) by soaking the explant in the impregnation solution for 15 to 20 minutes.
7. The method according to claim 1, characterized in that In step (4), the bacterial layer on the plate in step (3) is used for the infection treatment by smearing the explant with the bacterial layer.
8. The method according to claim 1, characterized in that In step (4), a 2-year-old rhizome of Polygonatum cyrtonema is used as an explant, and the surface of the explant is scratched and punctured, first soaked in the bacterial solution of step (1) for 15 to 20 minutes, then soaked in the infection solution of step (2) for 15 to 20 minutes, and then smeared with the bacterial layer obtained in step (3).
9. The method according to claim 1, characterized in that: In step (5), the explants were kept at a temperature of 26°C / 22°C (day / night), a light period of 16 h / darkness of 8 h, and a light intensity of 50 μmol·m -2 ·s -1 cultured in a culture room.
10. Use of the method according to any one of claims 1 to 9 in the identification of gene functions of Polygonatum cyrtonema.