Application of OsPCF7 or mutant thereof in regulation and control of heading stage of rice

Abstract

The invention belongs to the technical field of plant biology, and discloses an application of a rice gene OsPCF7 and a mutant thereof in heading stage regulation, the OsPCF7 mutant is constructed through a CRISPR-Cas9 technology, and a biological material containing the mutant is developed; experiments show that overexpression of the OsPCF7 or the mutant thereof can significantly advance the heading stage of rice, the mutant shows a stable early heading phenotype under long / short day conditions, and the plant height, the tiller number and the yield are not significantly affected. According to the mutant, through targeted editing of TCP structural domains (such as target sites 1 and 2) of the OsPCF7 gene, code shift or amino acid sequence change (such as SEQ ID No.6-10) is caused, and the regulation and control function of the mutant is enhanced. The invention provides a method for shortening the rice growth cycle through a gene editing or overexpression technology, a new strategy is provided for cultivating high-yield early-maturing varieties with wide adaptability, and the method is particularly suitable for rice planting areas needing to quickly adapt to different light and temperature environments and has remarkable agricultural application value.

Description

Technical Field

[0001] The present invention belongs to the field of plant biotechnology, and specifically discloses the application of rice gene OsPCF7 or its mutant in regulating the heading stage of rice. Background Art

[0002] Rice is a crucial food crop in China and even globally, being one of the three most important food crops in the world and occupying a pivotal position in the fields of agricultural production and scientific research. The heading stage of rice, i.e., the flowering stage, generally refers to the number of growing days required for rice from sowing to the emergence of the panicle from the flag leaf. The early or late heading stage will affect the accumulation of photosynthesis products in rice, and further affect the filling process of grains during the grain-filling period, ultimately affecting the yield and rice quality of rice. The early or late heading stage of rice is a complex life phenomenon determined by the combined action and mutual influence of internal genetic factors such as genes and external environmental factors such as light and temperature. The length of the heading stage of rice is directly related to the adaptability of different rice varieties in various regions and the final yield performance. However, the current research on the regulation mechanism of the heading stage has not been completely thorough, and there are still many mysteries unsolved. Therefore, in-depth exploration of the molecular regulation mechanism of rice flowering genes has extremely important theoretical guiding value for agricultural production, and can provide a solid scientific basis for cultivating higher-quality rice varieties, increasing rice yield and adaptability.

[0003] The TCP protein family, as a plant-specific transcription factor, has been proven to be the main regulator of plant morphogenesis, regulating plant cell proliferation and hormone response through multiple pathways. The PCF transcription factor family is a subfamily of the TCP transcription factor family. According to the different characteristics of the TCP domain, the TCP transcription factor family is divided into two families: Class I TCP and Class II TCP. The PCF family belongs to the Class I TCP subfamily. Compared with Class II TCP, Class I TCP has a four-amino acid deletion at the TCP domain. The PCF family is mainly involved in the processes of cell proliferation and growth and development. For example, PCF1 and PCF2 in rice bind to the promoter of the rice PROLIFERATING CELL NUCLEAR ANTIGEN (PCNA) gene to regulate the cell cycle process. However, the role of OsPCF7 in regulating the heading stage of rice is still unclear, which has important theoretical and practical significance for guiding molecular design breeding. Summary of the Invention

[0004] To solve the above problems, we disclose the application of OsPCF7 or its mutant in regulating the heading stage of rice, providing a feasible and popularizable method for regulating the heading stage of rice using this gene or mutant.

[0005] The present invention includes the following specific technical solutions:

[0006] The present invention discloses the application of rice gene OsPCF7 or its mutant in regulating the heading date of rice. The application includes overexpressing gene OsPCF7 or its mutant in rice, so as to advance the heading date of rice.

[0007] Furthermore, in the above application, the OsPCF7 or its mutant has a nucleotide sequence shown in any one of (a) to (c):

[0008] (a) The nucleotide sequence shown in SEQ ID No.1;

[0009] (b) A mutant obtained by substituting and / or deleting and / or adding one or several bases in the nucleotide sequence shown in SEQ ID No.1 and having the same function;

[0010] (c) A mutant having a similarity of more than 88% with the nucleotide sequence shown in SEQ ID No.1 and having the same function.

[0011] Furthermore, in the above application, the nucleotide sequence of the ospcf7 mutant is the nucleotide sequence shown in any one of SEQ ID No.2 to SEQ ID No.5.

[0012] The present invention discloses a biological material containing the above ospcf7 mutant. The biological material includes any one of (a) to (c):

[0013] (a) An expression cassette;

[0014] (b) A recombinant vector;

[0015] (c) A recombinant prokaryotic cell.

[0016] Furthermore, in the above biological material, the recombinant vector selects plasmid pCAMBIA1300 as the vector.

[0017] Furthermore, in the above biological material, the recombinant prokaryotic cell selects Agrobacterium as the host cell.

[0018] Furthermore, in the above biological material, the recombinant prokaryotic cell selects EHA105 as the host cell.

[0019] The present invention also discloses a method for regulating the heading date of rice. The method uses the biological material described in any one of the above to transfect plant tissues, and plants expressing the protein edited by the ospcf7 mutant are obtained through screening.

[0020] Furthermore, in the above method for regulating the heading date of rice, the protein edited by the ospcf7 mutant has an amino acid sequence shown in any one of SEQ ID No. 6 to SEQ ID No. 10.

[0021] Preferably, the rice variety in the present invention is Nipponbare.

[0022] Compared with the prior art, the present invention has the following prominent beneficial effects:

[0023] The present invention provides the application of OsPCF7 or its mutant in regulating the heading date of rice, and gives the specific nucleotide sequence contained in OsPCF7 or its mutant, as well as the biological material containing the ospcf7 mutant, and gives a clear method for regulating the heading date of rice by using the OsPCF7 or its mutant and the biological material, providing a clear, simple and highly popularizable technical solution for improving the adaptability of rice varieties in different regions and increasing crop yields, and having potential economic value.

[0024] Other features and advantages of the present invention will be described in detail in the subsequent specific implementation section. Brief Description of the Drawings

[0025] Figure 1 It is a schematic diagram of the mutation sites of 4 mutants of the OsPCF7 gene;

[0026] Figure 2 It is the phenotypic diagram of the early heading of the ospcf7 mutant and the statistical results of the heading date;

[0027] Figure 3 It is the expression amount result of OsPCF7 in 4 OsPCF7 overexpression lines;

[0028] Figure 4 It is the statistical result of the heading date of 4 OsPCF7 overexpression lines;

[0029] Figure 5 It is the statistical results of the plant height, tiller number and 1000-grain weight of the ospcf7 mutant. Detailed Description of the Invention

[0030] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0031] The sequences of the present invention are shown in Table 1.

[0032] Table 1 Sequence Listing

[0033]

[0034]

[0035]

[0036]

[0037]

[0038] Example 1

[0039] Cloning of the nucleotide sequence of the OsPCF7 gene

[0040] Total RNA of rice was extracted from rice using the plant RNA extraction kit of Omega Company. Then, using 1 μg of total RNA as a template, the RNA was reverse-transcribed into cDNA according to the operating instructions of the cDNA synthesis kit (Yeasen). According to the website (http: / / rice.plantbiology.msu.edu / expression.shtml), the complete ORF of OsPCF7 was obtained, and specific primers were designed: the 5'-end primer was ATGCGCAACGCCAAGGCC (SEQ ID No. 11); the 3'-end primer was TCACCTGATCACCTCACT (SEQ ID No. 12). The PCR reaction system was 2×Mix 25 μL, 1 μL each of the forward / reverse primers at 10 μM, 5 μL of the template (cDNA), and the volume was made up to 50 μL with sterilized water. The reaction procedure was as follows: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at Tm for 30 s, extension at 72°C at 2 kb / min, 35 - 40 cycles, and extension at 72°C for 30 s. Finally, the full-length cDNA sequence of 813 bp (including the stop codon) of OsPCF7 was amplified (as shown in SEQ ID No. 1), encoding 271 amino acids (as shown in SEQ ID No. 6).

[0041] Example 2

[0042] Construction of the OsPCF7 gene mutant

[0043] Based on the CRISPR-Cas9 technology, two vectors pCAMBLA1300-CAS9-Os-OsPCF7 for the OsPCF7 gene mutant were constructed:

[0044] 2.1 Select the 118 - 140th positions of the CDS sequence of the OsPCF7 gene

[0045] (TACGGGTTCGGCAACACTACCGG CGG, as shown in SEQ ID No.13, where the underlined part is the PAM sequence conforming to NGG) sequence is the target site 1 (named Cas9-1), and sgRNA-1 is synthesized, with the nucleotide sequence of TACGGGTTCGGCAACACTACCGG (as shown in SEQ ID No.14). The gene editing vector psgR-CAS9-Os is digested with BbsI. First, the primers are annealed. The annealing reaction system includes 10 μL of forward primer F: TGTGTGACGGGTTCGGCAACACTAC (as shown in SEQ ID No.15), 10 μL of reverse primer R: AAACGTAGTGTTGCCGAACCCGTCA (as shown in SEQ ID No.16), and 80 μL of 10× T4 buffer. After the reaction system is mixed evenly, it is incubated at 95 °C for 10 min and then cooled on ice. Then it is ligated with the digested vector psgR-CAS9-Os. The ligation system includes 2 μL of the annealed product, 2 μL of the recovered digested vector, 0.5 μL of 10× T4 buffer, and 0.5 μL of T4 ligase, and they are ligated at room temperature for 30 min. The ligation product is transformed into Escherichia coli competent cell DH5α. The transformation procedure is as follows: Add the ligation product to the competent Escherichia coli, flick it gently to mix evenly, let it stand on ice for 30 min, heat shock it in a 42 °C water bath for 1 min, then let it stand on ice for 2 min, add 400 μL of LB, resuscitate and shake the bacteria at 37 °C for 1 h, centrifuge at 8000 rpm for 1 min, suck off most of the supernatant, leave 100 μL of the liquid, pipette it evenly, spread it on an LB plate (containing 50 μg / mL Kan) for culture, and select monoclonal colonies for sequencing identification the next day to analyze whether the vector is successfully constructed.

[0046] 2.2 Select GCCGGACACGACGAGTACAG GGG sequence on the OsPCF7 gene, (as shown in SEQ ID No.17, where the underlined part is the PAM sequence conforming to NGG) as the target site 2 (named Cas9-2), synthesize sgRNA-2 (GCCGGACACGACGAGTACAG, as shown in SEQ ID No.18), and then use the same method as in Example 2.1 to construct the OsPCF7 gene mutant and overexpression vector. The primers used in the annealing reaction system include forward primer F:

[0047] TGTGTGCCGGACACGACGAGTACAG (as shown in SEQ ID No.19), reverse primer R: AAACCTGTACTCGTCGTGTCCGGCA (as shown in SEQ ID No.20). The remaining ligation methods are the same as in Example 2.1.

[0048] Example 3

[0049] Obtaining and Identification of OsPCF7 Gene Mutants

[0050] Using rice (Nipponbare) callus as the experimental material. The mutant vector of OsPCF7 obtained in Example 2 was transformed into Agrobacterium tumefaciens EHA105 by the freeze-thaw method. Single colonies of Agrobacterium containing the OsPCF7 gene mutant vector were picked and cultured overnight at 28 °C and 200 rpm in 2 mL of LB liquid medium containing rifampicin and spectinomycin. Then, 1 mL of the bacterial solution was transferred to 10 mL of LB containing rifampicin and spectinomycin and cultured for 5 h. The cells were centrifuged at 4000 rpm for 10 min at room temperature, the supernatant was discarded, and the cells were resuspended with 50 mL of AAM-As resuspension solution; Well-grown rice callus was selected and placed in the Agrobacterium suspension for infection for 30 min, and then cultured in the dark at 28 °C for 2 days. After 2 days, the callus was rinsed with sterile water until the washing solution was clear, and then the callus was transferred to a selection medium containing 50 mg / L hygromycin for screening for about two weeks. The selected resistant callus was transferred to a differentiation medium containing 50 mg / L hygromycin for culture. After 2-3 weeks, the green rice shoots were transferred to a rooting medium for root induction. For mutant positive plants, the gDNA of the T0 generation plants needs to be extracted, identified by PCR and sequenced.

[0051] Identification of ospcf7 mutants: The leaves of T0 transgenic plants were extracted as templates. Specific forward primer F (ATGCGCAACGCCAAGGCC, as shown in SEQ ID No. 21) and reverse primer R (GGCCTTGGCGTTGCGCAT, as shown in SEQ ID No. 22) were designed for PCR amplification. The positive transgenic plants of Cas9-1 T0 generation were screened (the size of the PCR amplification product of the positive plants was 270 bp). The lines with mutations were sequenced and screened. Specific forward primer F (CGGCACCATGACCAGCGC, as shown in SEQ ID No. 23) and reverse primer R (GCGCTGGTCATGGTGCCG, as shown in SEQ ID No. 24) were designed for PCR amplification. The positive transgenic plants of Cas9-2 T0 generation were screened (the size of the PCR amplification product of the positive plants was 400 bp). The lines with mutations were sequenced and screened. The T0 generation was self-pollinated to obtain the T1 generation, and the T1 generation was self-pollinated to obtain the T2 generation. The T2 generation plants were screened again to screen out the independent lines without vectors and with homozygous mutations. Finally, four mutants were obtained, named ospcf7-1, ospcf7-2, ospcf7-3 and ospcf7-4 respectively. Two mutations occurred at target site 1. At this position, ospcf7-1 had a deletion of 5 bases (-AACAC), and the nucleotide sequence after mutation was as shown in SEQ ID No. 2. Ospcf7-2 also had an addition of 1 base (+T) at the same position, and the nucleotide sequence after mutation was as shown in SEQ ID No. 3. The nucleotide sequence changes of mutants ospcf7-1 and ospcf7-2 led to frameshift mutations at the corresponding positions of the encoded proteins; two mutations occurred at target site 2. At this position, ospcf7-3 had an addition of 1 base (+C), and the nucleotide sequence after mutation was as shown in SEQ ID No. 4. ospcf7-4 had a deletion of 1 base (-C) at the same position, and the nucleotide sequence after mutation was as shown in SEQ ID No. 5. There were a total of four mutants, as Figure 1 shown.

[0052] Comparative Example 1

[0053] Construction of OsPCF7 overexpression vector

[0054] In this example, an overexpression vector of the OsPCF7 gene, Ubi:OsPCF7, was constructed. The specific steps were as follows: First, the PCR product (810 bp) of the full-length target gene without the stop codon amplified in Example 1 was purified (using an Omega gel extraction kit). The required overexpression vector plasmid was digested with Hind III, and after electrophoresis detection, the purified product was ligated using the method of homologous recombination (Vazyme). The reaction system was as follows: 2 μL of linearized vector, 3 μL of inserted fragment, 4 μL of 5× buffer, 2 μL of Exnase II, and sterilized water was added to make up to 20 μL. Incubate at 37 °C for 30 min in a PCR instrument. The product was transformed into Escherichia coli competent cell DH5α, spread on an LB plate (containing 50 mg / L Kan), and cultured overnight at 37 °C in an inverted position. The next day, single colonies were picked for sequencing identification.

[0055] Comparative Example 2

[0056] Obtaining and identification of OsPCF7 overexpression plants

[0057] Using rice (Nipponbare) callus as the experimental material. The plant expression vector obtained in Comparative Example 1 was transformed into Agrobacterium tumefaciens EHA105 by the freeze-thaw method. Overexpression plants were obtained according to the transgenic method in Example 3. Finally, the expression of the target gene in wild-type and transgenic plants was detected by qRT-PCR, and overexpression positive plants were initially screened and named #1 - #30 respectively.

[0058] Identification of OsPCF7 overexpression plants: Sterile seedlings of wild-type and transgenic rice at 14 days were taken for RNA extraction. Using 1 μg of RNA as a template, the first-strand cDNA was synthesized according to the operation instructions of a cDNA synthesis kit (Yeasen). Specific quantitative PCR primers were designed for the cDNA of the OsPCF7 gene (forward primer F: ATGCCATGCCTGCATTCTCTGG, as shown in SEQ ID No. 25, reverse primer R: ATGATCTCGAGTGCAGGCGTTC, as shown in SEQ ID No. 26). The expression of the OsPCF7 gene in wild-type and transgenic lines was detected by qRT-PCR. The results showed that all 30 transgenic plants obtained were overexpressed, and 4 lines #3, #7, #12, and #23 were randomly selected as examples. As Figure 3 shown, for transgenic lines #3, #7, #12, and #23, the vertical axis represents an upregulation of approximately 7-fold, 8-fold, 15-fold, and 6-fold respectively, proving that the constructed overexpression vectors can all promote the expression of the OsPCF7 gene in plants, and then these 4 transgenic lines were used for heading date analysis.

[0059] Experimental Example 1

[0060] Heading date analysis of mutants and overexpression plants

[0061] Wild type (Nipponbare), four ospcf7 mutants and overexpression seeds were germinated, raised in nurseries and then transplanted into the experimental field in Fuyang District, Hangzhou City, Zhejiang Province. All materials were cultivated under the same conditions and appropriate field management was carried out during the whole cultivation period. When the wild type Nipponbare headed, the heading dates of each wild type, ospcf7 mutant and overexpression plant were counted. The results showed that compared with the wild type, all mutants of the OsPCF7 gene showed an obvious phenomenon of earlier heading date (as Figure 2 shown), while overexpression of the OsPCF7 gene showed an obvious phenomenon of delayed heading date (as Figure 4 shown).

[0062] Experimental Example 2

[0063] Agronomic trait analysis of mutants and wild type plants

[0064] Wild type (Nipponbare) and ospcf7 mutant seeds were planted in the field during the normal season. After actual statistics in the later stage, it was found that the plant height and tiller number of the mutants remained unchanged and the yield hardly decreased (as Figure 5 shown).

[0065] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0066] In addition, it should be noted that, in the case of no contradiction, the various specific technical features described in the above specific embodiments can be combined in any appropriate way. In order to avoid unnecessary repetition, the present invention will not separately describe various possible combination methods.

[0067] Furthermore, any combination can be made between various different embodiments of the present invention as long as it does not violate the idea of the present invention, and it should also be regarded as the content disclosed by the present invention.

Claims

1. Use of OsPCF7 or its mutant in regulating the heading period of rice, characterized in that: The application comprises overexpressing the gene OsPCF7 or its mutant in rice, thereby advancing the heading date of rice.

2. Use of OsPCF7 or its mutant in regulating the heading period of rice, characterized in that: The OsPCF7 or its mutant has a nucleotide sequence shown in any one of (a) to (c): (a) the nucleotide sequence shown in SEQ ID No. 1; (b) a mutant having the same function as the nucleotide sequence shown in SEQ ID No. 1 with one or more bases substituted and / or deleted and / or added; (c) A mutant having a similarity of more than 88% to the nucleotide sequence shown in SEQ ID No. 1 and having the same function.

3. The use according to claim 2, characterized in that: The nucleotide sequence of the ospcf7 mutant is the nucleotide sequence shown in any one of SEQ ID No. 2 to SEQ ID No.

5.

4. A biological material comprising the ospcf7 mutant according to claim 2 or 3, characterized in that: The biological material includes any one of (a) to (c): (a) expression cassette; (b) a recombinant vector; (c) Recombinant prokaryotic cells.

5. The biomaterial according to claim 4, characterized in that The recombinant vector uses plasmid pCAMBIA1300 as the vector.

6. The biomaterial according to claim 4, characterized in that The recombinant prokaryotic cell uses Agrobacterium as a host cell.

7. The biomaterial according to claim 6, characterized in that The recombinant prokaryotic cell uses EHA105 as a host cell.

8. A method for regulating the heading period of rice, characterized in that: The biological material according to any one of claims 4 to 7 is used to transfect plant tissues, and plants expressing proteins edited by the ospcf7 mutant are obtained through screening.

9. The method according to claim 8, characterized in that The protein edited by the ospcf7 mutant has an amino acid sequence as shown in any one of SEQ ID No.6 to SEQ ID No.

10.

10. The method according to claim 8 or 9, characterized in that: The rice is Nipponbare.

Images