Application of peanut gene AhHDZ4 in salt tolerance and drought resistance of plants

Abstract

The invention discloses an application of a peanut gene AhHDZ4 in the aspects of salt tolerance and drought resistance of plants. The invention discloses an application of a peanut AhHDZ4 gene and an encoding protein thereof in improving stress resistance of plants, the nucleotide sequence of the peanut AhHDZ4 gene is shown as SEQ ID NO: 1, and the amino acid sequence of the encoding protein is shown as SEQ ID NO: 2. The AhHDZ4 gene and the encoding protein thereof are obtained in peanuts, and the AhHDZ4 gene and the encoding protein thereof are related to plant stress resistance. By overexpressing the AhHDZ4 gene and the encoded protein thereof in the plant, the salt tolerance and drought resistance of the plant are improved, the content of chlorophyll, catalase, superoxide dismutase and malondialdehyde and the water content of the plant under the conditions of salt stress and drought stress are improved, and normal growth of the plant is ensured.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genes, and specifically, to the application of peanut gene AhHDZ4 in plant salt tolerance and drought tolerance. Background Art

[0002] Salt stress can inhibit the photosynthesis of crops and the accumulation of dry matter weight, damage the structure of cell membranes, reduce the activity of enzymes, inhibit the growth of plants, and thus affect the yield. Salt stress can also deteriorate the physical and chemical properties of the soil, leading to the accumulation of harmful substances, soil compaction, damage to microorganisms in the soil, and inhibition of plant growth.

[0003] The demand of crops for water resources and the supply capacity of water resources in the environment are the key factors determining the impact of climate change on agriculture. During the crop production process, insufficient water supply leads to water shortage in the plant body, affects the metabolism and growth and development of crops, and in severe cases, slows down the growth rate or even stops growing, endangering the stability of the yield. The crop yield reduction caused by drought stress reaches 25%. With the change of climate conditions in recent years, the soil water reserves in many regions of the world are being depleted day by day. The key environmental challenge in the 21st century is likely to be global sustainable water resource management, indicating that the interference of drought stress on crop growth will continue to exist and will have a huge impact on agricultural production.

[0004] HD-ZIP family proteins are plant-specific transcription factors that encode homeobox proteins containing 60 conserved amino acid homology domains (HD). HD-ZIP proteins include an HD binding domain and a leucine zipper (ZIP) domain that is closely linked to HD. Plant HD-ZIP family genes mainly play important roles in stress tolerance, leaf development, and light signal transduction. Currently, there is no report on the identification of the related functions of HD-ZIP family genes in peanuts. Summary of the Invention

[0005] The object of the present invention is to overcome the above deficiencies of the prior art and provide the application of peanut gene AhHDZ4 in plant salt tolerance and drought tolerance.

[0006] The first object of the present invention is to provide the application of peanut AhHDZ4 gene and its encoded protein in improving plant stress resistance.

[0007] The second object of the present invention is to provide a recombinant vector.

[0008] The third object of the present invention is to provide a recombinant engineering bacterium.

[0009] The fourth object of the present invention is to provide a method for improving plant stress resistance.

[0010] The fifth object of the present invention is to provide a method for cultivating stress-resistant plants.

[0011] To achieve the above object, the present invention is realized through the following solutions:

[0012] In a first aspect, the present invention provides the use of the peanut AhHDZ4 gene and its encoded protein in improving plant stress resistance. The nucleotide sequence of the peanut AhHDZ4 gene is as shown in SEQ ID NO: 1, and the amino acid sequence of its encoded protein is as shown in SEQ ID NO: 2.

[0013] By overexpressing the peanut AhHDZ4 gene and its encoded protein in the model plant Arabidopsis thaliana, its salt tolerance and drought resistance are improved.

[0014] Furthermore, the stress resistance includes salt tolerance and / or drought resistance.

[0015] In a second aspect, the present invention provides a recombinant vector, which contains the peanut AhHDZ4 gene described in claim 1.

[0016] Even further, the recombinant vector uses the pCAMBIA1300 vector as the backbone vector.

[0017] In a specific embodiment of the present invention, the peanut AhHDZ4 gene is ligated to the pCAMBIA1300 vector to obtain the pCAMBIA1300-AhHDZ4 recombinant vector overexpressing the AhHDZ4 gene.

[0018] In a third aspect, the present invention provides a recombinant engineering bacterium, which expresses the recombinant vector described above.

[0019] In a specific embodiment of the present invention, the pCAMBIA1300-AhHDZ4 recombinant vector is transformed into Escherichia coli by the heat shock method. Further, the pCAMBIA1300-AhHDZ4 recombinant vector is transformed into Agrobacterium tumefaciens by the liquid nitrogen freezing method.

[0020] In a specific embodiment of the present invention, the Escherichia coli is Escherichia coli DH5α, and the Agrobacterium tumefaciens is Agrobacterium tumefaciens GV3101.

[0021] In a fourth aspect, the present invention provides a method for improving plant stress resistance, which is to express the peanut AhHDZ4 gene and its encoded protein in plants.

[0022] Furthermore, the recombinant vector is transferred into a recipient plant to obtain a stress-resistant plant overexpressing the AhHDZ4 gene.

[0023] Furthermore, the recombinant vector was transformed into Agrobacterium by the liquid nitrogen freeze-thaw method to obtain positive Agrobacterium, and the positive Agrobacterium was transferred into the receptor plant by the floral dip method to obtain a stress-resistant plant overexpressing the AhHDZ4 gene, thereby improving the stress resistance of the plant.

[0024] In a specific embodiment of the present invention, the Agrobacterium is Agrobacterium GV3101, and the receptor plant can be Arabidopsis thaliana.

[0025] Fifthly, the present invention provides a method for cultivating stress-resistant plants by expressing the peanut AhHDZ4 gene and its encoded protein in plants.

[0026] Further, the recombinant vector was transferred into the receptor plant to obtain a stress-resistant plant overexpressing the AhHDZ4 gene.

[0027] Furthermore, the recombinant vector was transformed into Agrobacterium by the liquid nitrogen freeze-thaw method to obtain positive Agrobacterium, and the positive Agrobacterium was transferred into the receptor plant by the floral dip method to obtain a stress-resistant plant overexpressing the AhHDZ4 gene, thereby improving the stress resistance of the plant.

[0028] In a specific embodiment of the present invention, the Agrobacterium is Agrobacterium GV3101, and the receptor plant can be Arabidopsis thaliana.

[0029] Furthermore, the stress resistance includes salt tolerance and / or drought tolerance.

[0030] Compared with the prior art, the present invention has the following beneficial effects:

[0031] The AhHDZ4 gene and its encoded protein were obtained in peanuts in the present invention, which are related to plant stress resistance. Overexpressing the AhHDZ4 gene and its encoded protein in plants improved the salt tolerance and drought resistance of plants, and increased the contents of chlorophyll, catalase, superoxide dismutase and malondialdehyde as well as the water content of plants under salt stress and drought stress conditions, ensuring the normal growth of plants. The present invention firstly identified the salt tolerance and drought resistance of the peanut AhHDZ4 gene, aiming to provide more gene resources for peanut stress-resistant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 Amplification of the AhHDZ4 gene.

[0033] Figure 2 Schematic diagram of the construction of the AhHDZ4 overexpression vector.

[0034] Figure 3 For T 0 Identification of positive single plants of T-generation AhHDZ4 overexpressing Arabidopsis thaliana CK: overexpression positive plasmid; WT: wild-type Arabidopsis thaliana.

[0035] Figure 4 Statistical analysis of germination rate data of wild type (WT) and AhHDZ4 transgenic lines under 0, 100, 150 and 200 mM NaCl conditions.

[0036] Figure 5 Statistical analysis of germination rate data of wild type (WT) and AhHDZ4 transgenic lines under 0, 100, 200 and 300 mM mannitol conditions.

[0037] Figure 6 Physiological characteristics of wild type and AhHDZ4 transgenic Arabidopsis under salt stress. A: Phenotypes of wild type and transgenic lines under salt stress; B: Chlorophyll content of wild type and transgenic lines under salt stress; C: Schematic diagram of CAT activity of wild type and transgenic lines under salt stress; D: Schematic diagram of MDA activity of wild type and transgenic lines under salt stress; E: Schematic diagram of SOD activity of wild type and transgenic lines under salt stress; F: Relative leaf water content of wild type and transgenic lines under salt stress.

[0038] Figure 7 Physiological characteristics of wild type and AhHDZ4 transgenic Arabidopsis under salt stress. A: Phenotypes of wild type and transgenic lines under drought stress; B: Chlorophyll content of wild type and transgenic lines under drought stress; C: Schematic diagram of CAT activity of wild type and transgenic lines under drought stress; D: Schematic diagram of MDA activity of wild type and transgenic lines under drought stress; E: Schematic diagram of SOD activity of wild type and transgenic lines under drought stress; F: Relative leaf water content of wild type and transgenic lines under drought stress. Detailed implementation mode

[0039] The present invention will be further elaborated in detail below in conjunction with the accompanying drawings of the specification and specific embodiments. The embodiments are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following embodiments are all conventional methods unless otherwise specified; the materials, reagents, etc. used are all reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0040] Example 1 Amplification of AhHDZ4 gene, construction of overexpression vector and identification of positive plants

[0041] The nucleotide sequence of peanut AhHDZ4 gene is shown in SEQ ID NO: 1, with a full length of 783 bp:

[0042] ATGGAATATGCAACATATTCATCAGCAGCAGAAGTTTGTGAAGGTATTGAAACTCCACCAGCACCAGCAGCATCATCTTCATCAATTTCATCCATGATGATTTGTAGGAAGAAGAAGAACAACAACAGCAACAATACAAGGAGGTTCAGTGATGATCAAATCAAGTCATTGGAATCAATATTTGAGACTGAGTCAAGGCTTGAGCCAAAGAAGAAGCTTCAACTTGCAAGGGAGCTTGGTTTGCAGCCAAGACAAGTTGCTATTTGGTTTCAGAACAAGAGAGCAAGGTGGAAGTCAAAGCAACTTGAGAGAGATTACACCATTCTCAGAAACAATTACAACAATTTGGCTTCAAGGTTTGAGTCACTCAAGAAGGAGAAACAAGCATTACTAATTCAGTTGCAGAAGCTGAATGATCTAATACAGAAGCCATCAATGGAGAAGAAAACTCAGAGCATGGACAGTGAATCAGAAAATGGTGACACAACCAAGAGTGGTAGTGAACTTAAGGTCAAACCAATAAGCCAATCATCAATGGCAGCAAGATCATCAGAACATGCAGTTCTTTGTGGTGGTGGTGGTGGTGGTGGTGCTCTTTCAGATGATGATACAAGCATCAAAGTTGAGTACTTTGGAAACTTGGAAGATGGGCTTGTGAATTTTGCTCATGATCATGGTGATGGGTCTTTGACATCACCAGAAGA TTGGGGTCATTTTGATTCTGATGATCTTTTAGGCCAATCAACCAGTGATTACCAATGGTGGGACTTTTGGTCCTGA。

[0043] The amino acid sequence of the protein encoded by the peanut AhHDZ4 gene is shown in SEQ ID NO: 2, with a full length of 260 aa:

[0044] MEYATYSSAAEVCEGIETPPAPAASSSSISSMMICRKKKNNNSNNTRRFSDDQIKSLESIFETESRLEPKKKLQLARELGLQPRQVAIWFQNKRARWKSKQLERDYTILRNNYNNLASRFESLKKEKQALLIQLQKLNDLIQKPSMEKKTQSMDSESENGDTTKSGSELKVKPISQSSMAARSSEHAVLCGGGGGGGGALSDDDTSIKVEYFGNLEDGLVNFAHDHGDGSLTSPEDWGHFDSDDLLGQSTSDYQWWDFWS。

[0045] 1. Using the mixed cDNA of roots, stems and leaves of the peanut tetraploid material Qinghua 6 as a template, primers were designed to amplify the AhHDZ4 gene. The AhHDZ4 gene was amplified using the GXL high-fidelity enzyme system (brand: TaKaRa; catalog number: R051S). The amplification system is shown in Table 1, and the amplification program is as follows: 98°C, 5 min; 98°C, 10 s, 55°C, 15 s, 68°C, 1 min, 35 cycles; 68°C, 10 min; 4°C, ∞.

[0046] Forward primer: ttggagagaacacgggggacGAATTCATGGAATATGCAACATATTCATC AGC;

[0047] Reverse primer: GCCTGCAGGTCGACTCTAGAGGATCCGGACCAAAAGTCCC ACCATTG.

[0048] Table 1 AhHDZ4 gene amplification system

[0049]

[0050] 2. The PCR amplification product fragments in step 1 were detected by electrophoresis, and the results met the expected target size ( Figure 1 ). All the PCR products were gel-extracted and purified, and further ligated with the pCAMBIA1300 overexpression vector linearized by EcoRI and BamHI digestion using the ClonExpress MultiS One Step Cloning Kit (ligase-independent multi-fragment one-step cloning technology) (brand: Novoprotein, catalog number: C113) ( Figure 2 ), to obtain the AhHDZ4 gene overexpression vector: pCAMBIA1300-AhHDZ4 recombinant vector.

[0051] 3. Transform the pCAMBIA1300-AhHDZ4 recombinant vector in Step 2 into Escherichia coli DH5α by heat shock method. Pick recombinant monoclonal colonies in LB liquid medium containing 50 μg / mL kanamycin resistance, and shake culture at 37 °C and 200 rpm for more than 12 h. Collect the bacterial liquid and use DNAPolymerase (DNA polymerase, manufacturer: TransGen Biotech Co., Ltd., Beijing, product number: AP111-01) for PCR amplification.

[0052] Forward primer: ttggagagaacacgggggacGAATTCATGGAATATGCAACATATTCATC AGC;

[0053] Reverse primer: GCCTGCAGGTCGACTCTAGAGGATCCGGACCAAAAGTCCC ACCATTG.

[0054] The amplification system is shown in Table 2, and the amplification program is: 95 °C, 3 min; 95 °C, 15 s, 55 °C, 20 s, 72 °C, 1 min, 30 cycles; 72 °C, 10 min; 10 °C, ∞. After electrophoresis detection of the target band, sequence it.

[0055] Table 2 Amplification system for identification of bacteria P and transgenic positive seedlings

[0056]

[0057] 4. Extract the pCAMBIA1300-AhHDZ4 recombinant vector from the bacterial liquid with correct sequencing in Step 3, and transfer it into Agrobacterium tumefaciens GV3101 by liquid nitrogen freeze-thaw method to obtain Agrobacterium tumefaciens GV3101 containing the pCAMBIA1300-AhHDZ4 recombinant vector for standby.

[0058] 5. Transfer the bacterial liquid of Agrobacterium tumefaciens GV3101 containing the pCAMBIA1300-AhHDZ4 recombinant vector into Arabidopsis thaliana (Col-0) by floral dip method to obtain T 0 -generation transgenic Arabidopsis thaliana. Harvest the seeds and plant them. Use 1 / 2 MS medium (Murashige & Skoog Medium) containing 50 μg / L ticarcillin and 50 μg / mL kanamycin as the selection medium to perform positive screening on T 0 -generation transgenic Arabidopsis thaliana to obtain positive seedlings: Sterilize the seeds with 10% (v / v) bleach solution for 10 min and wash them with sterile water for T 0The transgenic Arabidopsis thaliana seeds of the [generation number] were sterilized 3 times to obtain sterilized seeds. The sterilized seeds were spread on 1 / 2 MS medium and vernalized at 4 °C for 3 days to break seed dormancy. Then they were transferred to a light incubator with a culture condition of 16 h light / 8 h dark and a temperature of 21 - 22 °C (the subsequent culture conditions were the same). After growing on the selection medium for 10 days, the normally growing seedlings were transplanted into nutrient soil (the volume ratio of the substrate to vermiculite was 2:1). When the above seedlings grew to the flowering stage, leaves were taken to extract DNA, and PCR amplification and electrophoresis verification were carried out using gene-specific primers. The amplification system was as shown in Table 2, and the amplification program was: 95 °C, 3 min; 95 °C, 15 s, 55 °C, 20 s, 72 °C, 1 min, 30 cycles; 72 °C, 10 min; 10 °C, ∞.

[0059] Forward primer: ttggagagaacacgggggacGAATTCATGGAATATGCAACATATTCATC AGC;

[0060] Reverse primer: GCCTGCAGGTCGACTCTAGAGGATCCGGACCAAAAGTCCC ACCATTG.

[0061] The electrophoresis results were as Figure 3 shown. Positive single plants were retained, and T 1 -generation transgenic Arabidopsis thaliana seeds were harvested.

[0062] On 1 / 2 MS medium containing 50 μg / mL kanamycin, the T 1 -generation transgenic Arabidopsis thaliana seeds were cultured under the same culture conditions until germination to obtain seedlings, and lines with a segregation ratio of seedling survival to death of (3:1) were obtained. Single-copy lines were identified, and T 2 -generation transgenic Arabidopsis thaliana seeds were harvested.

[0063] Using the same method as culturing the T 1 -generation transgenic Arabidopsis thaliana seeds, the T 2 -generation transgenic Arabidopsis thaliana seeds were cultured to obtain T 2 -generation transgenic Arabidopsis thaliana, and T 2 -generation homozygous transgenic Arabidopsis thaliana was screened.

[0064] Three T 2 -generation homozygous transgenic Arabidopsis thaliana lines were selected for additional generation planting, and T 3 -generation homozygous transgenic Arabidopsis thaliana line seeds were harvested.

[0065] Example 2 Salt stress and drought stress germination rate and root elongation experiments

[0066] The T 3Seeds of the T-generation homozygous transgenic Arabidopsis thaliana lines and WT wild-type Arabidopsis thaliana seeds were sterilized and vernalized according to the method of Example 1 to break seed dormancy, and then sown into 1 / 2 MS solid media containing 0, 100, 150, and 200 mM NaCl, respectively, and 1 / 2 MS solid media containing 0, 100, 200, and 300 mM mannitol, respectively, for salt stress and drought stress treatments. After 10 days of culture, the germination rates were counted.

[0067] As Figure 4 shown in Figure 4 A and

[0068] B, in the salt treatment, when the NaCl concentration was 0 mM, there was no difference in the germination rates between the WT wild-type Arabidopsis thaliana line and the homozygous transgenic Arabidopsis thaliana lines OE1, OE2, and OE3; when the NaCl concentrations were 100, 150, and 200 mM, the germination rate of the WT wild-type Arabidopsis thaliana line was significantly lower than that of the homozygous transgenic Arabidopsis thaliana lines OE1, OE2, and OE3. Figure 5 As Figure 5 shown in

[0069] A and

[0070] B, in the drought treatment, when the mannitol concentration was 0 mM, there was no difference in the germination rates between the WT wild-type Arabidopsis thaliana line and the homozygous transgenic Arabidopsis thaliana lines OE1, OE2, and OE3; when the mannitol concentrations were 100, 200, and 300 mM, the germination rate of the WT wild-type Arabidopsis thaliana line was significantly lower than that of the homozygous transgenic Arabidopsis thaliana lines OE1, OE2, and OE3. 3

[0071] 1. Seeds of the T-generation homozygous transgenic Arabidopsis thaliana lines OE1, OE2, and OE3 and WT wild-type Arabidopsis thaliana seeds in Example 1 were sterilized and vernalized according to the method of Example 1 to break seed dormancy, and then transferred to a light incubator. The culture conditions were 16 h light / 8 h dark, and the temperature was 21 - 22 °C. After growing in 1 / 2 MS medium for 7 days, the normally growing seedlings were transplanted into nutrient soil (the volume ratio of the substrate to vermiculite was 2:1) and cultured for 4 weeks to obtain seedlings grown for 4 weeks. 250 mM NaCl was added to OE1, OE2, and OE3 for salt treatment, and 30% (v / v) PEG6000 was added for drought treatment, while water was added to the control group for treatment. The phenotypes of the WT wild-type Arabidopsis thaliana line and the homozygous transgenic Arabidopsis thaliana lines OE1, OE2, and OE3 were recorded on the 8th and 16th days of the salt treatment and drought treatment.2. On the 8th day of salt treatment and drought treatment in Step 1, 4 portions of 0.5 g of fresh leaves were taken from the WT wild-type Arabidopsis thaliana strain and the homozygous transgenic Arabidopsis thaliana strains OE1, OE2, and OE3. The fresh leaves were quickly frozen in liquid nitrogen and stored at -80 °C for later use as the quick-frozen samples of the leaves to be tested.

[0072] Using the plant chlorophyll content detection kit (KTB3022), hydrogen peroxide (CAT) activity analysis kit (KTB1040), superoxide dismutase (SOD) activity detection kit (KTB1030), and lipid peroxidation (malondialdehyde) content detection kit (KTB1050) from Abbkine, the chlorophyll content, catalase (CAT), superoxide dismutase (SOD), and malondialdehyde (MDA) content of the quick-frozen samples of the leaves to be tested in each group were detected respectively.

[0073] After detecting the fresh weight (FW) of the fresh leaves in each group, the fresh leaves in each group were immersed in pure water for 24 h to obtain the pure water-treated leaves. The saturated weight (SW) of the pure water-treated leaves was recorded. The pure water-treated leaves were dried at 80 °C for 48 h to obtain the dried leaves, and the dry weight (DW) of the dried leaves was recorded. The relative water content of the fresh leaves in each group was calculated according to the following formula:

[0074] Relative water content RLWC (%) = (FW - DW) / (SW - DW) × 100%.

[0075] As Figure 6 A and Figure 7 shown in A, under salt and drought stress, the WT wild-type Arabidopsis thaliana showed obvious leaf chlorosis and inhibited growth and development. Arabidopsis thaliana overexpressing the AhHDZ4 gene showed a better growth trend and stronger salt and drought tolerance.

[0076] Chlorophyll content ( Figure 6 B and Figure 7 B), CAT ( Figure 6 C and Figure 7 C), MDA ( Figure 6 D and Figure 7 D), SOD ( Figure 6 E and Figure 7 E), and RLWC ( Figure 6 F and Figure 7 F) measurement results showed that in the CK control group, there was no obvious difference between the WT wild-type Arabidopsis thaliana and Arabidopsis thaliana overexpressing the AhHDZ4 gene. After salt treatment and drought treatment, there were extremely significant differences in various indicators between Arabidopsis thaliana overexpressing the AhHDZ4 gene and the WT wild-type Arabidopsis thaliana. Overexpression of the AhHDZ4 gene showed salt tolerance and drought tolerance.

[0077] The above indicates that the AhHDZ4 gene plays a positive regulatory role in plant salt tolerance and drought stress.

[0078] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than limit the protection scope of the present invention. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description and ideas. It is not necessary and impossible to enumerate all implementation manners here. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the claims of the present invention.

Claims

1. Application of peanut AhHDZ4 gene and its encoded protein in improving plant stress resistance, the nucleotide sequence of the peanut AhHDZ4 gene is shown in SEQ ID NO: 1, and the amino acid sequence of its encoded protein is shown in SEQ ID NO:

2.

2. The use according to claim 1, characterized in that: The stress resistance includes salt tolerance and / or drought tolerance.

3. A recombinant vector, characterized in that: The recombinant vector contains the peanut AhHDZ4 gene according to claim 1.

4. The recombinant vector according to claim 3, characterized in that The recombinant vector uses pCAMBIA1300 vector as a backbone vector.

5. A recombinant engineered bacterium, characterized in that: The recombinant engineered bacteria express the recombinant vector according to claim 3 or 4.

6. A method for improving plant stress resistance, characterized in that: Expressing the peanut AhHDZ4 gene and its encoded protein according to claim 1 in plants.

7. The method according to claim 6, characterized in that The recombinant vector according to claim 3 or 4 is introduced into a recipient plant to obtain a stress-resistant plant overexpressing the AhHDZ4 gene.

8. The method according to claim 6, characterized in that The recombinant vector according to claim 3 or 4 is transformed into Agrobacterium by liquid nitrogen freeze-thaw method to obtain positive Agrobacterium, and the positive Agrobacterium is transferred into a recipient plant by floral dipping method to obtain a stress-resistant plant overexpressing the AhHDZ4 gene.

9. A method for cultivating stress-resistant plants, characterized in that: Expressing the peanut AhHDZ4 gene and its encoded protein according to claim 1 in plants.

10. The method according to any one of claims 6 to 9, characterized in that: The stress resistance includes salt tolerance and / or drought tolerance.

Images