Method for promoting plant cuttage regeneration, related protein and application
By enhancing the expression of specific proteins in plants, promoting the production of plant lateral roots and the growth of primary roots, the problem of slow regeneration after cuttings is solved, and the root growth and regeneration rate of plants is improved.
Patent Information
- Application Number
- CN202510241257.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-03
- Publication Date
- 2025-05-30
AI Technical Summary
During plant cuttings, trees often die due to slow or less regeneration speed of uncertain roots, especially during the root transplantation process of Baimuxiang.
By enhancing or increasing the expression or activity of the gene encoding a specific protein in the plant, the production of plant lateral roots and primary root growth are promoted, thereby increasing the root length and number of lateral roots of the plant.
It significantly increases the number of lateral roots behind the plant cuttings and the length of the first roots, and improves the regeneration and survival rate of plants, especially during the root-breaking and transplanting of Baimuxiang.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and in particular relates to a method for promoting plant cutting regeneration, related proteins and applications. Background Art
[0002] Aquilaria sinensis Aquilaria sinensis (Lour.) Gilg is the only original plant of domestic agarwood in the Chinese Pharmacopoeia (2020 Edition). Its resin-containing wood is used as traditional Chinese medicine agarwood, which has the effects of promoting qi circulation to relieve pain, warming the middle-jiao to stop vomiting, and absorbing qi to relieve asthma. Modern pharmacological studies have shown that agarwood essential oil has antioxidant, neuroprotective, antibacterial and sedative effects. In the traditional agarwood production technique, there is a process of cutting off the roots and transplanting to promote agarwood formation, but during the transplantation process, the tree body often dies due to slow or few adventitious root regeneration. Summary of the Invention
[0003] The technical problem to be solved by the present invention is how to promote plant cutting regeneration and / or how to promote the growth of lateral roots after plant cutting and / or how to promote the number of plant lateral roots and / or how to increase the root length of plants and / or how to increase the number of lateral roots after plant cutting and / or how to promote the cutting regeneration of Aquilaria sinensis.
[0004] To solve the above technical problems, the present invention first provides a method for increasing the number of plant lateral roots and / or the length of primary roots, including increasing the number of plant lateral roots and / or the length of primary roots by enhancing or increasing the expression level of the coding gene of the protein in the target plant or the activity of the protein; the protein is the following protein: A1) A protein with an amino acid sequence of Sequence 2 in the sequence listing; A2) A protein derived from A1) obtained by substitution and / or deletion and / or addition of amino acid residues of the amino acid sequence shown in A1) and having the same function, or a protein having more than 80% identity with the protein shown in A1) and having the same function; A3) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of A1) or A2).
[0005] In the above method, the enhancement or increase of the expression level of the coding gene of the protein in the target plant or the activity of the protein can be achieved by introducing the coding gene of the protein into the target plant. The target plant can be any one of the following: D1) Magnoliopsida plants, D2) Malvales plants, D3) Thymelaeaceae plants, D4) Aquilaria plants, D5) Aquilaria sinensis; E1) Dicotyledonous plants, E2) Capparales plants, E3) Brassicaceae plants, E4) Arabidopsis plants, E5) Arabidopsis thaliana.
[0006] To solve the above technical problems, the present invention also provides a method for promoting the generation of lateral roots after cuttings are inserted or increasing the number of lateral roots after cuttings are inserted, which may include promoting the generation of lateral roots after cuttings are inserted or increasing the number of lateral roots after cuttings are inserted by enhancing or increasing the expression level of the coding gene of the protein in the cuttings or the activity of the protein; the protein is the protein described above.
[0007] In the above method, the enhancement or increase of the expression level of the coding gene of the protein in the cuttings or the activity of the protein may be achieved by introducing the coding gene of the protein described above into the cuttings.
[0008] In the above method, the cuttings may be the remaining part obtained after cutting off the main root of a plant. The cuttings may only include the above-ground part of the plant and do not include the underground part.
[0009] The above protein can be artificially synthesized, or its coding gene can be synthesized first and then biotically expressed.
[0010] In the above protein, the protein-tag refers to a polypeptide or protein that is fused and expressed together with the target protein by using DNA in vitro recombination technology for the purpose of facilitating the expression, detection, tracing, and / or purification of the target protein. The protein-tag may be a Flag tag, His tag, MBP tag, HA tag, myc tag, GST tag, and / or SUMO tag, etc.
[0011] In the above protein, identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using homology search sites on the Internet, such as the BLAST web page of the NCBI home page website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively and performing a search to calculate the identity of a pair of amino acid sequences, and then the identity value (%) can be obtained.
[0012] In the above protein, the identity of more than 80% may be at least 81%, 82%, 85%, 86%, 88%, 90%, 91%, 92%, 95%, 96%, 98%, 99%, or 100% identity.
[0013] The above-mentioned protein can be derived from Aquilaria sinensis (Lour.) Spreng.
[0014] In the above method, the cuttings are taken from any one of the following plants: D1) Magnoliopsida plants, D2) Malvales plants, D3) Thymelaeaceae plants, D4) Aquilaria plants, D5) Aquilaria sinensis (Lour.) Spreng.; E1) Dicotyledonous plants, E2) Capparales plants, E3) Brassicaceae plants, E4) Arabidopsis plants, E5) Arabidopsis thaliana.
[0015] In the above method, the coding gene of the protein can be first modified as follows and then introduced into the target plant to achieve better expression effects: 1) Connect with promoters expressed in various plants to facilitate its expression in plants; the promoters can include constitutive, inducible, temporal regulation, developmental regulation, chemical regulation, tissue-preferred and tissue-specific promoters; the selection of promoters will vary with the needs of expression time and space and also depends on the target species; for example, tissue or organ-specific expression promoters are determined according to the developmental stage of the receptor as needed; although it has been proven that many promoters derived from dicotyledonous plants are functional in monocotyledonous plants and vice versa, ideally, dicotyledonous plant promoters are selected for expression in dicotyledonous plants and monocotyledonous plant promoters are selected for expression in monocotyledonous plants; 2) Connect with suitable transcription terminators, which can also improve the expression efficiency of the gene of the present invention; for example, tml derived from CaMV and E9 derived from rbcS; any available terminator known to be functional in plants can be connected to the gene of the present invention; 3) Introduce enhancer sequences, such as intron sequences (e.g., derived from Adhl and bronzel) and viral leader sequences (e.g., derived from TMV, MCMV and AMV).
[0016] In the above method, the plants sensitive to stress can be transgenic plants or plants obtained by conventional breeding techniques such as hybridization.
[0017] In the above method, the transgenic plant is understood to include not only the first-generation to second-generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated in this species, or transferred into other varieties of the same species, especially commercial varieties, by conventional breeding techniques. The transgenic plants include seeds, callus, whole plants and cells.
[0018] To solve the above technical problems, the present invention also provides any one of the following applications of a protein or a protein-related biological material: P1. Application in promoting the generation or increasing the number of lateral roots of plants; P2. Application in increasing the root length of the primary roots of plants; P3. Application in promoting the generation or growth of lateral roots after cutting of plant cuttings; P4. Application in increasing the number of lateral roots after cutting of plant cuttings; P5. Application in promoting the regeneration or survival rate after cutting of plant cuttings; P6. Application in the preparation of agarwood; The protein may be the protein described above.
[0019] The biological material may be any one of the following: B1) A nucleic acid molecule encoding the protein described above; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) A recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) A transgenic plant tissue containing the nucleic acid molecule described in B1), or a transgenic plant tissue containing the expression cassette described in B2); B7) A transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2); B8) A nucleic acid molecule that promotes or enhances the gene expression of the protein described above; B9) An expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell line containing the nucleic acid molecule described in B8).
[0020] In the above applications, the nucleic acid molecule described in B1) may be the coding gene of the protein shown as follows: b1) The nucleotide is a DNA molecule of Sequence 1 in the Sequence Listing, b2) a cDNA molecule or a DNA molecule that hybridizes with the cDNA or DNA molecule defined in b1) and encodes a protein with the same function.
[0021] Among the above biological materials, the expression cassette containing a nucleic acid molecule described in B2) refers to DNA that can express the protein described in the above application in a host cell. This DNA may not only include a promoter that initiates transcription of the protein-coding gene, but also include a terminator that terminates transcription of the protein-coding gene. Further, the expression cassette may also include enhancer sequences. Promoters that can be used in the present invention include, but are not limited to: constitutive promoters, tissue-, organ- and development-specific promoters, and inducible promoters.
[0022] An existing plant expression vector can be used to construct a recombinant expression vector containing the expression cassette of the protein-coding gene. The plant expression vectors include binary Agrobacterium vectors and vectors that can be used for plant microprojectile bombardment, etc. Such as pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (from CAMBIA), etc. The plant expression vector may also contain the 3'-untranslated region of the foreign gene, that is, it contains a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression. The polyadenylation signal can direct the addition of polyadenylate to the 3' end of the mRNA precursor. For example, the nopaline synthase gene Nos ) of the Agrobacterium tumefaciens Ti plasmid gene and the 3'-untranslated regions transcribed by plant genes (such as soybean storage protein genes) have similar functions. When using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translational enhancers or transcriptional enhancers. These enhancer regions can be the ATG start codon or the start codon in the adjacent region, etc., but must be in the same reading frame as the coding sequence to ensure the correct translation of the entire sequence.
[0023] Among the above biological materials, the recombinant microorganism can specifically be yeast, bacteria, algae, and fungi.
[0024] Any of the following applications of the method described above also belongs to the protection scope of the present invention: Q1. Application in promoting the regeneration or survival rate after cutting of plant cuttings; Q2. Application in the preparation of agarwood.
[0025] The protein described above and / or the biological material described above also belongs to the protection scope of the present invention.
[0026] The present invention provides a transgenic method for promoting plant cutting regeneration by using the regeneration gene of Aquilaria sinensis (Lour.) Spreng., a plant origin of domestic Aquilaria, which helps to improve the survival rate of Aquilaria sinensis after root cutting transplantation, and can also be used to promote the regeneration efficiency after gene transformation. The present invention fills the research gap of directly regulating cutting regeneration of Aquilaria sinensis through regeneration genes, and provides a feasible solution for improving the survival rate of Aquilaria sinensis after root cutting transplantation. AsWOX11 The following description is provided to further detail the present invention in conjunction with specific embodiments. The examples given are only for clarifying the present invention and not for limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 Transgenic method for promoting cutting regeneration of Aquilaria sinensis. (A) Vector construction of Aquilaria sinensis; (B) Transgenic method for promoting cutting regeneration of Aquilaria sinensis. AsWOX11 FIG. AsWOX11 For promoting cutting regeneration of Aquilaria sinensis. (A) Aquilaria sinensis
[0028] Figure 2 FIG. AsWOX11 Functional verification of promoting cutting regeneration of Aquilaria sinensis. (A) PCR verification of transgenic Aquilaria sinensis (WT, wild type; +, positive control; CK, Aquilaria sinensis transformed with empty vector; AsWOX11, Aquilaria sinensis overexpressing AsWOX11 gene); (B) Promotion of adventitious root regeneration of cutting in Aquilaria sinensis; (C) Statistics of the number of transgenic adventitious roots in Aquilaria sinensis. AsWOX11 FIG.
[0029] Figure 3 FIG. AsWOX11 Functional verification of promoting root development of Arabidopsis thaliana by Aquilaria sinensis. (A) Root phenotype of transgenic Arabidopsis thaliana by Aquilaria sinensis; (B) Root cutting regeneration experiment of transgenic Arabidopsis thaliana by Aquilaria sinensis; (C) Statistics of root phenotype of transgenic Arabidopsis thaliana by Aquilaria sinensis; (D) AsWOX11 FIG. AsWOX11 For promoting root development of Arabidopsis thaliana by Aquilaria sinensis. (A) Root phenotype of transgenic Arabidopsis thaliana by Aquilaria sinensis; (B) Root cutting regeneration experiment of transgenic Arabidopsis thaliana by Aquilaria sinensis; (C) Statistics of root phenotype of transgenic Arabidopsis thaliana by Aquilaria sinensis; (D) AsWOX11 FIG. AsWOX11 Statistics of root cutting regeneration phenotype of transgenic Arabidopsis thaliana by Aquilaria sinensis.
[0030] Figure 4 FIG. p Schematic diagram of CAMBIA3301-35S-RUBY vector. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0031] The following further details the present invention in conjunction with specific embodiments. The examples given are only for clarifying the present invention and not for limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any limitation to the present invention in any way.
[0032] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.
[0033] The following examples used SPSS 11.5 statistical software to process the data. The experimental results were expressed as mean ± standard deviation. One-way ANOVA test was used, and P < 0.05 (*) indicated significant difference, P < 0.01 (**) indicated extremely significant difference, and P < 0.001 (***) indicated extremely significant difference.
[0034] Example 1. Aquilaria sinensis AsWOX11 Functional verification of the Aquilaria sinensis gene promoting cuttings regeneration 1. Cloning of the Aquilaria sinensis AsWOX11 gene Samples of Aquilaria sinensis roots were ground and crushed with liquid nitrogen. Total RNA was extracted using TRIzol Plant RNA Kit according to the TRIzol Plant RNA Kit instructions. The integrity of RNA was determined by 1% agarose gel electrophoresis, and the RNA content was measured by a nucleic acid / protein quantifier. cDNA was synthesized using M-MLV RTase cDNA Synthesis Kit (Takara) according to the M-MLV RTase cDNA Synthesis Kit (Takara) instructions. Using the obtained cDNA as a template, PCR amplification was performed with AsWOX11-F and AsWOX11-R to obtain PCR products. The primer sequences are as follows: AsWOX11-F: 5’-ATGGAAGAAGATCAAACTCAAGCTCAGCC-3’; AsWOX11 -R: 5’-TCAAGATGCTCTTGAAACCAGGAAATAGCT-3’. After gel recovery of the PCR products, cloning and sequencing were performed. The sequencing results were confirmed as the Aquilaria sinensis AsWOX11 gene (sequence 1 in the sequence listing) after alignment with smartBLAST. The amino acid sequence of AsWOX11 protein is shown as sequence 2 in the sequence listing.
[0035] Sequence 1 (5’-3’): ATGGAAGAAGATCAAACTCAAGCTCAGCCTCCGGACCCCAACAGTCCCAGCCACAGCTCTGAGAGATCCGAACCGGTTCGCTCTAGGTGGACACCCAAGCCGGAGCAAATCCTCATCCTGGAGTCCATCTTCAACAGCGGCATGGTGAACCCCGCCAAAGATGAAACCGTCCGAATCCGAAAGCTTCTAGAGAAGTTCGGCCCCGTGGGCGACGCCAACGTCTTCTACTGGTTCCAGAACCGCCGCTCCCGATCACGACGCCGCCAACGCCAGCTCCAGGCCCAGGCGCAGGCCAGTTACGGCAACAGCAACACGGCGACTGGTGCAATTCAGTTGGAAAACGGGTGCGGTGCTCCGGCGGCTTCGGCAGCCATGGGGCTCTTGCCTGCTACTTCTTGCTCGCCACCTGCGGCTTTTGGTTCGTCGCCGTCTCCGTCGTTCCTAGTGGGTTCGCCGTCGTCGTCGACTTCATGTGGCTCCGACAACGGAGCGGAGAGTCTGTTCCCGATGCCGGCTCAAGCGGGATTTCAGCAGATCGGTGAAAGCTCGTCCATCTTGTGTCCGACGGGGGGGTCCCAGAATTTACAGTACCAATCTGATTCGATCACAGTATTTATCAATGGAGTGGCGACAGCAGTTCCAAGAGGGCCGATCGACATAAAAGCAGCGTTTGGGGAAGACGTGATGTTGGTCCACTCCTCAGGCTTTCCTCTTCCCATGAATGACTTCGGCTGTCTTCTCCACAGCTTGCAACATGGTGAAAGCTATTTCCTGGTTTCAAGAGCATCTTGA。
[0036] Sequence 2: MEEDQTQAQPPDPNSPSHSSERSEPVRSRWTPKPEQILILESIFNSGMVNPAKDETVRIRKLLEKFGPVGDANVFYWFQNRRSRSRRRQRQLQAQAQASYGNSNTATGAIQLENGCGAPAASAAMGLLPATSCSPPAAFGSSPSPSFLVGSPSSSTSCGSDNGAESLFPMPAQAGFQQIGESSSILCPTGGSQNLQYQSDSITVFINGVATAVPRGPIDIKAAFGEDVMLVHSSGFPLPMNDFGCLLHSLQHGESYFLVSRAS。
[0037] 2. Construction of transgenic vector and transformation of Agrobacterium tumefaciens 2.1 Obtaining of overexpression recombinant vector The p CAMBIA3301 plasmid (Cambia) was modified by changing the position of the GUS gene in the plasmid to the RUBY gene, and a p CAMBIA3301-35S-RUBY vector with 35S as the promoter was constructed (see the vector schematic diagram in Figure 4 , and the RUBY sequence is shown in detail in Sequence 3. The public can obtain it from the applicant and is only used to repeat this invention and cannot be used for other purposes). The purified PCR product (containing the Aquilaria sinensis AsWOX11 gene) obtained in Step 1 was digested with BamHI and SalI to obtain a large fragment, which was ligated to the p CAMBIA3301-35S-RUBY vector (the large fragment after double digestion) that was also digested with BamHI and SalI to obtain the recombinant vector p CAMBIA3301- AsWOX11 . As shown in the schematic diagram in Figure 1 , the empty vector was used as the control CK (CK in A in Figure 1 ), and the recombinant vector was Figure 1 A in AsWOX11 as shown.
[0038] 2.2 Plasmid extraction of overexpression recombinant vector and Agrobacterium transformation The recombinant vector p CAMBIA3301- AsWOX11 obtained in Step 2.1 was transformed into Escherichia coli to obtain recombinant Escherichia coli. The recombinant Escherichia coli broth was shaken and propagated, and the plasmid was extracted to obtain the plasmid of the recombinant vector p CAMBIA3301- AsWOX11 .
[0039] Prepare the competent cells of Agrobacterium tumefaciens GV3101 according to the instruction manual of the Agrobacterium Competent Cell Preparation Kit (Beyotime Biotechnology, Shanghai), and carry out Agrobacterium transformation according to the following steps: Add 0.1 - 1 μg of p the plasmid DNA of CAMBIA3301-35S-RUBY (empty vector) or the recombinant vector p CAMBIA3301- AsWOX11 to every 50 μL of the competent cells of Agrobacterium tumefaciens GV3101; Let it stand on ice for 15 - 20 min; Quick-freeze it in liquid nitrogen for 1 - 3 min, and immediately put it into a 37 °C water bath for 5 min; Add 500 μL of LB liquid medium, and culture it on a shaker at 30 °C and 200 rpm for 4 h; Pipette 100 μL of the cultured bacterial liquid and spread it evenly on the solid LB medium containing 50 μg / mL of streptomycin and kanamycin; Culture it in an incubator at 30 °C for 2 days, and then pick the selected positive single colonies to obtain the recombinant Agrobacterium.
[0040] By transforming the empty plasmid or the recombinant vector p CAMBIA3301- AsWOX11 into Agrobacterium tumefaciens, the recombinant Agrobacterium tumefaciens GV3101 / p CAMBIA3301-35S-RUBY and GV3101 / p CAMBIA3301- AsWOX11 are obtained respectively.
[0041] 3. Infect the cut root Aquilaria sinensis seedlings with Agrobacterium tumefaciens Expand the culture of the two kinds of recombinant Agrobacterium tumefaciens GV3101 (Luria-Bertani (LB) liquid medium containing 50 μg / mL of streptomycin and kanamycin and 200 μM of acetosyringone) to an OD 600nm value of about 0.8 to obtain the infection solutions of the two kinds of recombinant Agrobacterium (recombinant Agrobacterium tumefaciens GV3101 / p CAMBIA3301-35S-RUBY and GV3101 / p CAMBIA3301- AsWOX11 ).
[0042] To prepare Aquilaria sinensis for the transformation process, carefully take it out of the soil, gently rinse the roots to remove the attached soil particles, and trim the main root below the soil surface. Cut off the excess lateral roots and most of the leaves, and only retain 2 to 4 young leaves to obtain the cuttings of Aquilaria sinensis seedlings for the convenience of the infection process ( Figure 1(B). The Aquilaria sinensis seedling cuttings were briefly (1.5 hours) soaked in the recombinant Agrobacterium infection solution to ensure that the cut surface was fully covered, and then transplanted to sterilized moist vermiculite or soil for growth. 3 to 5 ml of the recombinant Agrobacterium infection solution was gently poured on the soil surface to allow it to penetrate and saturate the root zone. Subsequently, the Aquilaria sinensis seedling cuttings that had been briefly soaked were placed in the culture medium (soil) that had been watered with the recombinant Agrobacterium and cultured at 25°C with a controlled light cycle of 16 hours of light and 8 hours of darkness to promote optimal growth and transformation efficiency. Finally, the empty-transfected (recombinant Agrobacterium tumefaciens GV3101 / p CAMBIA3301-35S-RUBY) and transfection AsWOX11 Gene (recombinant Agrobacterium tumefaciens GV3101 / p CAMBIA3301- AsWOX11 ) of Aquilaria sinensis seedlings.
[0043] 4. AsWOX11 Observation and statistics on gene-promoting regeneration of Aquilaria sinensis from cuttings Through the genetic transformation method of step 3, the present invention obtains the empty load and overexpression AsWOX11 By extracting wild-type Aquilaria sinensis seedlings (WT), empty-transfected (CK) and transfected overexpressed AsWOX11 The DNA of the Aquilaria sinensis seedlings with the gene was used to verify the RUBY fragment by PCR. The primer sequences are as follows: UBQ-F: 5'-CGATTAGGGTTTCATAGATATCATCC-3'; NOCA-R: 5'-TGGAGAAACTCGAGTGATCTAG-3'.
[0044] The Aquilaria sinensis seedlings with amplified DNA fragments of about 1800 bp are the positive seedlings with successful genetic modification ( Figure 2 The CK in A represents the PCR product test result of the transgenic seedlings after empty vector transfer. Figure 2 A AsWOX11 Represents transexpression AsWOX11 PCR product detection results of transgenic seedlings after transgenic). Through phenotypic observation (observation of the roots of transgenic seedlings 60 days after transgenic), the results showed that compared with the empty-transfected Agrobacterium tumefaciens ( Figure 2 The transgenic seedlings expressed AsWOX11 The number of adventitious roots in the cuttings of Aquilaria sinensis seedlings with the gene was significantly increased ( Figure 2 Medium B AsWOX11 Representative); Statistical results showed that the number of adventitious roots of transgenic seedlings was 46±5 compared with that of the empty-transfected Agrobacterium tumefaciens ( Figure 2 CK in C stands forAsWOX11 The adventitious root number of the transgenic seedlings of the gene increased to 71 ± 14 ( Figure 2 represented by C in AsWOX11 ). Therefore, AsWOX11 Overexpression of the gene can significantly increase the adventitious root number of Aquilaria sinensis cuttings, thus promoting the cutting regeneration of Aquilaria sinensis.
[0045] Example 2. Functional verification of Aquilaria sinensis AsWOX11 in regulating Arabidopsis root development 1. Preparation of Aquilaria sinensis AsWOX11 transgenic Arabidopsis The wild-type Arabidopsis used in this invention is the Arabidopsis Col-0 type. Using the recombinant GV3101 Agrobacterium tumefaciens containing the overexpressed AsWOX11 gene obtained in step 3 of Example 1 (GV3101 / p CAMBIA3301- AsWOX11 ), Arabidopsis was infected by the floral dipping method. After the transformed Arabidopsis matured, the fruit pods were cut and seeds were collected. The seedlings grown from the seeds were the T 0 generation Arabidopsis transgenic plants. The T 0 generation transgenic plants were self-crossed for 2 generations respectively to obtain the T 2 generation transgenic plants. Positive transgenic plants were detected according to the method in step 4 of Example 1 for each generation. Seeds of the T 2 generation Arabidopsis transgenic plants were used for phenotypic detection and observation.
[0046] 2. Detection of Arabidopsis root development indexes T 2 generation transgenic Arabidopsis seeds were grown in a controlled environment: the temperature was 22 °C, and the light cycle was 16 hours of light and 8 hours of darkness. The seeds were cultured on 1 / 2 Murashige and Skoog (MS) basal medium supplemented with 1% sucrose and 2-(N-morpholino)ethanesulfonic acid (MES). Three batches of different AsWOX11 transgenic Arabidopsis lines ( WOX11-1 , WOX11-4 and WOX11-6 ) were obtained through step 1, with 20 seedlings in each group. When the root length of the Arabidopsis seedlings grown in the medium reached 1 cm, they were transferred to a new 1 / 2 MS medium. After 7 days of growth, their root development phenotypes were observed.
[0047] In the root regeneration experiment, when the Arabidopsis root grew to about 1 cm, the root was carefully excised with a blade, ensuring the removal of the quiescent center (QC) and adjacent root tips, and then cultured in 1 / 2 MS medium. Subsequently, the seedlings were photographed and recorded.
[0048] 3.AsWOX11 Observation and Statistics of Gene Regulation on Arabidopsis Root Development In the group without root cutting treatment, AsWOX11 the number of lateral roots of transgenic Arabidopsis thaliana ( Figure 3 represented by WOX11-1 、 WOX11-4 and WOX11-6 and Figure 3 represented by WOX11 in Figure 3 the right figure of Figure 3 in Figure 3 represented by Figure 3 in AsWOX11 A and C, P < 0.01) and the primary root length (
[0049] the left figure of AsWOX11 in Figure 3 represented by WOX11-1 、 WOX11-4 and WOX11-6 and Figure 3 in WOX11 represented by Figure 3 in Figure 3 the left figure of AsWOX11 the right figure of Figure 3 in Figure 3 represented by AsWOX11 in AsWOX11 represented by
[0050] The above details the present invention. For those skilled in the art, without departing from the purpose and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although the present invention gives specific embodiments, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that are outside the scope disclosed in this application.
Claims
1. A method for increasing the number of lateral roots and / or the length of primary roots of a plant, comprising increasing the number of lateral roots and / or the length of primary roots of a plant by enhancing or increasing the expression of a gene encoding a protein in a target plant or the activity of the protein; the protein is the following protein: A1) The amino acid sequence is the protein of sequence 2 in the sequence listing; A2) A protein derived from A1) or having more than 80% identity with the protein shown in A1) and having the same function, obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in A1); A3) A fusion protein obtained by connecting a protein tag to the N-terminus or / and C-terminus of A1) or A2).
2. The method according to claim 1, characterized in that: The enhancement or increase of the expression level of the protein encoding gene in the target plant or the activity of the protein is achieved by introducing the protein encoding gene into the target plant.
3. The method according to claim 1 or 2, characterized in that: The target plant is any one of the following: D1) Magnoliaceae, D2) Malvaceae, D3) Daphneaceae plants, D4) Aquilaria plants, D5) Aquilaria sinensis; E1) Dicotyledons, E2) Capparisales plants, E3) Cruciferous vegetables, E4) Arabidopsis thaliana, E5) Arabidopsis thaliana.
4. A method for promoting the production of lateral roots or increasing the number of lateral roots after cuttings are cut, comprising promoting the production of lateral roots or increasing the number of lateral roots after cuttings are cut by enhancing or increasing the expression level of a gene encoding a protein in the cutting or the activity of the protein; the protein is the protein described in claim 1.
5. The method according to claim 4, characterized in that: The enhancement or increase of the expression level of the gene encoding the protein in the cuttings or the activity of the protein is achieved by introducing the gene encoding the protein in claim 1 into the cuttings.
6. The method according to claim 4 or 5, characterized in that: The cuttings are the remaining parts of the plant after cutting off the main root.
7. The method according to any one of claims 4 to 6, characterized in that: The cuttings are taken from any of the following plants: D1) Magnoliaceae, D2) Malvaceae, D3) Daphneaceae plants, D4) Aquilaria plants, D5) Aquilaria sinensis; E1) Dicotyledons, E2) Capparisales plants, E3) Cruciferous vegetables, E4) Arabidopsis thaliana, E5) Arabidopsis thaliana.
8. Any of the following applications of proteins or protein-related biomaterials: P1. Application in promoting the production or number of lateral roots of plants. P2. Application in increasing the length of primary roots of plants. P3. Application in promoting the production or growth of lateral roots after plant cuttings. P4. Application in increasing the number of lateral roots after plant cuttings. P5. Application in promoting the regeneration or survival rate of plant cuttings after cuttings; P6, application in the preparation of agarwood; The protein is the protein described in claim 1; The biological material is any of the following: B1) a nucleic acid molecule encoding the protein according to claim 1; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); B5) a transgenic plant cell line containing the nucleic acid molecule described in B1) or a transgenic plant cell line containing the expression cassette described in B2); B6) transgenic plant tissue containing the nucleic acid molecule described in B1) or transgenic plant tissue containing the expression cassette described in B2); B7) a transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2); B8) A nucleic acid molecule that promotes or increases the gene expression of the protein according to claim 1; B9) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line containing the nucleic acid molecule described in B8); B1) The nucleic acid molecule is a gene encoding a protein as shown below: b1) The nucleotide is the DNA molecule of sequence 1 in the sequence list, b2) A cDNA molecule or a DNA molecule that hybridizes with the cDNA or DNA molecule defined in b1) and encodes a protein having the same function.
9. Any of the following uses of the method according to any of claims 4 to 7: Q1. Application in promoting the regeneration or survival rate of plant cuttings; Q2. Application in the preparation of agarwood.
10. The protein according to claim 1 and / or the biomaterial according to claim 7 or 8.