HvSLAC1 protein as well as coding gene and application thereof

Abstract

The invention discloses an HvSLAC1 protein as well as a coding gene and application thereof. The invention proves that the HvSLAC1 gene participates in regulating and controlling the drought resistance of the plant through a transgenic means for the first time, the drought resistance of the plant is obviously reduced after the HvSLAC1 gene is knocked out, the drought resistance of the plant is obviously enhanced through overexpression of the HvSLAC1 gene, and damage caused by drought stress can be effectively relieved, so that the normal growth of the plant is maintained. The HvSLAC1 gene and the encoding protein thereof provided by the invention have the function of regulating and controlling the drought resistance of the plant, and can be widely applied to the breeding of stress-resistant transgenic plants.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant breeding, and particularly relates to the HvSLAC1 protein, its encoding gene and uses thereof. Background Art

[0002] Drought is one of the most important abiotic stresses limiting crop growth and production globally. During the long-term adaptation to drought stress, plants sense external stimuli, generate and transduce corresponding stress signals, thereby initiating various defense mechanisms to cope with the harm of drought stress. The drought resistance of plants is a complex quantitative trait. Although great progress has been made in the analysis of drought-related genes, the signal transduction and regulation mechanisms of related downstream genes are still unclear (Ligaba and Katsuhara, 2010, J Plant Res. 123:105-118).

[0003] Stomata located on the surface of plant leaves are important tissues for the gas and water exchange between terrestrial plants and the external environment, are closely related to water use efficiency, and affect the global water and carbon cycles (Berry et al., 2010; Chen et al., 2017; Hetherington et al., 2003). Stomatal guard cells integrate many signal pathways to regulate the size of stomatal aperture, and can quickly respond to external environmental stimuli, thereby helping plants respond to drought stress. It is generally believed that compared with other dicotyledonous plants and early-differentiated terrestrial plants such as ferns, Selaginella and mosses, etc., the stomata of gramineous plants have a faster response speed and tighter closure, thereby increasing the photosynthesis yield per unit area and improving the water loss caused by transpiration (Kollist et al., 2014). However, the mechanism by which the stomata of gramineous plants obtain a faster response to environmental stimuli is still unclear.

[0004] The main anion channel SLAC1 (Slow Anion Channel 1) that regulates stomatal closure is located downstream of the ABA signaling pathway. When ABA forms a complex with the receptor RCAR / PYR / PYL and the PP2C family member ABI1, the protein kinase OST1 is released. OST1 activates the activity of the SLAC1 anion channel through phosphorylation, promoting the efflux of anions from guard cells and causing stomatal closure (Lind et al., 2015; Roelfsema et al., 2012). It is currently known that Arabidopsis AtSLAC1 has 4 homologous genes (SLAC1 homologue, AtSLAH1 to AtSLAH4). Among them, AtSLAC1 and AtSLAH3 control the efflux of anions from the plasma membrane of guard cells, and this process is precisely regulated by ABA during drought-induced stomatal closure (Dreyer et al., 2012; Roelfsema et al., 2012). There are two activation mechanisms for the Arabidopsis anion channels SLAC1 and SLAH3: one is a calcium-signal-independent transduction pathway, that is, directly activated by the phosphorylation of OST1 (Geiger et al., 2009); the other is a calcium-signal-dependent transduction pathway, that is, activated by the phosphorylation of calcium-dependent protein kinases in guard cells (Zhang et al., 2016; Geiger et al., 2010; Brandt et al., 2012; Maierhofer et al., 2014; Hua et al., 2012; Chen et al., 2010). In addition, the anion selectivity of the anion channels SLAC1 / SLAHs varies greatly among different species. For example, BrSLAC1 in rapeseed and SlSLAC1 in tomato have both nitrate and chloride selectivity, while OsSLAC1 in rice and ZmSLAC1 in maize are both nitrate-selective, etc. (Brandt et al., 2012; Geiger et al., 2009; Sun et al., 2016; Qi et al., 2018).

[0005] Barley (Hordeum vulgare L.) is the fourth largest cereal crop globally and an ideal model plant for plant genetics and physiology research. Compared with other cereal crops, barley has stronger drought tolerance (Saisho and Takeda, 2011; Nevo et al., 2010). However, there is currently no report on the regulation of stomatal movement in response to drought stress by barley SLAC1. Therefore, it is of great significance to explore excellent drought-related genes, such as SLAC1 family members, from barley for improving and enhancing the drought tolerance of crops. Summary of the Invention

[0006] One object of the present invention is to provide the use of the HvSLAC1 gene in at least one of the following:

[0007] 1) Regulating plant drought tolerance;

[0008] 2) Preparation of products for regulating plant drought tolerance;

[0009] 3) Cultivation of drought-tolerant plants;

[0010] 4) Improvement of plant drought-tolerant germplasm resources;

[0011] The nucleotide sequence of the said gene contains SEQ ID No: 1.

[0012]

[0013] The second object of the present invention is to provide the use of the HvSLAC1 protein in at least one of the following aspects:

[0014] 1) Regulating the drought tolerance of plants;

[0015] 2) Preparing a product for regulating the drought tolerance of plants;

[0016] 3) Cultivating drought-tolerant plants;

[0017] 4) Improving plant drought-resistant germplasm resources;

[0018] The amino acid sequence of the said protein contains SEQ ID No:3.

[0019] In certain embodiments, the regulation is selected from: increasing the drought tolerance of plants by upregulating the activity and / or content of the HvSLAC1 protein; or, decreasing the drought tolerance of plants by inhibiting the activity and / or content of the HvSLAC1 protein. MAGAEPSSSSAGNGQHAAVDIRVAAAAAPEEPRQTSMSGPLNLRSDRRPPPPQRAFSRQVSLGSGVTVMGMDRGGRSGGGRPGQRALPRSGKSLGVLNHSGGLGPDGGARRGGDFSMFRTKSTLGKQNSMLPSRIKEELDSVDLDHVEGQPAGRPADVDPLNKSVPAGRYFAALRGPELDEVRDYEDILLPKDEVWPFLLRFPIGCFGVCLGLGSQAILWGALAASPAMGFLRVTPMINVAVWLLATAVLVATSVTYALKCVFYFEAIRREFFHPVRVNFFFTPSIAAMFLAIGLPRAFAPARLHPAVWCAFVAPLFALELKIYGQWLSGGKRRLCKVANPSSHLSVVGNFVGAILAARVGWEEAGKFLWAIGVSHYIVVFVTLYQRLPTNEALPMELHPVYSMFIATPSAAGLAWAAIYGSFDAVARTFFFMALFLYMSLVVRINFFRGFRFSIAWWSYTFPMTTASLATVKYAEAVPCFTSRALALSLSLMSTTMVSLLLVSTLLHAFYWRSLFPNDLAIAITKDRQGGAGRPHGKGRKAGKRVNDIKRWAKQVPLSVVSSITKTNSADKEEEEKTD*(SEQ IDNo:3)

[0020] A third object of the present invention is to provide the use of a biological material related to the HvSLAC1 gene in at least one of the following:

[0021] 1) Regulating plant drought tolerance;

[0022] 2) Preparing a product for regulating plant drought tolerance;

[0023] 3) Cultivating drought-tolerant plants;

[0024] 4) Improving plant drought-resistant germplasm resources;

[0025] The nucleotide sequence of the said gene contains SEQ ID No:1;

[0026] The said biological material is any one of the following:

[0027] A1) A recombinant expression vector containing the said nucleotide;

[0028] A2) A bioengineered bacterium containing the said nucleotide, or a bioengineered bacterium containing the recombinant expression vector described in A1).

[0029] In some embodiments, the said nucleotide can be inserted into an expression vector to form a recombinant expression vector. In a specific embodiment, the nucleotide of the HvSLAC1 gene is ligated to the pDONR TM / Zeo intermediate vector through a BP reaction, and then ligated to the pBract214 vector through an LR reaction to obtain a recombinant expression vector (overexpression vector) pBract214:HvSLAC1.

[0030] In some embodiments, the said bioengineered bacterium contains the recombinant expression vector as described above or the nucleotide is integrated into the genome as described above. Cultivate the bioengineered bacterium to enable it to express the protein. The bioengineered bacterium can be a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a plant cell. Representative examples are: Escherichia coli, Streptomyces, Agrobacterium; fungal cells such as yeast; plant cells, etc. It is not limited to the Agrobacterium AGL1, GV3101 and Escherichia coli DH5α used in the present application. Preferably, it is Agrobacterium AGL1.

[0031]

[0032] B1) Increase the activity of HvSLAC1 protein in the target plant to improve drought tolerance;

[0033] B2) Promote the expression of HvSLAC1 gene in the target plant to improve drought tolerance;

[0034] The amino acid sequence of the HvSLAC1 protein contains the sequence shown in SEQ ID NO.3.

[0035] The fifth object of the present invention is to provide a method for cultivating drought-tolerant plants, and the method includes one or more of the following steps:

[0036] C1) Increase the activity of HvSLAC1 protein in the target plant to obtain the drought-tolerant plant;

[0037] C2) Promote the expression of HvSLAC1 gene in the target plant to obtain the drought-tolerant plant;

[0038] The amino acid sequence of the HvSLAC1 protein contains the sequence shown in SEQ ID No:3.

[0039] In some embodiments, the plant is selected from barley. Preferably, it is Golden Promise barley.

[0040] Compared with the prior art, the present invention has the following beneficial effects:

[0041] 1. The present invention clones and analyzes the barley anion channel gene HvSLAC1 for the first time, publishes the nucleotide sequence and amino acid sequence of this gene, and has important significance for clarifying the molecular mechanism of barley drought resistance regulation and the cultivation of drought-resistant materials.

[0042] 2. The present invention confirms for the first time by transgenic means that the HvSLAC1 gene is involved in barley drought resistance. Among them, knocking out the HvSLAC1 gene significantly reduces the drought resistance of barley, while overexpressing the HvSLAC1 gene can significantly enhance the drought resistance of barley, effectively relieve the damage caused by drought stress, and thus maintain the normal growth of plants.

[0043] 3. The present invention points out that the functions of SLAC1 are not the same in different plants. If fully explored and effectively utilized, it will be beneficial to improve the drought resistance of barley varieties, and at the same time can also improve the stress resistance of other crops. Description of the Drawings

[0044] Figure 1 It is the structure diagram of the HvSLAC1 gene. The numbers represent base sites, the gray boxes represent exons, the black solid lines represent non-coding regions, and the pink boxes represent the 5'-UTR region and the 3'-UTR region respectively.

[0045] Figure 2 It is a schematic diagram of vector construction, where: a represents the construction diagram of the overexpression vector. The 35S promoter drives the resistance gene Hygromycin, the maize Ubi promoter (Ubi) drives the HvSLAC1 gene, attR1 and attR2 are the exchange positions of the LR reaction in the Gateway method, and NOS represents the terminator; B represents the construction diagram of the gene editing vector. The 35S promoter drives the resistance gene Hygromycin, the maize Ubi promoter (Ubi pro.) drives the Cas9 protein, and NOS represents the terminator.

[0046] Figure 3 It is the verification result of transgenic materials. Among them, (a) is the Sanger sequencing result of gene editing materials. As can be seen from the figure, compared with the wild type GP, there is an insertion of a T base at the 1090th position in the coding region of HvSLAC1 in the gene editing transgenic material, resulting in a frameshift mutation of the gene and loss of function; (b) is the agarose gel electrophoresis map of the PCR products of overexpression transgenic materials. M represents DNA marker DL2000 (Takara, Japan), PR is the amplified fragment of the pBract214:HvSLAC1 vector, HvSLAC1-OX-2 / 3 / 4 are 3 lines of overexpression transgenic plants, and WT represents that no fragment is amplified with the overexpression primer using the wild type GP material; (c) is the qRT-PCR result. Under normal growth conditions and drought treatment (soil water content < 10%), the expression level of this gene in 3 lines of overexpression (OE) plants is up-regulated by 2 - 5 times; (d) The fresh weight, dry weight, and water content of gene knockout and (e) overexpression transgenic plants were measured two weeks after drought treatment (soil water content < 10%).

[0047] Figure 4 It is the physiological phenotype diagram of the soil culture experiment results of transgenic materials. Seedlings at 3 weeks old were subjected to drought treatment for 2 weeks, and the drought resistance differences among wild type, gene knockout materials, and overexpression materials in the control group (left) and drought treatment group (right) were compared. GP: wild type; hvslac1: gene knockout transgenic material, HvSLAC1-OE: overexpression transgenic material. Specific implementation manners

[0048] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed descriptions are all exemplary and only a part of the embodiments of the present invention, rather than all the embodiments.

[0049] Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the scope of protection of the present invention.

[0050] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs. The experimental materials used in the embodiments of the present invention are all conventional experimental materials in this field and can be obtained through commercial channels. The experimental methods without detailed conditions are carried out according to conventional experimental methods or according to the operation manuals recommended by the suppliers.

[0051] In the present invention, unless otherwise specified, all parts and percentages are in weight units, and the equipment and raw materials used can be purchased from the market or are commonly used in this field. The methods in the following embodiments are all conventional methods in this field unless otherwise specified.

[0052] Toyobo KOD enzyme, purchased from Toyobo (Shanghai) Biotechnology Co., Ltd.;

[0053] pDONR TM / Zeo vector, provided by Dr. Zhonghua-Chen of the University of Western Sydney;

[0054] Agrobacterium tumefaciens AGL1, purchased from Shanghai Weidi Biotech Co., Ltd.

[0055] Example 1 Cloning of the barley anion channel HvSLAC1 gene

[0056] In this Example 1, the anion channel HvSLAC1 gene was cloned from barley.

[0057] 1.1. Treatment of plant materials

[0058] Barley Golden Promise seeds were disinfected with 2% H 2 O 2 for 20 min, rinsed 5 times with dd H 2 O 2 , and then germinated in a germination box with the ventral side of the seeds facing downwards. They were cultured in the dark in an incubator (14 h / 10 h, 22 °C / 18 °C, day / night) for 3 days, and supplemented with light after the shoots showed 2 cm of white tips above the ground. Barley seedlings at 7-day-old were quickly frozen in liquid nitrogen and stored at -70 °C for DNA and total RNA extraction.

[0059] 1.2. Extraction of total RNA from barley

[0060] Total RNA from barley was extracted using the Trizol method. Genomic DNA was removed using DNase I enzyme (Takara, Japan).

[0061] 1.3, Synthesis of cDNA

[0062] Using the RT reagent Kit Perfect Real Time (DRR037A) from Takara to reverse transcribe the total RNA extracted in step 1.2 above into single-stranded cDNA.

[0063] 1.4, Cloning of the HvSLAC1 gene

[0064] Using the cDNA in step 1.3 above as a template, primers were designed according to the ORF frame of the target gene, and KOD enzyme from Toyobo was used for PCR amplification respectively. The PCR system (50 μL) is shown in Table 1, and the PCR program is shown in Table 2.

[0065] Table 1

[0066] KOD buffer 25 μL KOD FX 1 μL dNTP 10 μL Primer F 1.5 μL Primer R 1.5 μL cDNA 0.5 μL <![CDATA[ddH 2 O]]> 10.5 μL Total 50 μL

[0067] Table 2

[0068]

[0069] Specific target bands were obtained. After gel cutting and recovery, the fragments were ligated into a T vector (TransGen Biotech), transformed into Escherichia coli DH5α, and positive clones were verified by PCR, and then sent to the company for sequencing. Primer synthesis and sequencing were both completed by Shanghai Sangon Biotech Co., Ltd.

[0070] Using DNA as a template, the full-length genomic sequence of 2120 bp amplified by DNA-F / R (Primer F / Primer R) is shown as SEQ ID No:1, and the primer information is:

[0071] DNA-F: 5’-ATCAATCCATAAATAGTAGTACTGTGTTC-3’ (SEQ ID No:4)

[0072] DNA-R: 5’-GAACACCCGAGTTCTTGC-3’ (SEQ ID No:5)

[0073] Using cDNA as a template, the full-length cDNA sequence of 1740 bp amplified by cDNA-F / R is shown as SEQ ID No:2, and the primer information is:

[0074] cDNA-F: 5’-ATGGCGGGAGCGGAGCCATC-3’ (SEQ ID No:6)

[0075] cDNA-R: 5’-CTAGTCTGTTTTCTCCTCTT-3’ (SEQ ID No:7)

[0076] The CDS nucleotide sequence of the HvSLAC1 gene was translated into an amino acid sequence of 588 aa using BioXM 2.6, as shown in SEQ ID No:3.

[0077] By analyzing the gene structure, it was found that this gene has 3 exon regions and 2 intron regions. The gene structure diagram is shown in the appendix Figure 1 .

[0078] Example 2 Verification of the function of the HvSLAC1 gene by CRISPR-Cas9 and overexpression transgenic methods

[0079] In this Example 2, expression vectors for overexpressing and knocking out the HvSLAC1 gene were constructed and then introduced into barley for drought resistance performance research.

[0080] 2.1 Construction of the pBract214:HvSLAC1 overexpression vector

[0081] Using the Gateway method (Invitrogen, USA), first, with the positive T vector containing cDNA in Example 1 above as a template, OE-HvSLAC1-F / R primers were designed to amplify a 1740 bp fragment covering the coding region of HvSLAC1. The primer information is as follows:

[0082] OE-HvSLAC1-F: 5’-ATGGCGGGAGCGGAGCCATC-3’ (SEQ ID No:8)

[0083] OE-HvSLAC1-R: 5’-CTAGTCTGTTTTCTCCTCTT-3’ (SEQ ID No:9)

[0084] After two rounds of PCR amplification, using the BP ClonaseTMII Enzyme Mix kit (Cat.No.11789-020, Invitrogen, USA) to introduce this 1740 bp fragment into the pDONR TM / Zeo vector (Life Technology). After transforming Escherichia coli DH5α, it was sent to the company for sequencing. A positive vector containing the target fragment with correct sequencing was selected, and then through The LR ClonaseTMII Enzyme Mix kit (Cat. No. 11791-020, Invitrogen, USA) was reacted with the expression vector pBract214 (from the John Innes Centre, UK, https: / / www.jic.ac.uk / ) to form an overexpression vector containing the target fragment. After transforming Escherichia coli DH5α and sequencing without error, the plasmid was extracted to obtain the pBract214:HvSLAC1 overexpression vector (see Appendix Figure 2 a).

[0085] 2.2 Construction of the HvSLAC1 gene editing vector

[0086] For the construction of the gene editing vector, the positive T vector containing cDNA in Example 1 above was used as a template, and a single-stranded RNA guiding molecule was designed to cover the 1083-1335 bp interval of the coding region of the coding gene HvSLAC1 shown in SEQ ID No: 2. The SgRNA sequence information is: ATCTACGGGCAGTGGCTGTC (SEQ ID No: 20), and the primer information is:

[0087] SLAC1-sg1F: 5’-CTTGTCTACGGGCAGTGGCTGTC-3’ (SEQ ID No: 10)

[0088] SLAC1-sg1R: 5’-AAACGACAGCCACTGCCCGTAGA-3’ (SEQ ID No: 11)

[0089] After one round of PCR amplification, it was ligated into the pTaU6:Cas9 vector at the BsaI site through an enzymatic reaction to construct (see Appendix Figure 2 b).

[0090] 2.3 Obtaining transgenic barley plants

[0091] The expression vectors constructed in steps 2.1 and 2.2 above were respectively introduced into Agrobacterium tumefaciens AGL1 by the heat shock method. The Agrobacterium tumefaciens containing the overexpression vector and the gene knockout vector (i.e., the gene editing vector) were successively transformed into the young embryos of barley GoldenPromise. After screening with hygromycin, dozens of transgenic candidate plants were obtained for both the overexpression material and the gene knockout material. Then, the DNA of the transgenic candidate plants and barley Golden Promise wild type (i.e., wild type GP) was extracted successively, and transgenic positive plants were obtained through the PCR verification method. The overexpression verification primers were PBR214-F / OEHvSLAC1-R, and the amplified fragment length was 1770 bp. The primer information is:

[0092] PBR214-F: 5’-GCTTTTTGTTCGCTTGGTTGTG-3’ (SEQ ID No:12)

[0093] OEHvSLAC1-R: 5’-CTAGTCTGTTTTCTCCTCTTCCTC-3’ (SEQ ID No:13)

[0094] Agarose gel electrophoresis map of the PCR products of the overexpressed transgenic materials, and the results are shown in b of 3. M represents DNA marker DL2000 (Takara, Japan), P R is the amplified fragment of the pBract214:HvSLAC1 vector. HvSLAC1-OX-2 / 3 / 4 are respectively three lines of the overexpressed transgenic plants. WT represents the wild-type GP material, and no fragment was amplified with the overexpression primers.

[0095] From Figure 3 b in it, it can be seen that among the three different overexpressed transgenic lines, the sampled individual plants (T2) all contain the overexpressed vector fragment, indicating that they are positive plants and can be used for subsequent experimental analysis.

[0096] For the verification of the gene knockout materials, Sanger sequencing was used to detect whether a T base was successfully inserted to cause a frameshift mutation. Two pairs of primers were used for amplification to ensure the accuracy of the detection. The amplified fragments were 375bp and 382bp respectively. The sequencing primer information is as follows:

[0097] KO-SLAC1-1F: 5’-ACCCTCTCAACAAGAGCGTC-3’ (SEQ ID No:14)

[0098] KO-SLAC1-1R: 5’-GCGTGAAGAAGAAGTTGACG 3’ (SEQ ID No:15)

[0099] KO-SLAC1-2F: 5’-AGCATGTTCCGGACCAAGTC-3’ (SEQ ID No:16)

[0100] KO-SLAC1-2R: 5’-ACACGGCGACGTTGATCATG-3’ (SEQ ID No:17)

[0101] The Sanger sequencing results of the gene-edited materials are shown in Figure 3 a in it.

[0102] From Figure 3As can be seen from a, compared with the wild-type GP, there is a T base insertion at the 1090th position in the coding region of HvSLAC1 in the gene-edited material, resulting in a frameshift mutation of the gene and loss of function, indicating successful construction.

[0103] After obtaining positive plants and multiplying them, harvest enough transgenic seeds for experiments.

[0104] 2.4. Comparison of drought resistance between overexpressing and gene-edited transgenic barley plants of HvSLAC1

[0105] Select 3 independent homozygous lines each of the overexpressing and gene-edited transgenic barley seeds of HvSLAC1 obtained in step 2.3 and 1 portion of wild-type barley seeds of Golden Promise in sequence.

[0106] Sow the seeds of 1 portion of wild type, 3 independent homozygous lines each of the overexpressing and gene-edited transgenic materials of HvSLAC1 simultaneously in black square culture pots that can hold 1 L of soil sample (the soil sample is obtained by mixing vermiculite and nutrient soil according to a mass ratio of 2:1), and then culture them in a culture room. The conditions of the culture room are: light intensity is 250 μmol m -2 s -1 , day and night temperature is 22 / 18 °C, and day and night duration is 14 / 10 h.

[0107] When the seedlings are 3 weeks old, set a control group (Control) and a drought treatment group (Drought) for each portion. Among them, the control group is watered with natural water (the soil water content is maintained between 40% - 50%), and the drought treatment group restricts watering (wait until the soil water content drops to about 10% and keep it for two weeks). Each genotype and treatment group are planted in 3 pots as replicates.

[0108] After 2 weeks of treatment, take pictures and observe. The results are shown in Figure 4 ; Collect the leaves of overexpressing barley of HvSLAC1, gene-edited transgenic barley and wild-type barley, and use qRT-PCR to detect the expression of genes in them. The results are shown in Figure 3 c; Statistically analyze the determination results of the fresh weight, dry weight and water content of the plants. The results are shown in Figure 3 d and e.

[0109] The specific steps of qRT-PCR detection are as follows: Transgenic and wild-type plants are subjected to drought treatment, and samples are taken from the above-ground parts of the plants. Using a plant RNA extraction kit (Aidlab, RN38 EASYspin Plus), total RNA from barley leaf controls and under drought treatment is extracted, and its quality is detected using 1% agarose gel electrophoresis, and the concentration and quality peak map are detected by NanoDroup. Using a reverse transcription kit (Takara, qScript cDNA Synthesis Kit), cDNA is synthesized from the extracted RNA and diluted 5-fold. Using a real-time fluorescence quantitative PCR premix (Aidlab, SYBR green PCRmaster mix) and a QuantStudio 6 (ABI) instrument for fluorescence quantitative PCR (qRT-PCR). Each treatment is performed with three biological replicates, and the expression level is calculated by the 2 -ΔΔCt method, with the barley HvActin gene used as an internal reference.

[0110] HvActin-F: TGGATCGGAGGGTCCATCCT (SEQ ID No:18)

[0111] HvActin-R: GCACTTCCTGTGGACGATCGCTG (SEQ ID No:19)

[0112] Fresh weight measurement: After sampling, it is weighed on a one-ten-thousandth balance.

[0113] Dry weight measurement: After the drought treatment is over, the above-ground stems and leaves of barley plants are collected, the samples are folded in half into small vertical strips and knotted, put into paper bags with corresponding numbers, and then placed in an oven at 65 °C for drying, which takes three days.

[0114] Water content measurement: The water content of the plants is calculated using the dry and fresh weights, and the formula is as follows: (fresh weight - dry weight) / fresh weight * 100%.

[0115] From Figure 3 the qRT-PCR results of c, it can be seen that the expression level of this gene in 3 lines of overexpressed (OE) plants under normal growth conditions and drought treatment (soil water content < 10%) is up-regulated by 2-5 times.

[0116] From Figure 3 it can be seen from e that for the gene knockout (hvslac1) plants, after drought treatment, their fresh weight, dry weight and water content are significantly reduced.

[0117] From Figure 3As can be seen from Table d, for the gene overexpression (HvSLAC1-OE) plants, after drought treatment, there were no significant changes in their fresh weight, dry weight, and water content.

[0118] There were obvious differences in drought resistance among the wild type, gene knockout materials, and overexpression materials in the drought treatment group (see Appendix Figure 4 ).

[0119] From Figure 4 it can be seen that after 2 weeks, the wild type GP barley in the drought treatment group showed yellowing and withering of the leaf tips, water loss and wilting, and it was semi-erect, but new leaves still grew; the gene knockout hvslac1 barley was extremely sensitive to drought stress, showing severe water loss, withering and yellowing of the leaves in the treatment group, unable to stand upright, and new leaves could not grow; the overexpressed HvSLAC1-OE barley was extremely drought-resistant, showing no wilting, withering, or yellowing of the leaves in the treatment group, and the plants could grow normally.

[0120] Taken together, the drought resistance of the HvSLAC1 overexpressing transgenic plants was significantly better than that of the wild type GP and gene knockout materials. Therefore, the drought resistance of barley can be improved by promoting the expression of the HvSLAC1 gene in barley plants.

[0121] The above-described embodiments are only a preferred solution of the present invention, and do not impose any form of limitation on the present invention. There are other variations and modifications without exceeding the technical solutions described in the claims. All nucleotide sequences of transcripts, genomes, and promoters related to the HvSLAC1 gene, amino acid sequences of encoded proteins, and biological materials containing any of the above genes belong to the protection scope of the present invention.

Claims

1. Use of the HvSLAC1 gene in at least one of the following: 1) Regulate plant drought tolerance; 2) preparing products for regulating plant drought tolerance; 3) Cultivate drought-tolerant plants; 4) Improvement of drought-tolerant plant germplasm resources; The nucleotide sequence of the gene comprises SEQ ID No:

1.

2. Use of HvSLAC1 protein in at least one of the following: 1) Regulate plant drought tolerance; 2) preparing products for regulating plant drought tolerance; 3) Cultivate drought-tolerant plants; 4) Improvement of drought-tolerant plant germplasm resources; The amino acid sequence of the protein comprises SEQ ID No:

3.

3. Use of biological materials related to the HvSLAC1 gene in at least one of the following: 1) Regulate plant drought tolerance; 2) preparing products for regulating plant drought tolerance; 3) Cultivate drought-tolerant plants; 4) Improvement of drought-tolerant plant germplasm resources; The nucleotide sequence of the gene comprises SEQ ID No: 1; The biological material is any of the following: A1) a recombinant expression vector comprising the nucleotide sequence; A2) A bioengineering bacterium comprising the nucleotide, or a bioengineering bacterium comprising the recombinant expression vector described in A1).

4. A method for regulating plant drought tolerance, characterized in that: The method comprises one or more of the following steps: B1) increasing the activity of HvSLAC1 protein in target plants to improve drought tolerance; B2) promoting the expression of HvSLAC1 gene in target plants to improve drought tolerance; The amino acid sequence of the HvSLAC1 protein comprises the sequence shown in SEQ ID No:

3.

5. A method for cultivating drought-tolerant plants, characterized in that: The method comprises one or more of the following steps: C1) increasing the activity of HvSLAC1 protein in the target plant to obtain the drought-tolerant plant; C2) promoting the expression of the HvSLAC1 gene in the target plant to obtain the drought-tolerant plant; The amino acid sequence of the HvSLAC1 protein comprises the sequence shown in SEQ ID No:

3.

6. The use according to any one of claims 1 to 3 or the method according to any one of claims 4 to 5, characterized in that: The plant is selected from barley.

Images