OgXa1 gene and application of OgXa1 gene in improvement of bacterial blight resistance of rice

Abstract

The invention relates to the technical field of biology, in particular to an OgXa1 gene and application of the OgXa1 gene to improvement of bacterial blight resistance of rice, the sequence of the OgXa1 gene is shown as SEQ ID No.1, the CDS sequence of the OgXa1 gene is shown as SEQ ID No.2, and the coded amino acid sequence of the OgXa1 gene is shown as SEQ ID No.3. According to the invention, a homologous gene OgXa1 of Xa1 with transformative resistance to dominant race 1 of bacterial blight in rice is homologous cloned from Oryza meyeriana through PCR (Polymerase Chain Reaction) amplification. The gene encodes an NBS-LRR protein, and a transgenic rice plant over-expressing OgXa1 can significantly enhance resistance to a plurality of bacterial blight germs, reaches an almost immune level, shows broad-spectrum high bacterial blight resistance, has a good application prospect in the aspect of breeding of bacterial blight resistant rice varieties, and has a wide application prospect. And a new normal form is provided for excavation and utilization of the excellent bacterial leaf blight resistance gene in Oryza meyeriana.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and specifically to an OgXa1 gene and its application in improving the resistance of rice to bacterial blight. Background Art

[0002] Rice (Oryza sativa) is a major global food crop and the staple food for most of the world's population. Bacterial blight, caused by the Gram-negative bacterium Xanthomonas oryzae pv. oryzae (Xoo), is one of the most serious bacterial diseases in rice production in China. The bacterial blight pathogen mainly invades the rice host vascular bundles through stomata or wounds, spreads along the vascular tissue and multiplies in large numbers. It can infect rice throughout the growth period and shows various symptoms such as leaf margin (wilt) type, wilting type, midrib type, and chlorosis type under different conditions. First, yellowish-green appears at the edge of the rice, and after a large number of bacteria multiply, it spreads to the xylem tissue of the rice, and the leaves then turn grayish-white, further causing the leaves to wither and seriously affecting its photosynthesis, hindering the growth and development process of rice. Once bacterial blight occurs in rice, it spreads very fast, not only causing large-scale crop diseases, but also leading to a significant reduction in rice yield or even crop failure, posing a serious threat to the world economy and food security. Chemical pesticide application is currently the main measure for controlling bacterial blight in rice production. It not only has a high application cost, but also brings serious environmental and food pollution. Moreover, the long-term and large-scale use of chemical pesticides will cause the drug resistance and pathogenicity of the bacterial blight pathogen to mutate. Therefore, the exploration and utilization of excellent disease-resistant gene resources are the most economical and effective methods for controlling bacterial blight and also the only way for the development of green agriculture. Up to now, a total of 48 R genes resistant to bacterial blight have been identified from various cultivated rice and different wild rice and confirmed by international registration and reported in journals. Among them, 17 genes have been cloned and widely used in disease-resistant breeding. For example, the bacterial blight-resistant gene Xa1 cloned from cultivated rice Kogyoku encodes an NLR protein and has specific resistance only to the dominant race 1 of Japanese bacterial blight. Xa1 has been widely applied and is usually used in combination with other genes such as Xa21 and Xa13 in rice disease-resistant breeding to enhance the disease resistance of rice; rice varieties carrying the Xa1 gene have been quickly screened out through molecular marker-assisted selection, greatly accelerating the breeding process. Zhang Biaoming (Cloning and Functional Analysis of the Major Gene Xa14 for Resistance to Bacterial Blight in Rice [D]. Huazhong Agricultural University, 2020.) identified and cloned a new completely dominant gene Xa14 resistant to bacterial blight, which has specific resistance to the Philippine pathogenic race P5 (PXO112) of the bacterial blight pathogen. Through technical means such as gene transformation, cross-breeding, and gene editing, this gene can be applied to rice varieties to effectively improve the resistance of rice to bacterial blight and reduce disease losses.

[0003] Currently, the cloned genes can be roughly divided into five categories: (1) Resistance genes encoding receptor kinases, including the Xa21, Xa3 / Xa26 genes encoding receptor-like kinases (RLK) and the Xa4 gene encoding cell wall-associated kinase (WAK); (2) Resistance genes Xa1, Xa2, Xa14, Xa31(t), Xa45, Xa47(t) encoding proteins containing nucleotide-binding leucine-rich repeat (NLR); (3) Resistance genes encoding sugar transporter (SWEET) proteins with a transmembrane domain of MtN3 / saliva: xa13, xa25, xa41(t); (4) Resistance execution genes encoding Executor proteins and dependent on TALE: Xa7, Xa10, Xa23, Xa27; (5) Genes encoding other proteins: xa5, etc.

[0004] However, after long-term large-scale cultivation of a single disease-resistant variety, due to selection pressure, the pathogen is prone to gene mutation or recombination, evolving into a new pathogenic variant, resulting in the loss of variety resistance and then triggering a new large-scale occurrence of bacterial blight (Yu Tengqiong, Xiao Suqin, Yin Fuyou, et al. Analysis of resistance to bacterial blight in Yunnan wild rice and local rice resources [J]. Acta Phytophylacica Sinica, 2016, 43(5):8. DOI: 10.13802 / j.cnki.zwbhxb.2016.05.010.). Therefore, the discovery of new bacterial blight resistance genes, especially broad-spectrum resistance genes, is an important guarantee for broadening the disease resistance spectrum of rice varieties and the green and sustainable development of rice production.

[0005] Oryza meyeriana is mainly distributed in the tropical regions of Yunnan and the southwestern part of Hainan. It still retains a relatively primitive morphology under long-term natural selection and has the characteristics of high resistance or even immunity to Xanthomonas oryzae pv. oryzae. It is a natural treasure trove for exploring bacterial blight resistance gene resources. However, since Oryza meyeriana belongs to the GG chromosome group and has a relatively distant genetic relationship with cultivated rice of the AA chromosome group, its excellent disease-resistant genes cannot be utilized through traditional cross-breeding methods. Therefore, the utilization of resistance genes in Oryza meyeriana is greatly restricted.

[0006] There have been many studies on the genes resistant to bacterial blight in rice, and they have been applied to disease-resistant breeding. A large number of practices have proved that cloning disease-resistant genes and cultivating disease-resistant varieties are the most economical and environmentally friendly methods for controlling bacterial blight, and also the only way for the green development of agriculture. However, after a single disease-resistant variety is planted on a large scale for a period of time, due to selection pressure, the pathogenic bacteria are prone to adaptive evolution, and new pathogenic strains or races appear, which will cause the variety to lose its resistance and lead to a large-scale outbreak of bacterial blight in a new round. Therefore, excavating new excellent disease-resistant genes and studying the molecular mechanisms of their mediated disease resistance will provide theoretical guidance for molecular breeding of disease resistance. Summary of the Invention

[0007] The present invention provides a broad-spectrum bacterial blight-resistant gene OgXa1 cloned from Oryza meyeriana, which is induced by Xanthomonas oryzae pv. oryzae. The rice plants overexpressing OgXa1 confer broad-spectrum bacterial blight resistance by enhancing the expression of defense-related genes.

[0008] Based on the transcriptome and gene sequencing of Oryza meyeriana, the local blast software was downloaded, and a local blast database was constructed using the CDS sequences of Oryza meyeriana, with the e-value limited to 1e -5 . The CDS sequence of the Xa1 gene in rice was used for homologous alignment search in the Oryza meyeriana database, and a Unigene gene Unigene0008772 with a sequence homology of 76% was searched and named OgXa1. Further, specific PCR primers (OgXa1-5’: 5’-CCCTGCGATGGTGCTTAGGCATTTATGTGC-3’ and OgXa1-3’ : 5’-AGGCTGCGCCTTTCATGGAGTCAGTCCTTG-3’ ) were designed according to the sequence of Unigene0008772, and the full-length CDS sequence of OgXa1 was obtained from Oryza meyeriana by 3’ / 5’RACE, which was 4860 bp, and the sequence was shown as SEQ ID No.2. Specific primers (OgXa1-F: 5’-ATGGAGGAGGTGGAAGCCACTC-3’ / OgXa1-R: 5’-TCAATACACATATTCCTCACCAATTTTG-3’) were designed according to the CDS sequence of OgXa1, and PCR amplification was carried out using the genomic DNA of Oryza meyeriana as a template to obtain a full-length gene sequence of 5287bp ( Figure 1 ), and the sequence was shown as SEQ ID No.1.

[0009] Total RNA was extracted from the leaves of Oryza granulata, reverse-transcribed into cDNA, and using the cDNA as a template, the CDS sequence of the OgXa1 gene was amplified by PCR with specific primers OgXa1-F: 5’-ATGGAGGAGGTGGAAGCCACTC-3’ / OgXa1-R: 5’-TCAATACACATATTCCTCACCAATTTTG-3’. The length of the CDS sequence was 4,860 bp, and the sequence was as shown in SEQ ID No.2.

[0010] The CDS sequence of the OgXa1 gene encodes an NBS-LRR protein consisting of 1,619 amino acids (the sequence is as shown in SEQ ID No.3). The conserved domains mainly include the RX_N domain (30-105 aa), the ZnF_BED domain (139-186 aa), the NB-ARC domain (300-539 aa), and the LRR conserved domain (1,042-1,467 aa) ( Figure 2 ).

[0011] The CDS sequence of OgXa1 was ligated into an overexpression vector (pCAMBIA1300), and by using the Agrobacterium-mediated genetic transformation method, the overexpression vector was introduced into the susceptible japonica rice Nipponbare to obtain transgenic rice plants overexpressing OgXa1. The wild-type Nipponbare and the T 0 -generation positive transgenic lines were inoculated with the rice bacterial blight pathogen PXO99 by the leaf-cutting method at the booting stage, and the lesion length and the proportion of the lesion in the total leaf length were investigated. The results showed that the transgenic rice lines overexpressing OgXa1 significantly enhanced the resistance to the rice bacterial blight pathogen. Further, the T 1 -generation positive transgenic lines and the wild-type Nipponbare were inoculated with the rice bacterial blight pathogens PXO99, P3, P8, Y8, and FuJ-Xa7 by the leaf-cutting method for resistance identification. The results showed that the lesion length and the proportion of the lesion in the leaf of the transgenic lines were significantly lower than those of the wild-type Nipponbare, indicating that OgXa1 can significantly enhance the resistance of rice to different pathogenic rice bacterial blight pathogens and is an excellent new gene with broad-spectrum and high resistance to the rice bacterial blight pathogen. Through RT-qPCR, the relative expression levels of the defense-related genes PR1a and PR10a in the T 1 -generation positive transgenic lines were studied at 0 h, 48 h, and 72 h after inoculation with the rice bacterial blight pathogen PXO99. The results showed that the expression levels of PR1a and PR10a in the transgenic plants overexpressing OgXa1 were higher than those of the control, and were significantly up-regulated by the induction of the pathogen. The above results all indicate that OgXa1 is a new broad-spectrum rice bacterial blight resistance gene, and this gene can further enhance the expression of defense-related genes and enhance the resistance of rice plants to the rice bacterial blight.

[0012] Therefore, this application requests to protect the application of the OgXa1 gene in improving the resistance of rice to the rice bacterial blight.

[0013] The second object of the present invention is to provide the application of the CDS region sequence of the OgXa1 gene shown in SEQ ID No.2 in improving the resistance of rice to bacterial blight.

[0014] The third object of the present invention is to provide the application of the amino acid sequence encoded by the OgXa1 gene shown in SEQ ID No.3 in improving the resistance of rice to bacterial blight.

[0015] The fourth object of the present invention is to provide the application of the OgXa1 gene shown in SEQ ID No.1 or the CDS region of the OgXa1 gene shown in SEQ ID No.2 or the amino acid sequence encoded by the OgXa1 gene shown in SEQ ID No.3 in the breeding of rice varieties resistant to bacterial blight.

[0016] The fifth object of the present invention is to provide primers for amplifying the OgXa1 gene shown in SEQ ID No.1 or the CDS sequence of the OgXa1 gene shown in SEQ ID No.2, and the primer sequences are as follows:

[0017] OgXa1-F: 5’-ATGGAGGAGGTGGAAGCCACTC-3’

[0018] OgXa1-R: 5’-TCAATACACATATTCCTCACCAATTTTG-3’

[0019] The sixth object of the present invention is to provide a recombinant vector containing the OgXa1 gene shown in SEQ ID No.1 or the CDS sequence of the OgXa1 gene shown in SEQ ID No.2.

[0020] Furthermore, the original vector of the recombinant vector is the plant expression vector pCAMBIA1300.

[0021] The seventh object of the present invention is to provide a method for improving the resistance of rice to bacterial blight by using the OgXa1 gene shown in SEQ ID No.1 or the CDS region of the OgXa1 gene shown in SEQ ID No.2 or the amino acid sequence encoded by the OgXa1 gene shown in SEQ ID No.3, and the steps include:

[0022] (1) Extract the total RNA from the leaves of Oryza meyeriana, and reverse transcribe it into cDNA;

[0023] (2) Use the cDNA as a template to perform PCR amplification to obtain the CDS sequence of the OgXa1 gene, as shown in SEQ ID No.2, with a full length of 4860 bp;

[0024] (3) Connect the gene OgXa1 fragment to the overexpression vector (pCAMBIA1300) to obtain the plasmid pCAMBIA1300 - OgXa1 that overexpresses the target gene OgXa1;

[0025] (4) Introduce the plasmid pCAMBIA1300 - OgXa1 into Agrobacterium;

[0026] (5) Co - culture the Agrobacterium containing the plasmid pCAMBIA1300 - OgXa1 with rice plants to obtain disease - resistant rice lines.

[0027] The beneficial technical effects of the present invention are as follows: The present invention homologously cloned the homologous gene OgXa1 of Xa1 in rice that has specific resistance to the dominant race 1 of single Japanese bacterial blight from Oryza granulata through PCR amplification. This gene shows broad - spectrum disease resistance to Xanthomonas oryzae pv. oryzae, encodes an NBS - LRR protein, and the transgenic rice plants overexpressing OgXa1 can significantly enhance the resistance of rice to multiple Xanthomonas oryzae pv. oryzae strains, with the resistance reaching an almost immune level. It has good application prospects in the breeding of rice varieties resistant to bacterial blight and provides a new paradigm for the excavation and development of excellent bacterial blight - resistant genes in Oryza granulata. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0029] Figure 1 Schematic diagram of the gene structure of OgXa1; Exons are represented by black boxes, and introns are represented by black lines.

[0030] Figure 2 Schematic diagram of the protein structure of OgXa1.

[0031] Figure 3 It is the PCR electrophoresis result of the CDS sequence of OgXa1 in Example 1; M: Trans 2KPLUS marker, and the bands of 4 lines represent 4 replicates.

[0032] Figure 4 It is the total relative expression level of OgXa1 in the seedlings of different over - expression transgenic lines in Example 3; A: Electrophoresis result of positive identification of different OgXa1 over - expression transgenic lines by using hygromycin primer HYG and OgXa1 gene - specific primer; B: Relative expression level of OgXa1 in different transgenic lines.

[0033] Figure 5 is the resistance performance of the OgXa1-OX T 0 generation lines against PXO99; (A) Resistance identification of OgXa1-OX transgenic T 0 generation lines 14 days after inoculation with PXO99; (B) Lesion length of OgXa1-OX T 0 generation transgenic plants 14 days after inoculation with PXO99; (C) Percentage of the lesion length to the total leaf length of OgXa1-OX T 0 generation transgenic plants 14 days after inoculation with PXO99.

[0034] Figure 6 is the resistance identification of OgXa1-OX T 1 generation plants inoculated with different Xanthomonas oryzae pv. oryzae strains; (A) Resistance identification of OgXa1-OX transgenic T 1 generation plants 14 days after inoculation with Xanthomonas oryzae pv. oryzae; (B) Lesion length of OgXa1-OX T 1 generation transgenic plants 14 days after inoculation with Xanthomonas oryzae pv. oryzae; (C) Percentage of the lesion length to the total leaf length of OgXa1-OX T 1 generation transgenic plants 14 days after inoculation with Xanthomonas oryzae pv. oryzae.

[0035] Figure 7 is the expression of pathogenesis-related genes PR1a and PR10a in OgXa1-OX T 1 generation transgenic plants in Example 5. Detailed implementation manners

[0036] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0037] 1. Materials and reagents used in the experiment

[0038] 1.1 Rice materials

[0039] (1) Oryza meyeriana, highly resistant or nearly immune to Xanthomonas oryzae pv. oryzae, carrying excellent Xanthomonas oryzae pv. oryzae resistance genes.

[0040] (2) Nipponbare: A japonica rice variety, susceptible to the Philippine race PXO99. Used as the receptor material for overexpression transgenic in this experiment.

[0041] 1.2 Test Strains and Vectors

[0042] (1) Test Xanthomonas oryzae pv. oryzae strains: PXO99, P3, P8, Y8, FuJ-Xa7

[0043] (2) Plasmid vector: pCAMBIA1300

[0044] (3) Escherichia coli strain: DH5α

[0045] (4) Agrobacterium strain: EHA105

[0046] 1.3 Common Molecular Biology Reagents

[0047] (1) High-fidelity enzyme: KOD FX Neo (No.KFX-201) (Guangzhou Skyworth Biotechnology Co., Ltd.)

[0048] (2) Ordinary PCR amplification enzyme: Easy Taq @ DNA polymerase kit (Beijing TransGen Biotech Co., Ltd.)

[0049] (3) Gel extraction kit: EasyPure Quick Gel Extraction Kit (Beijing TransGen Biotech Co., Ltd., EG101)

[0050] (4) RNA extraction kit: MiniBEST Plant RNA Extraction Kit (TaKaRa)

[0051] (5) Long-chain RNA reverse transcription kit: SuperScript Ⅲ First-Strand Synthesis Systemfor RT-PCR (invitrogen, 1844575)

[0052] (6) Reverse transcription kit: ReverTra Ace qPCR RT Master Mix RNA (TOYOBO)

[0053] (7) Cloning vector kit: T-Vector pMD19 Cloning Kit (TransGen)

[0054] (8) Plasmid extraction kit: MiniBEST Plasmid Purification Kit Ver.2.0 (TaKaRa)

[0055] (9) Fluorescent quantitative kit: GoTaq qPCR Master Mix (Promega)

[0056] 1.4 Medium preparation

[0057] (1)Formula of NA liquid medium: Peptone 5 g / L, yeast powder 1 g / L, sucrose 10 g / L, beef extract 3 g / L. Dissolve in 800 mL of pure water, adjust the pH to 7.0, make up the volume to 1 L. For solid medium, 20 g / L of agar powder needs to be added.

[0058] (2)Formula of LB medium: Tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L. Dissolve in 800 mL of pure water, adjust the pH to 7.0, make up the volume to 1 L. After autoclaving and cooling to about 55 °C, add antibiotics (1 mL / L). For solid medium, 15 g / L of agar powder needs to be added.

[0059] Example 1

[0060] 1. Cloning and structural analysis of OgXa1 gene

[0061] Based on the transcriptome and gene sequencing of Oryza granulata, the local blast software was downloaded, and a local blast database was constructed using the CDS sequence of Oryza granulata, with the e-value limited to 1e -5 。The CDS sequence of the Xa1 gene in rice was used for homologous alignment search in the Oryza granulata database, and a Unigene gene Unigene0008772 with a sequence homology of 76% was found and named OgXa1. Further, specific PCR primers (OgXa1-5’: 5’-CCCTGCGATGGTGCTTAGGCATTTATGTGC-3’ and OgXa1-3’ : 5’-AGGCTGCGCCTTTCATGGAGTCAGTCCTTG-3’ ) were designed according to the sequence of Unigene0008772, and the full-length CDS sequence of OgXa1 of 4860 bp was obtained from Oryza granulata by 3’ / 5’RACE. The sequence is shown in SEQ ID No.2. Specific primers (Table 1) were designed according to the CDS sequence of OgXa1, and PCR amplification was carried out using the genomic DNA of Oryza granulata as a template to obtain the full-length sequence of this gene of 5287 bp, which consists of 3 exons and 2 introns ( Figure 1 ), and the sequence is shown in SEQ ID No.1.

[0062] Table 1 CDS amplification primers of OgXa1 gene

[0063] Primer Name Primer Sequence OgXa1-F 5’-ATGGAGGAGGTGGAAGCCACTC-3’ OgXa1-R 5’-TCAATACACATATTCCTCACCAATTTTG-3’

[0064] 2. Cloning of OgXa1 gene CDS sequence and protein structure analysis

[0065] Total RNA was extracted from the leaves of *Oryza granulata* using an RNA extraction kit (TaKaRa, Dalian, China). The RNA concentration was detected using a NanoDrop 2000 UV-Vis Spectrophotometer (Thermo Fisher Scientific, Waltham, Massachusetts, USA), and each sample was measured three times repeatedly.

[0066] The total RNA of *Oryza granulata* was reverse transcribed using an RNA long-chain reverse transcription kit (invitrogen, 1844575) according to the method provided by the manufacturer to synthesize the first-strand cDNA.

[0067] Specific PCR primers (Table 1) were designed based on the full-length CDS sequence of OgXa1 (shown in SEQ ID No. 2) obtained from *Oryza granulata* by 3' / 5' RACE. Using the cDNA of *Oryza granulata* as a template, KOD polymerase was used according to the system in Table 2, and the amplification conditions were as follows: pre-denaturation at 94 °C for 5 min; denaturation at 98 °C for 30 s; annealing at 58 - 60 °C for 30 s (the annealing temperature was adjusted according to the primers); extension at 68 °C for 30 Sec / kb (the extension time was appropriately adjusted according to the length of the target fragment, and the extension time was set to 3 min in this experiment); 30 cycles, and final extension at 68 °C for 7 min for the full-length CDS amplification.

[0068] Table 2 PCR reaction system

[0069] Component Volume 10 x buffer 1 μL 2 mM dNTPs 2 μL Primer F 0.5 μL (0.005 nM) Primer R 0.5 μL(0.005 nM) KOD Enzyme 0.4 μL(1 U) cDNA 1 μL <![CDATA[ddH 2 O]]> 5.6 μL

[0070] The PCR products were subjected to 1.0% agarose gel electrophoresis (as shown in Figure 3 ), and the target fragments were recovered and purified using an EasyPure Quick Gel Extraction Kit and sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing.

[0071] The full-length CDS sequence of OgXa1 is 4860 bp (shown in SEQ ID No. 2), encoding an NBS-LRR protein composed of 1619 amino acids (shown in SEQ ID No. 3), containing conserved RX_N domain (30 - 105 aa), ZnF_BED domain (139 - 186 aa), NB-ARC domain (300 - 539 aa), and LRR conserved domain (1042 - 1467 aa) ( Figure 2 )

[0072] Example 2

[0073] Construction of the overexpression OgXa1 gene vector, the steps include:

[0074] 1. Total RNA was extracted from leaves using the MiniBEST Plant RNA Extraction Kit, and the integrity of the RNA was detected by 2% agarose gel electrophoresis. The concentration and purity were detected using a UV spectrophotometer (model: UV-2700). The first-strand cDNA was synthesized using the SuperScript Ⅲ First-Strand Synthesis System for RT-PCR reverse transcription kit and stored at -20°C for later use.

[0075] 2. Using the OgXa1 specific amplification primers (Table 1), the CDS sequence of the OgXa1 gene with restriction enzyme sites was amplified by PCR technology.

[0076] 3. Construction of the vector by T4 ligation method

[0077] Plasmid vector: The plasmid vector pCAMBIA1300 was kindly provided by Researcher Cheng Zhukuan of the State Key Laboratory of Plant Genomics, Institute of Genetics and Developmental Biology, Chinese Academy of Sciences. The vector contains two 35S strong promoters, one for initiating the target gene and the other for initiating the hygromycin gene, which was used to construct the overexpression vector in this study. After the PCR product was detected by gel electrophoresis and recovered and purified, it was stored at -20°C for later use. Then, the overexpression vector pCAMBIA1300 was digested with the restriction enzyme Kpn1. The digestion system was 50 µL: 5 µL pCAMBIA1300, 2 µL Kpn1 restriction enzyme, 5 µL 10× Buffer, and ddH 2 O was added to make up to 50 µL. The digestion was carried out overnight at 37°C, detected by 1% gel electrophoresis, and the vector fragment of the expected size was purified and recovered.

[0078] Then the CDS fragment recovered from the OgXa1 gel was ligated to the overexpression vector pCAMBIA1300 purified and recovered after digestion. The reaction system was 10 µL: 3 µL target fragment (10 ng·µL −1 ), 2 µL linearized vector after digestion, 5 µL 2× Seamless Master Mix, and the ligation reaction was carried out at 50°C for 15 min.

[0079] Take 10 µL of the ligation product and transform Escherichia coli. Finally, 3 positive clone bacterial solutions were picked and sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing. The results were aligned by Vector NTI Advance 11 to determine that the target gene was successfully inserted into the overexpression vector pCAMBIA1300 - OgXa1.

[0080] 4. Transformation and screening of recombinant plasmids

[0081] (1) Add 10 μL of the ligation product to 50 μL of DH5α E. coli competent cells and mix thoroughly.

[0082] (2) Place on ice for 30 min. After heat shock at 42°C for 45 s, place on ice for 2 min.

[0083] (3) Add 1 mL of LB liquid medium without antibiotics and incubate at 37 °C and 200 rpm for 1 h.

[0084] (4) Use a spreading stick to evenly spread the bacteria on the LB solid medium containing kan. Incubate the medium upside down at 37°C for 12 h.

[0085] (5) In the clean bench, pipette 500 μL of LB liquid medium containing Kan into a 1.5 mL centrifuge tube, randomly pick 12 colonies with a small pipette tip, place them in the centrifuge tube, and shake the culture at 37°C and 200 rpm for 4 h. Use Taq enzyme to perform PCR identification on the shaken bacterial liquid. Send the positive identification results for testing, and extract the plasmid after the results are confirmed by comparison.

[0086] 5. Agrobacterium transformation

[0087] Take 1 μL of plasmid and add it to 50 μL EHA105 Agrobacterium competent cells, mix thoroughly and then pipette it into the electroporation cup. After electroporation, quickly add 1 mL of LB liquid culture medium, mix thoroughly and then pipette it into a 1.5 mL centrifuge tube. Incubate at 30 ℃ and 180 rpm for 30 min. Pipette 50 μL of activated Agrobacterium culture liquid and spread it evenly on LB solid culture medium. Incubate it inverted in the dark at 30 ℃ for 48 h. Randomly pick 5 single colonies for PCR detection to screen positive clones. 1% gel electrophoresis detection. If the electrophoresis bands of the positive control and sample are clear and of the correct size, and there are no bands in the negative control, it indicates that the sample can proceed to the next step.

[0088] 6. Rice callus induction

[0089] (1) Select Nipponbare seeds without mold spots and with normal buds, disinfect them with 75% alcohol for 1 min, and then wash them three times with sterile water.

[0090] (2) Add 15% sodium hypochlorite and disinfect for 10 minutes, then rinse with sterile water until no residual sodium hypochlorite is left.

[0091] (3) Use sterile filter paper to absorb the liquid on the surface of the seeds, and use sterile tweezers to evenly inoculate the sterilized seeds on the N6 induction medium. Place them in a 30℃ incubator and culture them in the dark for about 10 days until tender yellow callus tissue grows.

[0092] 7. Infection and Co-cultivation

[0093] (1) Pick up Agrobacterium and place it in the infection solution to prepare an Agrobacterium resuspension with an OD 600 = 0.2.

[0094] (2) Pick up the callus and place it in an Erlenmeyer flask. Add the Agrobacterium resuspension. After infecting for 10 - 15 min, discard the bacterial solution. After blotting the bacterial solution on the surface of the callus with filter paper, inoculate the callus onto the co-culture medium and co-culture at 20°C for 72 h.

[0095] 8. Screening, differentiation and rooting culture

[0096] (1) Transfer the callus to the screening medium and incubate it in the dark in a constant temperature incubator at 26°C for about 30 days. Change the medium every 10 days.

[0097] (2) Inoculate the initially screened positive callus onto the secondary screening medium. When picking the callus, be sure to pick monoclonal callus and incubate it in the dark at 26°C for 7 - 10 days.

[0098] (3) Inoculate the positive callus onto the differentiation medium and culture it under light at 27°C for about 20 days. After green buds differentiate, inoculate them onto the rooting medium and culture them under light at 30°C for about 10 days;

[0099] (4) When the seedlings grow to about 10 cm, take them out of the medium, remove the residual medium from the roots of the seedlings, culture them with tap water for about 5 days, and transplant the still healthy and surviving small seedlings into the soil.

[0100] Example 3

[0101] Identification of overexpressed transgenic lines

[0102] 1. Identification of positive rice lines overexpressing the OgXa1 gene

[0103] Hygromycin soaking method: Add 650 μL of hygromycin solution with a concentration of 50 mg / mL and 1 mL of 6 - BA mother solution with a concentration of 1 mg / mL to 1 L of hygromycin soaking solution, and adjust the pH to 7. Mark the serial numbers on the back of the rice leaves of the transgenic plants, cut about 2 cm long rice leaves (leave another same serial number on the plant), place them in the hygromycin soaking solution, and observe whether there are brownish - black imprints at the cut of the leaves after 3 - 5 days. If there are, it is a negative plant; if the whole leaf is green, it is a positive plant.

[0104] PCR-positive transgenic plants: Based on the hygromycin soaking method, the DNA of the above-identified positive transgenic plants was further extracted by the CTAB method. Primers for amplifying the hygromycin gene (HYG) and specific fragments of OgXa1 (including the inserted fragment and the foreign-introduced fragment) were designed, and PCR was used to detect the presence of HYG and specific fragments in the transgenic rice plants to determine whether they were positive plants. Finally, 5 positive T 0 -generation transgenic plants ( Figure 4 A) were identified.

[0105] Primers used for detecting transgenic plants:

[0106] HYG -F: 5’-GAGCATATACGCCCGGAGTC-3’

[0107] HYG -R: 5’-CAAGACCTGCCTGAAACCGA-3’

[0108] OgXa1-OX- F: 5’- ATTGCGATAAAGGAAAGGCCATC-3’

[0109] OgXa1-OX-R: 5’- ACCGTGTCTTCAGGCTCATTCC-3’.

[0110] 2. Detection of gene expression levels

[0111] Total RNA of transgenic leaves was extracted using the MiniBEST Plant RNA Extraction Kit, and then the total RNA was reverse-transcribed into the first-strand cDNA using the ReverTra Ace qPCR RT Master Mix RNA reverse transcription kit from TOYOBO Co., Ltd. Using cDNA as a template and Ubiquitin (Ubi) as an internal reference gene, the expression level of the OgXa1 gene in overexpression lines was detected by qRT-PCR using the GoTaqqPCR Master Mix fluorescence quantitative kit from Promega Corporation. The qRT-PCR primers used are as follows:

[0112] Ubi-F: 5’-GCCCAAGAAGAAGATCAAGAAC-3’

[0113] Ubi-R: 5’-AGATAACAACGGAAGCATAAAAGTC-3’

[0114] OgXa1-qPCR-F: 5’-TGCAAGAGCTCCGATTTGAGC-3’

[0115] OgXa1-qPCR-R: 5’-TTCCAACGAAGGTGGGATACC-3’

[0116] The results showed that, compared with the Nipponbare control, the expression levels of OgXa1 in transgenic plants #1, #2, #4, #6, and #7 were significantly increased (the expression levels increased by 166 - 517 times) ( Figure 4 B).

[0117] Example 4

[0118] Resistance identification of transgenic lines

[0119] Rice cultivation: Collect seeds of positive transgenic lines with relatively high expression levels. Select a sufficient number of mature and plump rice seeds, disinfect, soak, and germinate them. When the root length of the seeds reaches about 1 cm, they can be sown in a black box filled with water for hydroponics. When all the roots grow to about 10 cm, change the water to nutrient solution and change it once a week. When the rice reaches the four-leaf stage, transplant it into a plastic pot (60 cm × 40 cm × 15 cm), keep the soil moist, and make marks. Do a good job in water and fertilizer management in the later stage, and use it for inoculation with Xanthomonas oryzae pv. oryzae when it grows to the booting stage. 0 Preparation of inoculation bacterial liquid: Streak the Xanthomonas oryzae pv. oryzae strain preserved in glycerol at -80 °C on an NB culture plate (5 g of peptone, 1 g of yeast extract, 10 g of sucrose, 3 g of beef extract, pH 6.8 - 7.0, made up to 1 L), and activate and culture it in an incubator at 28 °C for 2 d. Then, wash the bacteria with sterile water to prepare a suspension of Xanthomonas oryzae pv. oryzae, measure the cell concentration (OD

[0120] ) and adjust the final concentration to 0.5 - 0.6 for inoculating rice. Refer to the leaf-clipping inoculation method of Sun et al. for inoculation at the booting stage. Select 3 plants for each line, inoculate 2 fully expanded leaves of each rice plant, and conduct a disease investigation 14 days after inoculation. Evaluate the disease condition according to the percentage of the lesion length to the total leaf length. 600 ) and use it for inoculating rice. Refer to the leaf-clipping inoculation method of Sun et al. for inoculation at the booting stage. Select 3 plants for each line, inoculate 2 fully expanded leaves of each rice plant, and conduct a disease investigation 14 days after inoculation. Evaluate the disease condition according to the percentage of the lesion length to the total leaf length.

[0121] 1. Resistance identification of T 0 generation transgenic plants overexpressing OgXa1 against Xanthomonas oryzae pv. oryzae

[0122] Five T 0 generation lines with relatively high OgXa1 expression levels among the above-mentioned positive transgenic plants and the wild-type Nipponbare were inoculated with Xanthomonas oryzae pv. oryzae PXO99 for resistance identification. The lesion length and the percentage of the lesion length to the total leaf length were investigated 14 days later. The results showed that compared with the control Nipponbare, the lesion length of OgXa1-OX transgenic plants was significantly reduced ( Figure 5A and 5B), the percentage of lesion length of OgXa1 - OX plants in the total leaf length was about %, while that of the wild - type Nipponbare was 37.8% ( Figure 5 C). It indicated that OgXa1 significantly enhanced the resistance of rice to Xanthomonas oryzae pv. oryzae.

[0123] 2. Resistance identification of T 1 -generation transgenic plants overexpressing OgXa1 inoculated with multiple strains of Xanthomonas oryzae pv. oryzae (Xoo)

[0124] Using the T 1 -generation transgenic plants overexpressing OgXa1 and the wild - type Nipponbare as materials, they were inoculated with Xanthomonas oryzae pv. oryzae PXO99, P3, P8, Y8, FuJ - Xa7 for resistance identification. After 14 days, the lesion length and the percentage of lesion length in the total leaf length were investigated. The results showed that compared with the control Nipponbare, the lesion length of OgXa1 - OX transgenic plants was significantly reduced, and the percentage of lesion length in the total leaf length was significantly decreased ( Figure 6 A and 6B). The percentage of lesion length of OgXa1 - OX transgenic plants in the total leaf length was 4.1% - 19.8%, while that of the wild - type Nipponbare was 44% - 63.8% ( Figure 6 C), showing resistance to all 5 tested Xoo strains. It indicated that OgXa1 is an excellent new gene with broad - spectrum and high resistance to Xanthomonas oryzae pv. oryzae, and has important application value in rice disease - resistant breeding.

[0125] Example 5

[0126] Expression analysis of defense - related genes PR1a and PR10a in T 1 -generation transgenic plants of OgXa1 - OX

[0127] According to the method in 3 of Embodiment 2, the expression levels of defense - related genes PR1a and PR10a in OgXa1 - OX transgenic plants at 0 h, 48 h, and 72 h after inoculation with PXO99 were detected by RT - qPCR. The quantitative qRT - PCR primers used were as follows:

[0128] OsPR1a - F: 5’ - TACGGCGAGAACATCTTCTGG - 3’

[0129] OsPR1a - R: 5’ - TACCACTGCTTCTCCGACACC - 3’

[0130] OsPR10a - F: 5’ - TGCCGAATACGCCTAAGATG - 3’

[0131] OsPR10a-R: 5’-TGCCGAATACGCCTAAGATG-3’

[0132] The results showed that the expression levels of PR1a and PR10a in OgXa1-OX transgenic plants were higher than those in the control, and were significantly up-regulated by pathogen induction, indicating that the expression of OgXa1 in rice plants could further enhance the expression of defense-related genes and enhance the resistance of rice plants to bacterial blight ( Figure 7 ).

[0133] Finally, it should be noted that the above embodiments are only used to illustrate rather than limit the technical solutions of the present invention. Although the present invention has been described in detail with reference to the above embodiments, those of ordinary skill in the art should understand that: the present invention can still be modified or equivalently replaced, and any modification or partial replacement without departing from the spirit and scope of the present invention shall be covered by the scope of the claims of the present invention.

Claims

1. Application of the OgXa1 gene as shown in SEQ ID No. 1 in improving resistance to rice bacterial blight.

2. Application of the OgXa1 gene CDS sequence as shown in SEQ ID No. 2 in improving resistance to rice bacterial blight.

3. Application of the amino acid sequence encoded by the OgXa1 gene as shown in SEQ ID No. 3 in improving resistance to rice bacterial blight.

4. Use of the OgXa1 gene as shown in SEQ ID No.1 or the CDS sequence of the OgXa1 gene as shown in SEQ ID No.2 or the amino acid sequence encoded by the OgXa1 gene as shown in SEQ ID No.3 in the breeding of rice varieties resistant to bacterial blight.

5. Primers for amplifying the OgXa1 gene according to claim 1 or the CDS sequence of the OgXa1 gene according to claim 2, characterized in that: The primer sequences are: OgXa1-F: 5'-ATGGAGGAGGTGGAAGCCACTC-3' OgXa1-R: 5'-TCAATACACATATTCCTCACCAATTTTG-3'.

6. A recombinant vector comprising the OgXa1 gene according to claim 1 or the CDS sequence of the OgXa1 gene according to claim 2.

7. The recombinant vector according to claim 6, characterized in that: The original vector of the recombinant vector is the expression vector pCAMBIA1300.

8. A method for improving rice bacterial blight resistance using the CDS sequence of the OgXa1 gene as shown in SEQ ID No.1 or the OgXa1 gene as shown in SEQ ID No.2 or the amino acid sequence encoded by the OgXa1 gene as shown in SEQ ID No.3, characterized in that the steps include: (1) Total RNA was extracted from leaves of Oryza granulata and reverse transcribed into cDNA; (2) Using cDNA as a template, PCR amplification was performed to obtain the CDS sequence of the OgXa1 gene, as shown in SEQ ID No. 2, with a total length of 4860 bp; (3) Connecting the full-length CDS fragment of the gene OgXa1 to the expression vector to obtain the plasmid pCAMBIA1300-OgXa1 that overexpresses the target gene OgXa1; (4) Introducing plasmid pCAMBIA1300-OgXa1 into Agrobacterium; (5) Disease-resistant transgenic rice lines can be obtained by co-culturing Agrobacterium containing plasmid pCAMBIA1300-OgXa1 with rice plants.

Images