Application of cotton gene GhNUP160 in regulation and control of verticillium wilt resistance
By increasing the expression of the cotton gene GhNUP160, the nuclear pore complex protein it encodes enhances the disease resistance of cotton, solving the problem of difficult to effectively prevent and treat cotton verticillium wilt in the prior art, and achieving effective resistance to verticillium wilt.
Patent Information
- Application Number
- CN202510530994.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-25
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2045-04-25
AI Technical Summary
The existing technology is difficult to effectively prevent and control cotton verticillium wort, which poses a threat to the sustainable development of cotton production.
By increasing the expression of the cotton gene GhNUP160, the nuclear pore complex protein it encodes to fight verticillin wort, enhancing the disease resistance of cotton.
It improves the resistance of cotton to verticillium wilt, significantly reduces the invasion of pathogens to plants, and provides new genetic resources for resistance breeding.
Smart Images

Figure CN120060351A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering, and specifically relates to a cotton gene GhNUP160 for use in regulating Verticillium wilt resistance. Background Art
[0002] Cotton ( Gossypium hirsutum L. ), an annual herbaceous or perennial shrub plant of the genus Gossypium in the family Malvaceae, is an important fiber crop in the world, providing important natural plant fibers, oils, and feed proteins for people's lives. Cotton Verticillium wilt ( Verticillium wilt ) is a soil-borne vascular disease caused by Verticillium dahliae ( Verticillium dahliae Kleb. ), which can infect a variety of vegetables, fruits, and other cash crops. Verticillium wilt is also one of the most harmful and widespread plant diseases in the world's cotton-producing areas. Due to its special pathogenic mechanism, no effective control method has been developed yet, posing a serious threat to the sustainable development of cotton production.
[0003] After cotton is infected by Verticillium dahliae, it will induce a series of defense genes, including genes related to hormones, reactive oxygen species, kinases, secondary metabolites, etc., and then trigger a series of defense reactions, causing changes in the types and contents of resistance-related physiological and biochemical substances, thereby exerting a resistance effect and achieving the resistance of host cotton to pathogens. The gene ID of the cotton gene GhNUP160 is Gh_D11G308200.3. The full length of the CDS of this gene is 4461bp, and the encoded protein is a nuclear pore complex protein, which may play a role in the transport of resistance substances produced by plants. Studying GhNUP160 the function of the gene can provide new gene resources for cotton resistance breeding. Summary of the Invention
[0004] Aiming at the problems existing in the prior art, the purpose of the present invention is to provide a new application of a cotton gene GhNUP160 in regulating Verticillium wilt resistance, and to expand the application scope of the gene GhNUP160 in resisting Verticillium wilt.
[0005] The technical solution of the present invention is as follows: First aspect: The present invention discloses the application of the cotton gene GhNUP160 gene 、GhNUP160 the encoded protein of the gene 、 or an expression cassette or recombinant plant expression vector containing GhNUP160 the gene in regulating cotton Verticillium wilt resistance, and the CDS sequence of the cotton gene GhNUP160 is shown in SEQ ID No.1.
[0006] Preferably, the application is to increase the cotton gene GhNUP160Expression level, thereby improving the resistance of cotton to Verticillium wilt.
[0007] Cotton gene GhNUP160 Gene 、GhNUP160 Coding protein of the gene 、 Or containing GhNUP160 Application of the gene expression cassette or recombinant plant expression vector containing the gene in cultivating cotton varieties resistant to Verticillium wilt.
[0008] Second aspect: The present invention also discloses a method for improving the resistance of cotton to Verticillium wilt, by increasing GhNUP160 Expression level of the gene, and the CDS sequence of the cotton gene GhNUP160 Is shown in SEQ ID No.1.
[0009] Advantages and positive effects of the present invention are: Using VIGS technology to obtain gene-silenced cotton plants, through Verticillium dahliae stress treatment, the tolerance of the silenced plants to Verticillium dahliae is significantly reduced. The above results all indicate that GhNUP160 The gene plays a positive role in the process of plants resisting Verticillium wilt. Brief description of the drawings
[0010] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following will briefly introduce the drawings required to be used in the embodiments. It should be understood that the following drawings only show the embodiments of the present invention, and therefore should not be regarded as limiting the scope. For those of ordinary skill in the art, without creative efforts, other related drawings can also be obtained based on these drawings.
[0011] Figure 1 Is the TRV provided by the embodiment of the present invention: GhNUP160 Silencing efficiency and expression level of the target gene in the silenced plants; Figure 2 Is the TRV provided by the embodiment of the present invention: GhNUP160 Silenced cotton plants. Detailed implementation manners
[0012] The methods used in the following embodiments are all conventional methods unless otherwise specified.
[0013] The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.
[0014] Example 1 Verification using VIGS GhNUP160 Role in cotton's resistance to Verticillium dahliae stress Total RNA was extracted from semi-wild cotton Marie-Galante 1844 (from the National Wild Cotton Germplasm Repository). After removing gDNA with DNase I, it was reverse transcribed into cDNA and used as a template for amplifying genes. Specific primers were used for PCR amplification to construct a VIGS gene silencing vector. Through the forward primer VIGS-nupF: aaggttaccgaattc tctaga GACAATGGTGGGTTCGCTCC (the underlined part is the recognition site of restriction endonuclease Xba I) and the reverse primer VIGS-nupR: cgtgagctcggtacc ggatcc CGGAGATAGTTACGGTATAAAGCAAG (the underlined part is the recognition site of restriction endonuclease BamH I) to amplify GhNUP160 the gene fragment. The VIGS fragment was ligated into the pTRV2 vector digested with Xba I and BamH I using homologous recombinase. The constructed TRV: GhNUP160 gene silencing vector was transformed into Agrobacterium tumefaciens GV3103. The TRV:00 Agrobacterium was used as a negative control, and the TRV:PDS Agrobacterium was used as a positive control. After adjusting the OD 600 value of the Agrobacterium liquid to 1.5, an experiment of Agrobacterium infecting cotton leaves was carried out.
[0015] Semi-wild cotton Marie-Galante 1844 was used as the VIGS injection material. The seeds of Marie-Galante 1844 were planted in bottomless paper pots and placed in a greenhouse, growing under the conditions of 28 °C, 16 h light / 8 h darkness. When the two cotyledons of the seedlings were flat, VIGS injection was carried out. The back of the cotyledon was gently scratched with a syringe needle, and the bacterial liquid was injected into the whole cotyledon. After injection, it was cultured in the dark for 24 h, and then transferred to normal conditions for cultivation. After the plant grew three true leaves, it was subjected to Verticillium dahliae stress treatment.
[0016] Example 2 Phenotypic identification of gene-silenced cotton against Verticillium dahliae infection The TRV:00 and TRV: GhNUP160 were subjected to Verticillium dahliae inoculation treatment. Samples were taken at 0 h, 6 h, 12 h, 24 h, and 48 h respectively to detect the silencing efficiency at 0 h and the relative expression levels at each time. The results are as Figure 1 shown. The results show that GhNUP160 the disease resistance of cotton plants decreased after gene silencing.
[0017] The present invention compared the resistance of wild-type Marie-Galante 1844 and GhNUP160 gene-silenced plants to Verticillium dahliae inoculation. Figure 1In it, A is the plant inoculated with Verticillium dahliae and with the GhNUP160 gene successfully silenced, and its resistance to Verticillium wilt is significantly reduced compared with the plant without gene silencing. Figure 2 In it, B is the positive control plant treated with Verticillium dahliae, providing a reference standard for the resistance phenotype of the gene-silenced plants. Figure 2 In it, C is the positive control plant of the PDS gene set in the virus-induced gene silencing (VIGS) experiment, serving as an index to measure the virus vector infection efficiency and gene silencing effect. The results show that the leaves of the gene-silenced plants under Verticillium wilt stress turn yellow and begin to wilt, and it can be found that the resistance to Verticillium wilt is significantly weakened, indicating that this gene plays a positive role in the plant's resistance to Verticillium dahliae.
[0018] GhNUP160 Nucleotide sequence of the gene:
[0019] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. Cotton Genes GhNUP160 Gene 、GhNUP160 Gene encoding protein 、 or contain GhNUP160 Application of gene expression cassette or recombinant plant expression vector in regulating cotton Verticillium wilt resistance, the cotton gene GhNUP160 The CDS sequence of the gene is shown in SEQ ID No.
1.
2. The use according to claim 1, characterized in that Improving cotton genetics GhNUP160 The expression level of the gene can be increased, thereby improving the resistance of cotton to Verticillium wilt.
3. Cotton Genes GhNUP160 Gene 、GhNUP160 Gene encoding protein 、 or contain GhNUP160 Application of gene expression cassette or recombinant plant expression vector in breeding cotton varieties resistant to Verticillium wilt, the cotton gene GhNUP160 The CDS sequence of the gene is shown in SEQ ID No.
1.
4. A method for improving cotton resistance to Verticillium wilt, characterized in that: Improving cotton genetics GhNUP160 The expression level of the gene, the cotton gene GhNUP160 The CDS sequence of the gene is shown in SEQ ID No.1.
Citation Information
Patent Citations
Application of transcription factor GhTIFY3b in verticillium wilt resistance of plants
CN117165599A
Application of GhTPS6 gene in regulation and control of verticillium wilt resistance of cotton
CN117925700A
Application of cotton gene GhEDC13 in improving disease resistance of plants
CN118931952A