Biological process for preparation of 1, 2-propanediol
By reacting α-1,4-glucan lyase and 1,5-shrink-D-fructose reductase with starch, 1,5-shrinkol is generated, and 1,2-propanediol is efficiently produced by using enzymes such as glycokinase, which solves the problem of using expensive raw materials and toxic intermediates in the prior art, and an efficient and simplified production path is achieved.
Patent Information
- Application Number
- CN202311615909.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-29
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art has limitations on the use of expensive raw materials and toxic intermediates when microorganisms produce 1,2-propanediol, and the production path is complex and the efficiency is low.
The mixture of α-1,4-glucan lyase, 1,5-glucan-D-fructose reductase and related enzymes is reacted with a substrate containing α-1,4-glucosidic bonds to produce 1,5-glucosidic alcohol, and then further converted into 1,2-propylene glycol by catalysis by enzymes such as glycokinase.
Efficient production of 1,2-propanediol from inexpensive substrates such as starch is achieved, avoiding the defects of using expensive raw materials and toxic intermediates, simplifying the production path and improving efficiency.
Smart Images

Figure BDA0004578903370000691 
Figure BDA0004578903370000701 
Figure BDA0004578903370000702
Abstract
Description
Technical Field
[0001] The present application relates to the fields of genetic engineering, enzyme engineering and bioinformatics. Specifically, it relates to a biological method for preparing 1,2-propanediol. Background Art
[0002] 1,2-Propanediol is mainly used in the production of coatings and unsaturated polyester resins, and can also be used in the production of plasticizers and hydraulic brake fluids. In addition, 1,2-propanediol can be used as a good solvent in aspects such as the preparation of inks and epoxy resins; it can be used in non-ionic detergents to act as an enzyme stabilizer and solvent; and it can be used as an antifreeze and as a humectant in the pharmaceutical, cosmetic, animal food and tobacco industries.
[0003] Many bacteria have a natural 1,2-propanediol synthesis pathway that uses deoxysugars as raw materials. One advantage of microbial production is that the produced 1,2-propanediol is of a single configuration and can be used as a precursor for chiral pharmaceutical compounds.
[0004] Reported strategies for microbial production of 1,2-propanediol include the 6-deoxyhexose pathway (producing S-type 1,2-propanediol), the pyruvaldehyde pathway (producing R-type 1,2-propanediol) and the lactate pathway (producing racemic 1,2-propanediol). One of the main limitations of the 6-deoxyhexose pathway is that it requires expensive fucose and rhamnose as raw materials. All of the above three pathways involve toxic intermediates pyruvaldehyde and / or lactaldehyde.
[0005] Given that 1,2-propanediol is an important industrial raw material with important values and uses, the research on its synthesis pathway has important scientific research and industrial application values. Summary of the Invention
[0006] In a first aspect, the present application provides a new method for producing 1,2-propanediol, which includes:
[0007] a) Reacting a mixture I containing α-1,4-glucan lyase, 1,5-anhydro-D-fructose reductase and nicotinamide adenine dinucleotide reduced (NADH) or nicotinamide adenine dinucleotide phosphate reduced (NADPH) with a substrate containing an α-1,4-glycosidic bond such as starch or maltose; or reacting a culture solution of cells capable of expressing (such as heterologously expressing) and secreting α-1,4-glucan lyase and / or 1,5-anhydro-D-fructose reductase with NADH or NADPH and a substrate containing an α-1,4-glycosidic bond;
[0008] b) React the reaction product obtained in step a) with mixture II containing glucokinase, 1,5-anhydroglucitol-6-phosphate isomerase, radical enzyme activating enzyme, aldolase, and hydroxyacetone reductase, or co-culture with cells capable of expressing 1,5-anhydroglucitol-6-phosphate isomerase, radical enzyme activating enzyme, aldolase, hydroxyacetone reductase, and transport complex to obtain 1,2-propanediol.
[0009] In a second aspect, the present application provides a new method for producing 1,2-propanediol, which includes: reacting 1,5-anhydroglucitol with mixture II containing glucokinase, 1,5-anhydroglucitol-6-phosphate isomerase, radical enzyme activating enzyme, aldolase, and hydroxyacetone reductase, or co-culturing with cells capable of expressing 1,5-anhydroglucitol-6-phosphate isomerase, radical enzyme activating enzyme, aldolase, hydroxyacetone reductase, and transport complex to obtain 1,2-propanediol. In a preferred embodiment, the 1,5-anhydroglucitol is 1,5-anhydroglucopyranose or 1,5-anhydromannitol.
[0010] In some embodiments of the first aspect, the mixture I further contains other enzymes that regenerate NAD(P) + to NAD(P)H, such as formate dehydrogenase (FDH). In a specific embodiment, formate dehydrogenase and formate reduction produce NAD(P) + , to achieve the regeneration of NAD(P)H, thereby increasing the content of products such as 1,5-anhydroglucitol.
[0011] In some embodiments of the first aspect, the cells in step a) are also capable of expressing other enzymes that regenerate NAD(P) + to NAD(P)H, such as FDH. The cells can secrete the proteins they express (such as heterologous expression) extracellularly to participate in the reaction.
[0012] In some embodiments of the first aspect, by using cells such as Escherichia coli or yeast to heterologously express α-1,4-glucan lyase, 1,5-anhydro-D-fructose reductase, and / or other enzymes that regenerate NAD(P) + to NAD(P)H, such as formate dehydrogenase, and secreting the above enzymes extracellularly, the result of step a) is achieved.
[0013] In a specific embodiment of the first aspect, the transport complex is the bacterial phosphoenolpyruvate-phosphotransferase system (PTS).
[0014] In some embodiments of the first aspect, the 1,5-anhydro-D-fructose reductase is 1,5-anhydro-D-fructose reductase (Gafr) from Sus scrofa or 1,5-anhydro-D-fructose reductase (Mafr) from Ensifer adhaerens.
[0015] In some embodiments of the first aspect, the α-1,4-glucan lyase is derived from Gracilariopsis lemaneiformis, and / or the FDH is from Pseudomonas sp.
[0016] In some embodiments of the first aspect, the reaction product obtained in step a) is 1,5-anhydro sugar alcohol. In a specific embodiment, the 1,5-anhydro sugar alcohol is 1,5-anhydroglucitol or 1,5-anhydromannitol.
[0017] In some embodiments of the first aspect, the substrate containing an α-1,4-glycosidic bond is selected from starch, maltose or glycogen. In some embodiments, the starch is soluble starch. In some specific embodiments, the reaction of step a) is carried out in a solution containing starch, such as a culture medium.
[0018] In some embodiments of the first aspect, the sugar kinase or the transport complex phosphorylates the reaction product obtained in step a).
[0019] In some embodiments of the second aspect, the sugar kinase or the transport complex phosphorylates 1,5-anhydro sugar alcohol to 1,5-anhydro sugar alcohol-6-phosphate, such as 1,5-anhydroglucitol-6-phosphate or 1,5-anhydromannitol-6-phosphate.
[0020] In some specific embodiments, the sugar kinase is from Uniprot: Q7M537 and belongs to EC: 2.7.1.147.
[0021] In some embodiments of the first or second aspect, the cell is a eukaryotic cell or a prokaryotic cell. In some embodiments, the eukaryotic cell is a yeast cell. In other embodiments, the prokaryotic cell is selected from the genera Escherichia, Klebsiella, Streptococcus, Lactobacillus, Bifidobacterium, Bacteroidetes, and Firmicutes, etc. In a preferred embodiment, the cell is an Escherichia coli cell. In a specific embodiment, the cell is an Escherichia coli cell in which 1,5-AG and / or 1,5-AM induce high expression or are genetically engineered and highly expressed by a strong promoter-driven YbiW and / or PflD gene cluster. In some embodiments, the cell is an Escherichia coli MG1655 cell. In some embodiments of the first or second aspect, the 1,5-glycitol-6-phosphate isomerase comprises the amino acid sequence shown in SEQ ID NO:1 or a functional variant thereof, wherein the functional variant has 1,5-glucitol-6-phosphate isomerase activity. In some embodiments, the 1,5-glycitol-6-phosphate isomerase has an active site defined in terms of spatial conformation as follows: the active site comprises amino acid residues H165, H282, S283, H334, C441, E443, R453, T455, L562, S662, I664, and G786 that are close to each other in spatial conformation and are referenced to SEQ ID NO:1.
[0022] In some embodiments of the first or second aspect, the 1,5-glycitol-6-phosphate isomerase comprises the amino acid sequence shown in SEQ ID NO:97 or a functional variant thereof, wherein the functional variant has 1,5-mannitol-6-phosphate isomerase activity. In some embodiments, the 1,5-glycitol-6-phosphate isomerase has an active site defined in terms of spatial conformation as follows: the active site comprises amino acid residues Q162, H169, S277, S278, R323, F331, P335, C431, E433, D445, Y628, V630, and G752 that are close to each other in spatial conformation and are referenced to SEQ ID NO:97.
[0023] In some embodiments of the first or second aspect, the functional variant is a natural isoenzyme of the amino acid sequence shown in SEQ ID NO:97.
[0024] In some embodiments of the first or second aspect, the substrate of the 1,5-glycitol-6-phosphate isomerase is 1,5-glycitol-6-phosphate.
[0025] In some embodiments of the first or second aspect, the functional variant is generated by one or more amino acid insertions, substitutions, and / or deletions based on the amino acid sequence shown in SEQ ID NO: 1 or 97 or its natural isoenzyme.
[0026] In some embodiments of the first or second aspect, the transport complex comprises at least one of SEQ ID NOs: 150 - 153 or a functional variant thereof, and the transport complex has phosphoenolpyruvate-dependent phosphotransferase system transport activity.
[0027] In some embodiments of the first or second aspect, the radical enzyme activating enzyme is an S-adenosylmethionine radical enzyme family glycine radical enzyme activating enzyme.
[0028] In some embodiments of the first or second aspect, the aldolase is 1-deoxyfructose-6-phosphate aldolase.
[0029] In a third aspect, the present application provides a composition comprising α-1,4-glucan lyase, 1,5-anhydro-D-fructose reductase, and reduced nicotinamide adenine dinucleotide (NADH) or reduced nicotinamide adenine dinucleotide phosphate (NADPH), and its use in catalyzing the production of 1,5-anhydro sugar alcohol from a substrate containing an α-1,4-glycosidic bond. In some embodiments, the composition further comprises other enzymes that regenerate NAD(P) + to NAD(P)H, such as formate dehydrogenase (FDH). In some embodiments, the substrate containing an α-1,4-glycosidic bond is selected from starch, maltose, glycogen, etc.
[0030] In a fourth aspect, the present application provides a composition comprising glucokinase, 1,5-anhydro sugar alcohol-6-phosphate isomerase, radical enzyme activating enzyme, aldolase, and hydroxyacetone reductase, and its use in catalyzing the production of 1,2-propanediol from 1,5-anhydro sugar alcohol.
[0031] In some embodiments of the third or fourth aspect, the 1,5-anhydro sugar alcohol is 1,5-anhydroglucitol or 1,5-anhydromannitol. In some embodiments, the 1,5-anhydroglucitol or 1,5-anhydromannitol is phosphorylated by glucokinase to 1,5-anhydroglucitol-6-phosphate or 1,5-anhydromannitol-6-phosphate, respectively. Brief Description of the Drawings
[0032] Figure 1Schematic diagram of radical-dependent anhydroglycolysis. A. Gene cluster in Lactiplantibacillus plantarum (including the gene expressing 1,5-anhydroglucitol-6-phosphate isomerase shown in SEQ ID NO: 2) and the YbiW-dependent anhydroglycolysis pathway. B. Gene cluster in Escherichia coli (including the gene expressing 1,5-anhydromannitol-6-phosphate isomerase shown in SEQ ID NO: 98) and the PflD-dependent anhydroglycolysis pathway.
[0033] Figure 2 Electron paramagnetic resonance (EPR) spectroscopy and LC-MS enzymatic reaction analysis of YbiW. A. EPR spectra of LpYbiW with LpYbiY and titanium(III) citrate in the presence or absence of S-adenosylmethionine (SAM). B. Formation of 1-deoxyfructose-6-phosphate (1-deoxy-F6P) in the 1,5-anhydroglucitol-6-phosphate (1,5-AG-6P) isomerization catalyzed by LpYbiW detected by LC-MS. In the negative ion mode, the extracted ion chromatogram (EIC) at m / z = 243 monitors the formation of 1-deoxy-F6P (t R = 18.40 min). C-D. Mass spectra (negative ion mode) of compound 1 (1-deoxy-F6P) and compound 2 (1,5-AG-6P) corresponding to the EIC peaks in B. E. HPLC elution profiles of DNPH derivatives of reaction products and standards in the reaction analysis coupling LpFsaA with LpYbiW. F-H. ESI(-) m / z mass spectra of DNPH-3-phosphoglyceraldehyde (peak 3) and DNPH-hydroxyacetone (peaks 4 and 5) in E. Here, w / o means without.
[0034] Figure 3 Electron paramagnetic resonance (EPR) spectroscopy and LC-MS enzymatic reaction analysis of PflD. A. EPR spectra of EcPflD with EcPflC and titanium(III) citrate in the presence or absence of SAM. B. Formation of 1-deoxyfructose-6-phosphate (1-deoxy-F6P) in the 1,5-anhydromannitol-6-phosphate (1,5-AM-6P) isomerization catalyzed by EcPflD detected by LC-MS. In the negative ion mode, the extracted ion chromatogram (EIC) at m / z = 243 monitors the formation of 1-deoxy-F6P (t R= 18.40 min). C-D. Mass spectra (negative ion mode) of compounds 1 (1-deoxy-F6P) and 6 (1,5-AM-6P) corresponding to the EIC peaks in B. E. Reaction analysis of EcFsaB coupled with EcPflD. HPLC elution profiles of the DNPH derivatives of the reaction products and standards. F-H. Mass spectra of DNPH-glyceraldehyde 3-phosphate (peak 3) and DNPH-hydroxyacetone (peaks 4 and 5) in E. I. Spectrophotometric determination of EcGldA-EcFsaB coupled with EcPflD, monitoring NADH consumption as hydroxyacetone is reduced. Among them, w / o means without.
[0035] Figure 4 Are the X-ray diffraction crystal structures of EcYbiW and SdPflD. A-B. Structures of monomeric EcYbiW and SdPflD in each asymmetric unit. C-D. Structural active sites of the complexes formed by EcYbiW with 1,5-AG-6P and SdPflD with 1,5-AM-6P, respectively. The hydrogen atom transfer pathway is indicated by arrows, hydrogen bonds are represented by black dotted lines, and the distances between key atoms are marked. The 2Fo-Fc electron density of the substrate is 1.0σ. E-F. Catalytic mechanisms of EcYbiW and SdPflD.
[0036] Figure 5In Escherichia coli, the 1,5-anhydroglucitol (1,5-AG)-induced YbiW-dependent glycolytic pathway and the 1,5-anhydromannitol (1,5-AM)-induced PflD-dependent glycolytic pathway. A. Growth of wild-type Escherichia coli MG1655 and ΔybiW strains with 1,5-AG as the sole carbon source. The positive control used glucose as the sole carbon source, and the negative control (w / o glucose) had no added carbon source. B. SDS-PAGE analysis of wild-type Escherichia coli MG1655 with glucose (lane 2), 1,5-AG as the sole carbon source (lane 3), or ΔybiW with glucose (lane 4) as the sole carbon source. Arrows indicate two ~95 kDa bands containing PtsA and YbiW, one ~42 kDa band identified as GldA, and one ~27 kDa band identified as containing FsaB and FsaA. C. Growth of wild-type Escherichia coli MG1655 and ΔpflD strains with 1,5-AM as the sole carbon source. The positive control used glucose as the sole carbon source, and the negative control had no added carbon source. D. SDS-PAGE analysis of wild-type Escherichia coli MG1655 with glucose (lane 2), 1,5-AM as the sole carbon source (lane 3), or ΔpflD with glucose (lane 4) as the sole carbon source. Arrows indicate a ~95 kDa band identified as PtsA, a ~90 kDa band identified as PflD, a ~42 kDa band identified as GldA, and a ~27 kDa band identified as FsaB. E. Escherichia coli neighborhood genome of YbiW (SEQ ID NO:1) and PflD (SEQ ID NO:98) in Escherichia coli MG1655. F. 1,5-AG anhydroglycolytic pathway and 1,5-AM anhydroglycolytic pathway in Escherichia coli. Among them, w / o means without.
[0037] Figure 6 SDS-PAGE analysis of purified proteins for enzymatic assays and biochemical characterization. A. LpYbiW; B. MBP-LpYbiY; C. LpFsaA; D. EcPflD; E. MBP-EcPflC; F. EcFsaB; G. EcGldA. Lanes 1 to 4 in each 4-20% gradient gel (Bis-Tris) contained protein molecular weight markers and 1, 2, and 4 μg of recombinant protein in sequence.
[0038] Figure 7 Characterization of recombinant LpYbiY. A. [Fe–S] cluster quantification in LpYbiY, where the determination was performed in triplicate and represented with standard deviation. B. The UV-Vis absorption spectrum of LpYbiY was separated and reconstructed, corresponding to [4Fe-4S] in the reconstructed LpYbiY 2+The feature at 410 nm of the cluster disappeared upon reduction with the strong reducing agent titanium(III) citrate. C. LC-MS elution curves of the SAM cleavage reaction mixture catalyzed by LpYbiY in the presence and absence of Ti(III), using commercially available 5'-deoxyadenosine (5'-dA) as a standard. D. Positive ionization mass spectrum of the 5'-dA peak eluted in C at 27.22 minutes.
[0039] Figure 8 For the characterization of recombinant EcPflC. A. [Fe–S] cluster quantification in EcPflC, where the determination was performed in triplicate and expressed as standard deviation. B. UV-visible absorption spectra of separated and reconstituted EcPflC, corresponding to [4Fe-4S] in reconstituted EcPflC 2+ The feature at 410 nm of the cluster disappeared upon reduction with the strong reducing agent titanium(III) citrate. C. LC-MS elution curves of the SAM cleavage reaction mixture catalyzed by EcPflC in the presence and absence of Ti(III), using commercially available 5'-deoxyadenosine (5'-dA) as a standard. D. Positive ionization mass spectrum of the 5'-dA peak eluted in C at 27.22 minutes.
[0040] Figure 9 For the LC-MS enzyme activity assay of LpFsaA and EcFsaB in catalyzing the aldol addition reaction of hydroxyacetone with glyceraldehyde 3-phosphate. A-B. Extracted ion chromatograms (m / z = 243, negative ion mode) of the reaction mixtures catalyzed by LpFsaA- and EcFsaB-, monitoring the formation of 1-deoxyfructose-6-phosphate (1-deoxy-F6P). C-D. Negative ionization mass spectra of 1-deoxyfructose-6-phosphate formed by LpFsaA and EcFsaB. Among them, w / o means without.
[0041] Figure 10 For the enzyme kinetic data of LpYbiW. A. Dose-dependent LpFsaA-EcGldA coupled enzyme activity assay of LpYbiW, showing the amount of LpYbiW used in the assay. B. Michaelis-Menten kinetics of LpYbiW. Error bars represent the standard deviation of three separate experiments.
[0042] Figure 11 For the enzyme kinetic data of EcPflD. A. Dose-dependent EcFsaB-EcGldA coupled enzyme activity assay of EcPflD, showing the amount of EcPflD used in the assay. B. Michaelis-Menten kinetics of EcPflD. Error bars represent the standard deviation of three separate experiments.
[0043] Figure 12SDS-PAGE and SEC analysis of purified EcYbiW (E114A, E115A, and K117A) and SdPflD for protein crystallization. A. 4-20% gradient gel (Bis-Tris): Lane 1 is the protein molecular weight marker; lanes 2-4 are 1, 2, and 4 μg of purified EcYbiW (E114A, E115A, and K117A), respectively. B. 4-20% gradient gel (Bis-Tris): Lane 1 is the protein molecular weight marker; lanes 2-4 are 1, 2, and 4 μg of purified SdPflD, respectively. C. SEC standard curve established using standards bovine thyroglobulin (669 kDa), horse apoferritin (443 kDa), sweet potato β-amylase (200 kDa), yeast alcohol dehydrogenase (150 kDa), BSA (66 kDa), and bovine carbonic anhydrase (29 kDa) (Sigma MWGF 1000-1KT). D-E. Elution curves of EcYbiW (E114A, E115A, and K117A) and SdPflD for determining the molecular weights of EcYbiW and SdPflD using Superdex 200 gel filtration chromatography, with estimated molecular weights of 154.9 kDa and 77.9 kDa, respectively.
[0044] Figure 13 Gas chromatography (GC) analysis of the fermentation broth of wild-type Escherichia coli MG1655 grown on glucose, 1,5-AG, and 1,5-AM. Among them, w / o glucose indicates without glucose and is the negative control; glucose is the positive control.
[0045] Figure 14 YbiW cluster and PflD cluster constructed using the sequence similarity network (SSN) tool, with each node representing a sequence with 80% or more similarity. The nodes where EcYbiW and EcPflD are located are marked with arrows in the two clusters, respectively.
[0046] Figure 15 Exemplary gene cluster distribution map including the natural isozyme of 1,5-anhydroglucitol-6-phosphate isomerase shown in SEQ ID NO:1, glycine radical enzyme-activating enzyme of the S-adenosylmethionine radical enzyme family, and 1-deoxyfructose-6-phosphate aldolase (the direction of the gene represents the direction of the coding strand, from 5' to 3').
[0047] Figure 16 Exemplary gene cluster distribution map including the natural isozyme of 1,5-anhydromannitol-6-phosphate isomerase shown in SEQ ID NO:97, glycine radical enzyme-activating enzyme of the S-adenosylmethionine radical enzyme family, 1-deoxyfructose-6-phosphate aldolase, and hydroxyacetone reductase.
[0048] Figure 17 SDS-PAGE analysis of purified proteins for biochemical characterization. A. EcYbiW; B. MBP-EcYbiY; C. SdPflD; D. MBP-SdPflC. Lanes 1 to 4 in each 4-20% gradient gel (Bis-Tris) contained protein molecular weight markers and 1, 2, and 4 μg of recombinant proteins in sequence.
[0049] Figure 18 LC-MS enzymatic reaction analysis of Escherichia coli species YbiW. A. Detection of the formation of 1-deoxyfructose-6-phosphate (1-deoxy-F6P) in the 1,5-anhydroglucitol-6-phosphate (1,5-AG-6P) isomerization catalyzed by EcYbiW by LC-MS. In the negative ion mode, the extracted ion chromatogram (EIC) at m / z = 243 monitored the formation of 1-deoxy-F6P (t R = 18.40 min). B-C. Mass spectra (negative ion mode) of compound 1 (1-deoxy-F6P) and compound 2 (1,5-AG-6P) corresponding to the EIC peaks in A, respectively. Among them, w / o means without.
[0050] Figure 19 Gene cluster and LC-MS enzymatic reaction analysis of Streptococcus dysgalactiae subsp. Equisimilis species PflD. A. Gene cluster in Streptococcus dysgalactiae subsp. Equisimilis (including the gene expressing 1,5-anhydromannitol-6-phosphate isomerase shown in SEQ ID NO: 97). B. Detection of the formation of 1-deoxyfructose-6-phosphate (1-deoxy-F6P) in the 1,5-anhydromannitol-6-phosphate (1,5-AM-6P) isomerization catalyzed by SdPflD by LC-MS. In the negative ion mode, the extracted ion chromatogram (EIC) at m / z = 243 monitored the formation of 1-deoxy-F6P (t R = 18.40 min). C-D. Mass spectra (negative ion mode) of compound 1 (1-deoxy-F6P) and compound 6 (1,5-AM-6P) corresponding to the EIC peaks in B, respectively. Among them, w / o means without.
[0051] Figure 20SDS-PAGE analysis of purified proteins for biochemical characterization and co-culture with Escherichia coli MG1655 cells. A. α-1,4-glucan lyase; B. 1,5-anhydro-D-fructose reductase (Gafr, Uniprot accession number: P82125, EC: 1.1.1.263); C. maltose-binding protein (MBP)-1,5-anhydro-D-fructose reductase (Mafr, Uniprot accession number: Q2I8V6, EC: 1.1.1.292); D. FDH. Lanes 1 to 4 in each 4-20% gradient gel (Bis-Tris) contained protein molecular weight markers and 1, 2, and 4 μg of recombinant protein in sequence.
[0052] Figure 21 Determination of the enzyme activities of α-1,4-glucan lyase, Gafr, Mafr, and FDH by LC-MS. A, B. Detection of 1,5-anhydrofructose (1,5-AF) formed from maltose (A) and soluble starch (B) using α-1,4-glucan lyase by LC-MS, respectively. In the positive ion mode, the extracted ion chromatogram (EIC, m / z = 180) monitored the formation of 1,5-AF (retention time of 12.83 minutes, peak 1); peak 2 (retention time of 15.52 minutes) was assigned as glucose. C, D. Detection of 1,5-anhydroglucitol (1,5-AG) formed from maltose (C) and soluble starch (D) using α-1,4-glucan lyase, Gafr, and FDH by LC-MS, respectively. In the positive ion mode, the extracted ion chromatogram (EIC, m / z = 182) monitored the formation of 1,5-AG (retention time of 11.38 minutes, peak 3). E, F. Detection of 1,5-anhydromannitol (1,5-AM) formed from maltose (E) and soluble starch (F) using α-1,4-glucan lyase, Mafr, and FDH by LC-MS, respectively. The extracted ion chromatogram (m / z = 182) in the positive mode indicated the formation of 1,5-AM (retention time of 11.82 minutes, peak 4).
[0053] Figure 22 For Figure 2 Mass spectra of the intermediates and products shown. A-D. ESI(+) m / z spectra of 1,5-anhydrofructose (1,5-AF, peak 1), glucose (peak 2), 1,5-anhydroglucitol (1,5-AG, peak 3), and 1,5-anhydromannitol (1,5-AM, peak 4).
[0054] Figure 23For the determination of the activity of enzymes in "starch M9 medium" by LC-MS. A. Detection of 1,5-anhydroglucitol (1,5-AG) formed using α-1,4-glucan lyase, Gafr, and FDH by LC-MS. Monitoring the extracted ion chromatogram (EIC) at m / z = 182 in the positive mode indicated the formation of 1,5-AG (retention time of 11.38 minutes). B. Detection of 1,5-anhydromannitol (1,5-AM) formed from soluble starch in M9 medium using α-1,4-glucan lyase, Mafr, and FDH by LC-MS. In the positive ion mode, the extracted ion chromatogram (EIC) at m / z = 182 indicated the formation of 1,5-AM (retention time of 11.82 minutes). C. The positive ion mass spectrum of the EIC peak ([M+NH 4 + ) in Figure A is that of 1,5-AG. D. The positive ion mass spectrum of the EIC peak ([M+NH 4 + ) in Figure A is that of 1,5-AM.
[0055] Figure 24 For the anaerobic cultivation of wild-type Escherichia coli MG1655 using starch. A. Growth of wild-type Escherichia coli MG1655 co-cultured with α-1,4-glucan lyase, Gafr, MBP-Mafr, and FDH using soluble starch as the sole carbon source. Included were a positive control with glucose as the sole carbon source and a negative control of M9 medium without a carbon source, as well as "starch M9 medium" without Escherichia coli MG1655 cells. The growth of the strains and different carbon sources is also indicated in the figure. B. SDS-PAGE analysis of Escherichia coli MG1655 grown in glucose (lane 2), "starch M9 medium" containing α-1,4-glucan lyase, Gafr, and FDH (lane 3), and "starch M9 medium" containing α-1,4-glucan lyase, MBP-Mafr, and FDH (lane 4). C. Gas chromatography analysis of 1,2-propanediol (t R = 9.01 minutes) in the fermentation extract of co-culturing wild-type Escherichia coli MG1655 with different enzyme combinations in starch M9 medium, including a true standard of (R)-1,2-propanediol.
[0056] Figure 25 For in vitro enzymatic reactions and the GRE-dependent shrunken glycolysis pathway. A. Neighboring gene clusters of YbiW and PflD in Escherichia coli MG1655. B. In vitro enzymatic reactions of putative α-1,4-glucan lyase, Gafr, FDH involved in starch hydrolysis and the YbiW-dependent glycolysis process in Escherichia coli MG1655 cells. C. In vitro enzymatic reactions of putative α-1,4-glucan lyase, Gafr, FDH involved in starch hydrolysis and the PflD-dependent glycolysis process in Escherichia coli MG1655 cells.
[0057] Figure 26 For SDS-PAGE analysis and enzyme activity assay of the sugar kinase TlGlkA. A. 4-20% gradient gel (Bis-Tris): Lane 1 is the protein molecular weight marker; Lanes 2-4 are 1, 2, and 4 μg of purified TlGlkA, respectively. B. Detection of the formation of 1,5-anhydroglucitol-6-phosphate (1,5-AG-6P) in the phosphorylation of 1,5-anhydroglucitol catalyzed by TlGlkA by LC-MS. In the negative ion mode, the extracted ion chromatogram (EIC) at m / z = 243 monitors the formation of 1,5-AG-6P (t R = 19.60 min). C. Mass spectrum of compound 1,5-AG-6P corresponding to the EIC peak in B (negative ion mode).
[0058] Sequence description
[0059] SEQ ID NO:1 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number P75793 expressed in Escherichia coli.
[0060] SEQ ID NO:2 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A807DR53 expressed in Lactiplantibacillus plantarum.
[0061] SEQ ID NO:3 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0R2FVZ1 expressed in Lactobacillus selangorensis.
[0062] SEQ ID NO:4 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0A6S4M4 expressed in Streptococcus uberis.
[0063] SEQ ID NO:5 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0K1F3T2 expressed by Olsenella sp. oral taxon 807.
[0064] SEQ ID NO:6 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A134AK54 expressed by Leptotrichia wadei.
[0065] SEQ ID NO:7 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A134A1S1 expressed by Senella sp. DNF00959.
[0066] SEQ ID NO:8 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0E2UQR7 expressed by Streptococcus parauberis.
[0067] SEQ ID NO:9 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A173RRH3 expressed by Anaerostipes hadrus.
[0068] SEQ ID NO:10 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A1E8VV95 expressed by Senella sp. HMSC062G07.
[0069] SEQ ID NO:11 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A1I3HGA4 expressed by Selenomonas ruminantium.
[0070] SEQ ID NO:12 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A285HLM7 expressed by Orenia metallireducens.
[0071] SEQ ID NO: 13 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with the Uniprot accession number A0A2M9H9C8 expressed by Bifidobacterium primatium.
[0072] SEQ ID NO: 14 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with the Uniprot accession number C9N0T4 expressed by Leptotrichia hofstadii F0254.
[0073] SEQ ID NO: 15 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with the Uniprot accession number A0A0R2AF79 expressed by Ligilactobacillus agilis DSM 20509.
[0074] SEQ ID NO: 16 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with the Uniprot accession number U2TM27 expressed by Senella profusa F0195.
[0075] SEQ ID NO: 17 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with the Uniprot accession number A0A0A6PW80 expressed by Clostridium butyricum.
[0076] SEQ ID NO: 18 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with the Uniprot accession number A0A1C0A9L3 expressed by Orenia metallireducens.
[0077] SEQ ID NO: 19 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with the Uniprot accession number A0A0B8PMP8 expressed by Vibrio ishigakensis.
[0078] SEQ ID NO: 20 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with the Uniprot accession number A0A425WQY7 expressed by bacteria of the family Coriobacteriaceae.
[0079] SEQ ID NO:21 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number F2N714, expressed by the strain Coriobacterium glomerans ATCC49209 / DSM 20642 / JCM 10262 / PW2.
[0080] SEQ ID NO:22 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number M2NEK5, expressed by Eggerthia catenaformis OT 569.
[0081] SEQ ID NO:23 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0A7FYZ2, expressed by Clostridium baratiistr. Sullivan.
[0082] SEQ ID NO:24 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A143X8V0, expressed by the bacterium Clostridiales CHKCI006.
[0083] SEQ ID NO:25 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A2N2BBI5, expressed by the bacterium Firmicutes HGW-Firmicutes-5.
[0084] SEQ ID NO:26 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A2T0BJ14, expressed by Clostridium vincentii.
[0085] SEQ ID NO:27 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A380JDF6, expressed by Streptococcus downei MFe28.
[0086] SEQ ID NO:28 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A847CI73, expressed by a bacterium of the family Erysipelotrichaceae.
[0087] SEQ ID NO:29 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A8J6Z417 expressed by Quinella sp. 3Q1.
[0088] SEQ ID NO: 30 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number D1AFQ7 expressed by Sebaldella termitidis (strain ATCC33386 / NCTC 11300).
[0089] SEQ ID NO:31 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A062WZ81 expressed by Ligilactobacillus animalis.
[0090] SEQ ID NO:32 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0R1V613 expressed by Liquorilactobacillus satsumensis DSM 16230.
[0091] SEQ ID NO:33 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0M0A869 expressed by Clostridium botulinum.
[0092] SEQ ID NO: 34 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0V8QAB4 expressed by Acetivibrio ethanolgignens.
[0093] SEQ ID NO:35 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A2N3J357 expressed by Aeromonas sobria.
[0094] SEQ ID NO: 36 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A1I2MD83 expressed by Clostridium cadaveris.
[0095] SEQ ID NO:37 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A1L8MKJ9 expressed by Streptococcus bovimastitidis.
[0096] SEQ ID NO:38 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A4R1NC63 expressed by Sodalis ligni.
[0097] SEQ ID NO:39 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A5R9CBU2 expressed by Lactococcus raffinolactis.
[0098] SEQ ID NO:40 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number C2ELS4 expressed by Lactobacillus ultunensis DSM 16047.
[0099] SEQ ID NO:41 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A3P1W4E8 expressed by Leptotrichia sp. OH3620.
[0100] SEQ ID NO:42 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A498R759 expressed by Lucifera butyrica.
[0101] SEQ ID NO:43 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A4V6Q2Z2 expressed by Fonticella tunisiensis.
[0102] SEQ ID NO:44 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A7MME9 expressed by Cronobacter sakazakii strain ATCC BAA-894.
[0103] SEQ ID NO:45 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0R1Q920 expressed by Liquorilactobacillus uvarum DSM 19971.
[0104] SEQ ID NO:46 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A1Y4F189 expressed by Anaeromassilibacillus sp. An250.
[0105] SEQ ID NO:47 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A498D0T9 expressed by Anaerotruncus sp. 22A2-44.
[0106] SEQ ID NO:48 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A510JEA5 expressed by Leptotrichia hofstadii.
[0107] SEQ ID NO:49 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0A2VZ96 expressed by Beauveria bassiana D1-5.
[0108] SEQ ID NO:50 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A447V187 expressed by Cedecea lapagei.
[0109] SEQ ID NO:51 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number B2ISH7 expressed by Streptococcus pneumoniae strain CGSP14.
[0110] SEQ ID NO:52 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A075SG00 expressed by Streptococcus suis 6407.
[0111] SEQ ID NO:53 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0R2GM47 expressed by Lactiplantibacillus plantarum.
[0112] SEQ ID NO:54 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A1Q8F4Y7 expressed by Aeromonas veronii.
[0113] SEQ ID NO:55 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A290PWH6 expressed by Lactococcus raffinolactis.
[0114] SEQ ID NO:56 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A447Y009 expressed by Escherichia coli.
[0115] SEQ ID NO:57 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0B7GIL0 expressed by Streptococcus sanguinis.
[0116] SEQ ID NO:58 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A1L7RNK7 expressed by Actinomyces succiniciruminis.
[0117] SEQ ID NO:59 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A376TJI4 expressed by Escherichia coli.
[0118] SEQ ID NO:60 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A3R9YDI0 expressed by Vagococcus humatus.
[0119] SEQ ID NO:61 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A064C019 expressed by Streptococcus pneumoniae.
[0120] SEQ ID NO:62 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0P7FGJ3 expressed by Vibrio alginolyticus.
[0121] SEQ ID NO:63 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0R2KGV0 expressed by Ligilactobacillus acidipiscis.
[0122] SEQ ID NO:64 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A1T4P4Y5 expressed by Pilibacter termitis.
[0123] SEQ ID NO:65 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A1E3KU28 expressed by Lactiplantibacillus plantarum.
[0124] SEQ ID NO:66 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A349BXL4 expressed by bacteria of the family Lachnospiraceae.
[0125] SEQ ID NO:67 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A3T0ZV83 expressed by Aeromonas hydrophila.
[0126] SEQ ID NO:68 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A1L8WPN6 expressed by Enterococcus ratti.
[0127] SEQ ID NO:69 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0R2H5D7 expressed by Kandleria vitulina.
[0128] SEQ ID NO:70 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0H3J4P2 expressed by Clostridium pasteurianum DSM525.
[0129] SEQ ID NO:71 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0T6U3W3 expressed by Aeromonas allosaccharophila.
[0130] SEQ ID NO:72 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number K8CC45 expressed by Enterobacter sakazakii.
[0131] SEQ ID NO:73 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A1W6B1J9 expressed by Pantoea alhagi.
[0132] SEQ ID NO:74 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number B6FW14 expressed by Peptacetobacter hiranonis strain DSM 13275 / JCM 10541 / KCTC 15199 / TO-931.
[0133] SEQ ID NO:75 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A034T1M9 expressed by Edwardsiella piscicida.
[0134] SEQ ID NO:76 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A089PXZ6 expressed by Cedecea neteri.
[0135] SEQ ID NO:77 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0A3AQL5 expressed by Chelonobacter oris.
[0136] SEQ ID NO:78 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0D0QVG1 expressed by Aeromonas sp. L_1B5_3.
[0137] SEQ ID NO:79 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0F4VRP2 expressed by Clostridium sp. IBUN125C.
[0138] SEQ ID NO:80 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A1M5EXF5 expressed by Vibrio gazogenes DSM 21264.
[0139] SEQ ID NO:81 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A2Z5Y0I5 expressed by Melissococcus plutonius.
[0140] SEQ ID NO:82 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A5C7QZ11 expressed by Tolumonas sp.
[0141] SEQ ID NO:83 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A3D0GQ55 expressed by Erysipelotrichaceae bacteria.
[0142] SEQ ID NO:84 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0R1F6B2 expressed by Loigolactobacillus coryniformis subsp. coryniformis KCTC 3167.
[0143] SEQ ID NO:85 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A4P9VTG8 expressed by Zooshikella ganghwensis.
[0144] SEQ ID NO:86 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A829T2C0 expressed by Vibrio sp.
[0145] SEQ ID NO:87 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A2T3N2G3 expressed by Photobacterium lipolyticum.
[0146] SEQ ID NO:88 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A8S7XWX0 expressed by Escherichia coli.
[0147] SEQ ID NO:89 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number X0PS46 expressed by Agrilactobacillus composti DSM 18527.
[0148] SEQ ID NO:90 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A061Q2Y5 expressed by Vibrio sp. JCM 19052.
[0149] SEQ ID NO:91 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A174H662 expressed by Clostridium symbiosum.
[0150] SEQ ID NO:92 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number F3Y874 expressed by Melissococcus plutonius strain ATCC35311 / CIP 104052 / LMG 20360 / NCIMB 702443.
[0151] SEQ ID NO:93 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A1S1BRH2 expressed by Aerococcus sp. HMSC035B07.
[0152] SEQ ID NO:94 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A1Y4BCL8 expressed by Senella sp. An293.
[0153] SEQ ID NO:95 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A7Z0VH52.
[0154] SEQ ID NO:96 shows the amino acid sequence of 1,5-anhydroglucitol-6-phosphate isomerase with Uniprot accession number A0A0I9WIZ4.
[0155] SEQ ID NO:97 shows the amino acid sequence of 1,5-anhydromannitol-6-phosphate isomerase with NCBI accession number OCX05109.1 expressed by Streptococcus dysgalactiae subsp. Equisimilis.
[0156] SEQ ID NO:98 shows the amino acid sequence of 1,5-anhydromannitol-6-phosphate isomerase with Uniprot accession number P32674 expressed by Escherichia coli strain K12.
[0157] SEQ ID NO:99 shows the amino acid sequence of 1,5-anhydromannitol-6-phosphate isomerase with Uniprot accession number A0A7C9H654 expressed by Firmicutes bacteria.
[0158] SEQ ID NO:100 shows the amino acid sequence of 1,5-anhydromannitol-6-phosphate isomerase with Uniprot accession number A0A510J954 expressed by Pseudoleptotrichia goodfellowii.
[0159] SEQ ID NO:101 shows the amino acid sequence of 1,5-anhydromannitol-6-phosphate isomerase with Uniprot accession number D4F6M7 expressed by Edwardsiella tarda.
[0160] SEQ ID NO:102 shows the amino acid sequence of 1,5-anhydromannitol-6-phosphate isomerase with Uniprot accession number D4E0C4 expressed by Serratia odorifera DSM 4582.
[0161] SEQ ID NO:103 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A2V4E297 expressed by Gilliamella apicola.
[0162] SEQ ID NO:104 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A084T2T3 expressed by Vibrio sp. ER1A.
[0163] SEQ ID NO:105 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A0R2FPV6 expressed by Lactobacillus selangorensis.
[0164] SEQ ID NO:106 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A0N8NM72 expressed by Caloranaerobacter sp.
[0165] SEQ ID NO:107 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A1T4K0K6 expressed by Pilibacter termitis.
[0166] SEQ ID NO:108 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A096BHK0 expressed by Caloranaerobacter azorensis H53214.
[0167] SEQ ID NO:109 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A725B0Z8 expressed by Salmonella enteritidis.
[0168] SEQ ID NO:110 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A0B8Q7B9 expressed by Vibrio sp. JCM 19236.
[0169] SEQ ID NO:111 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A037YM28 expressed by Escherichia coli.
[0170] SEQ ID NO:112 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number C4LFY8 expressed by Tolumonas auensis strain DSM 9187 / TA4.
[0171] SEQ ID NO:113 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A6N7XPT4 expressed by Senella porci.
[0172] SEQ ID NO:114 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A4S2F5T8 expressed by bacteria of the family Mycobacteriaceae.
[0173] SEQ ID NO:115 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A4R7KVA0 expressed by Fonticella tunisiensis.
[0174] SEQ ID NO:116 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A437UWZ5 expressed by bacteria OH1046 of the order Coriobacteriales.
[0175] SEQ ID NO:117 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A3R9P0U8 expressed by Bacillus sp. HMF5848.
[0176] SEQ ID NO:118 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A380TM32 expressed by Actinobacillus rossii.
[0177] SEQ ID NO:119 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number C2ELS8 expressed by Lactobacillus ultunensis DSM 16047.
[0178] SEQ ID NO:120 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A2N2B0Z5 expressed by Firmicutes bacteria HGW-Firmicutes-7.
[0179] SEQ ID NO:121 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A1J0GF99 expressed by Clostridium estertheticum subsp. estertheticum.
[0180] SEQ ID NO:122 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A1D8GPW2 expressed by Geosporobacter ferrireducens.
[0181] SEQ ID NO:123 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A0B8PE23 expressed by Vibrio ishigakensis.
[0182] SEQ ID NO:124 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A239SQG5 expressed by Streptococcus merionis.
[0183] SEQ ID NO:125 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A823B0Q1 expressed by Shigella boydii.
[0184] SEQ ID NO:126 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number X0PU04 expressed by Agrilactobacillus composti DSM 18527.
[0185] SEQ ID NO:127 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A0R2FH98 expressed by Lactobacillus selangorensis.
[0186] SEQ ID NO:128 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A430AQ99 expressed by Vagococcus elongatus.
[0187] SEQ ID NO:129 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A1W1WZ75 expressed by Clostridium acidisoli DSM 12555.
[0188] SEQ ID NO:130 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A376L3P4 expressed by Escherichia coli.
[0189] SEQ ID NO:131 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A1T4WMT8 expressed by Caloramator quimbayensis.
[0190] SEQ ID NO:132 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A1I1H9K1 expressed by Clostridium uliginosum.
[0191] SEQ ID NO:133 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A143I1W1 expressed by Enterobacter asburiae.
[0192] SEQ ID NO:134 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number N2BYX9 expressed by Atopobium minutum.
[0193] SEQ ID NO:135 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A4S2EVE2 expressed by bacteria of the family Pyrrhocoraceae.
[0194] SEQ ID NO:136 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A7S7M803 expressed by Thermophilibacter immobilis.
[0195] SEQ ID NO:137 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A2T3N2G1 expressed by Photobacterium lipolyticum.
[0196] SEQ ID NO:138 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A381GG45 expressed by Citrobacter amalonaticus.
[0197] SEQ ID NO:139 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A0A0F8F5 expressed by Escherichia coli G3.
[0198] SEQ ID NO:140 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A0J0GCD9 expressed by Enterobacter asburiae.
[0199] SEQ ID NO:141 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A0H3J2B1 expressed by Clostridium pasteurianum.
[0200] SEQ ID NO:142 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number D1AJA5 expressed by Serpula lacrymans strain ATCC 33386 / NCTC 11300.
[0201] SEQ ID NO:143 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A8S0W6S0 expressed by Acididesulfobacillus acetoxydans.
[0202] SEQ ID NO:144 shows the amino acid sequence of 1,5-anhydro-D-mannitol-6-phosphate isomerase with Uniprot accession number A0A7W2G1V0 expressed by the genus Clostridium.
[0203] SEQ ID NO:145 shows the amino acid sequence of LpYbiY with Uniprot accession number A0A162FGG2 expressed by Lactiplantibacillus plantarum.
[0204] SEQ ID NO:146 shows the amino acid sequence of LpFsaA with Uniprot accession number A0A0M4CJJ6 expressed by Lactiplantibacillus plantarum.
[0205] SEQ ID NO:147 shows the amino acid sequence of EcPflC with Uniprot accession number P32675 expressed by Escherichia coli strain K12.
[0206] SEQ ID NO:148 shows the amino acid sequence of EcFsaB with Uniprot accession number P32669 expressed by Escherichia coli strain K12.
[0207] SEQ ID NO:149 shows the amino acid sequence of EcGldA with Uniprot accession number P0A9S5 expressed by Escherichia coli strain K12.
[0208] SEQ ID NO:150 shows the amino acid sequence of the PTS subunit PtsA with Uniprot accession number P32670 expressed by Escherichia coli strain K12.
[0209] SEQ ID NO:151 shows the amino acid sequence of the PTS subunit FrwB with Uniprot accession number P69816 expressed by Escherichia coli strain K12. The amino acid sequences of FrwC and FrwD.
[0210] SEQ ID NO:152 shows the amino acid sequence of the PTS subunit FrwC with Uniprot accession number P32672 expressed by Escherichia coli strain K12.
[0211] SEQ ID NO:153 shows the amino acid sequence of the PTS subunit FrwD with Uniprot accession number P32676 expressed by Escherichia coli strain K12.
[0212] SEQ ID NO:154 shows the nucleotide sequence of primer 1F.
[0213] SEQ ID NO:155 shows the nucleotide sequence of primer 1R.
[0214] SEQ ID NO:156 shows the nucleotide sequence of primer 2F.
[0215] SEQ ID NO:157 shows the nucleotide sequence of primer 2R.
[0216] SEQ ID NO:158 shows the nucleotide sequence of primer 3F.
[0217] SEQ ID NO:159 shows the nucleotide sequence of primer 3R.
[0218] SEQ ID NO:160 shows the nucleotide sequence of primer 4F.
[0219] SEQ ID NO:161 shows the nucleotide sequence of primer 4R.
[0220] SEQ ID NO:162 shows the nucleotide sequence of primer 5F.
[0221] SEQ ID NO:163 shows the nucleotide sequence of primer 5R.
[0222] SEQ ID NO:164 shows the nucleotide sequence of primer 6F.
[0223] SEQ ID NO:165 shows the nucleotide sequence of primer 6R.
[0224] SEQ ID NO:166 shows the nucleotide sequence of primer 7F.
[0225] SEQ ID NO:167 shows the nucleotide sequence of primer 7R.
[0226] SEQ ID NO:168 shows the nucleotide sequence of primer 8F.
[0227] SEQ ID NO:169 shows the nucleotide sequence of primer 8R.
[0228] SEQ ID NO:170 shows the nucleotide sequence of primer 9F.
[0229] SEQ ID NO:171 shows the nucleotide sequence of primer 9R.
[0230] SEQ ID NO:172 shows the nucleotide sequence of primer 10F.
[0231] SEQ ID NO:173 shows the nucleotide sequence of primer 10R.
[0232] SEQ ID NO:174 shows the nucleotide sequence of primer 11F.
[0233] SEQ ID NO:175 shows the nucleotide sequence of primer 11R.
[0234] SEQ ID NO:176 shows the nucleotide sequence of primer 12F.
[0235] SEQ ID NO:177 shows the nucleotide sequence of primer 12R.
[0236] SEQ ID NO:178 shows the nucleotide sequence of primer 13F.
[0237] SEQ ID NO:179 shows the nucleotide sequence of primer 13R.
[0238] SEQ ID NO:180 shows the nucleotide sequence of primer 14F.
[0239] SEQ ID NO:181 shows the nucleotide sequence of primer 14R.
[0240] SEQ ID NO:182 shows the nucleotide sequence of primer 15F.
[0241] SEQ ID NO:183 shows the nucleotide sequence of primer 16F.
[0242] SEQ ID NO:184 shows the nucleotide sequence of primer 16R.
[0243] SEQ ID NO:185 shows the nucleotide sequence of primer 17F.
[0244] SEQ ID NO:186 shows the nucleotide sequence of primer 17R.
[0245] SEQ ID NO:187 shows the nucleotide sequence of the guide RNA contained in the pRed_Cas9_recA_ΔybiW plasmid.
[0246] SEQ ID NO:188 shows the nucleotide sequence of the nucleotide sequence of the guide RNA contained in the pRed_Cas9_recA_ΔpflD plasmid.
[0247] SEQ ID NO:189 shows the nucleotide sequence of primer 18F.
[0248] SEQ ID NO:190 shows the nucleotide sequence of primer 18R.
[0249] SEQ ID NO:191 shows the nucleotide sequence of primer 19F.
[0250] SEQ ID NO:192 shows the nucleotide sequence of primer 19R.
[0251] SEQ ID NO:193 shows the nucleotide sequence of primer 20F for constructing α-1,4-glucan lyase.
[0252] SEQ ID NO:194 shows the nucleotide sequence of primer 20R for constructing α-1,4-glucan lyase.
[0253] SEQ ID NO:195 shows the nucleotide sequence of primer 21F for constructing α-1,4-glucan lyase.
[0254] SEQ ID NO:196 shows the nucleotide sequence of primer 21R for constructing α-1,4-glucan lyase.
[0255] SEQ ID NO:197 shows the nucleotide sequence of primer 22F for constructing HMT-Mafr.
[0256] SEQ ID NO:198 shows the nucleotide sequence of primer 22R for constructing HMT-Mafr. Specific embodiments
[0257] The inventors of the present application, through bioinformatics analysis, for the first time discovered two new radical-dependent glycolytic pathways, both of which can produce 1,2-propanediol. Through heterologous expression and purification of the relevant enzymes in these two new pathways, LC-MS detection verified the enzyme activity and the characterization of enzyme kinetic parameters, and combined with protein crystallography analysis, explored the catalytic mechanism of key enzymes (such as 1,5-anhydroglucitol-6-phosphate isomerase or 1,5-anhydromannitol-6-phosphate isomerase).
[0258] The inventors first found that when 1,5-anhydroglucitol and 1,5-anhydromannitol were used as the sole carbon sources respectively, in Escherichia coli cells, the relevant pathway proteins were highly expressed; while the knockout of key genes (such as the genes encoding 1,5-anhydroglucitol-6-phosphate isomerase or 1,5-anhydromannitol-6-phosphate isomerase) made Escherichia coli unable to grow when 1,5-anhydroglucitol or 1,5-anhydromannitol was used as the sole carbon source, indicating that Escherichia coli can utilize 1,5-anhydroglucitol and 1,5-anhydromannitol for energy production and growth.
[0259] The inventors found that when starch and maltose were used as substrates respectively, α-1,4-glucan lyase could catalyze the substrates to produce 1,5-anhydrofructose (1,5-AF); adding Gafr and NADPH to this reaction system produced 1,5-anhydroglucitol (1,5-AG); then adding FDH and sodium formate, the yield of 1,5-AG was significantly increased. This indicates that through the catalysis of these enzymes, the production of 1,5-AG from starch can be achieved. The inventors also found that when starch and maltose were used as substrates respectively, adding Mafr and NADPH to the reaction system of α-1,4-glucan lyase produced 1,5-anhydromannitol (1,5-AM); then adding FDH and sodium formate, the yield of 1,5-AM was significantly increased. This indicates that through the catalysis of these enzymes, the production of 1,5-AM from starch can be achieved.
[0260] Then, the inventors detected the activities of these enzymes, such as α-1,4-glucan lyase, 1,5-anhydro-D-fructose reductase, formate dehydrogenase (FDH), etc. in a medium with soluble starch as the sole carbon source ("starch medium"), and found that these enzymes could still produce corresponding products in the medium. Through the co-culture experiment of enzymes and cells, it was found that when α-1,4-glucan lyase, Gafr, FDH, NADPH and sodium formate were added to the "starch medium", obvious growth of Escherichia coli MG1655 was visible; when α-1,4-glucan lyase, MBP-Mafr, FDH, NADPH and sodium formate were added to the "starch medium", obvious growth of Escherichia coli MG1655 was visible. The SDS-PAGE results showed that the pathway proteins were induced to be highly expressed, and the GC analysis showed that 1,2-propanediol was produced in the fermentation broth, indicating that 1,2-propanediol can be produced from starch through in vitro enzyme reactions and co-culture of strains.
[0261] The two pathways discovered by the inventors of the present application, namely, starch - 1,5-AG - 1,2-propanediol and starch - 1,5-AM - 1,2-propanediol, are new glycolytic pathways since the discovery of the EMP, ED and pentose phosphate pathways in the 1920s - 1950s of the last century, and both of these new pathways can produce 1,2-propanediol.
[0262] Unless otherwise specified, the terms used in the present application have the meanings commonly understood by those skilled in the art.
[0263] As used herein, the term "NAD(P) + " means NAD + or NADP + and the term "NAD(P)H" means NADH or NADPH.
[0264] As used herein, the term "enzyme active center" refers to the part of the enzyme molecule that can directly bind to the substrate molecule and catalyze the chemical reaction of the substrate, and this part becomes the enzyme active center.
[0265] As used herein, the term "amino acid" refers to a compound in which a hydrogen atom on the carboxylic acid carbon atom is replaced by an amino group, and the amino acid molecule contains two functional groups, an amino group and a carboxyl group. It includes naturally occurring and non-naturally occurring amino acids, as well as amino acid analogs and mimetics. Naturally occurring amino acids include the 20 (L)-amino acids used in protein biosynthesis, as well as other amino acids such as 4-hydroxyproline, hydroxylysine, carboxylated lysine, desmosine, isodesmosine, homocysteine, citrulline, and ornithine. Non-naturally occurring amino acids include, for example, (D)-amino acids, norleucine, norvaline, p-fluorophenylalanine, ethylthreonine, etc., which are known to those skilled in the art. Amino acid analogs include modified forms of naturally occurring and non-naturally occurring amino acids. Such modifications can include, for example, substituting chemical groups and moieties on the amino acid, or derivatizing the amino acid. Amino acid mimetics include, for example, organic structures that exhibit functionally similar properties, such as the charge and charge-space characteristics of an amino acid. For example, an organic structure mimicking arginine (Arg or R) has a positive charge moiety located in a similar molecular space and having the same degree of mobility as the e-amino group of the side chain of the naturally occurring Arg amino acid. Mimetics also include constrained structures to maintain optimal spatial and charge interactions of the amino acid or amino acid functional group. Those skilled in the art can determine what structures constitute functionally equivalent amino acid analogs and amino acid mimetics.
[0266] As used herein, the term "isoenzyme" refers to enzymes in an organism that catalyze the same reaction but have different molecular structures.
[0267] As used herein, "full-length sequence" with respect to a particular polynucleotide or the protein encoded thereby refers to the entire nucleic acid sequence or the entire amino acid sequence having the native (non-synthetic) endogenous sequence. The full-length polynucleotide encodes the full-length, catalytically active form of the particular protein.
[0268] As used herein, the term "glucokinase" refers to an enzyme that catalyzes the transfer of a phosphate group from a high-energy donor molecule to a specific substrate (sugar). The glucokinases mentioned herein include 1,5-anhydroglucitol kinase and / or 1,5-anhydromannitol kinase.
[0269] In a specific embodiment, the glucokinase used is from Thermococcus litoralis, with Uniprot number: Q7M537, belonging to EC:2.7.1.147, which catalyzes the formation of 1,5-anhydroglucitol-6-phosphate from 1,5-anhydroglucitol.
[0270] As used herein, the term "bacterial phosphoenolpyruvate - phosphotransferase system (PTS)" refers to an enzyme complex widely present in bacteria, fungi, and some archaea, which consists of cytoplasmic enzyme I (EI) or histidine phosphocarrier protein (HPr or NPr) and sugar - specific enzyme II complexes and other phosphotransferases, having both catalytic transport functions and very broad regulatory functions. The bacterial phosphoenolpyruvate - phosphotransferase system mainly phosphorylates various sugars and their derivatives through a phosphocascade reaction and then transports them into the cell. All PTSs rely on cytoplasmic enzyme I (EI) and histidine phosphocarrier protein (HPr), and the latter phosphorylates the sugar through a sugar - specific EII complex, which consists of two cytoplasmic domains (EIIA and EIIB) and one or two membrane domains (EIIC or EIID). The EIIC or EIID domain binds to the membrane and transfers the sugar into the cytoplasm, where the sugar undergoes a multi - stage phosphorylation process involving the EIIA and EIIB domains. The phosphate group of phosphoenolpyruvate is transferred from EI to HPr, then from HPr to EIIA, then from EIIA to EIIB, and then the phosphate group is transferred to the sugar transported by EIIC or EIID. Most bacteria utilize the phosphoenolpyruvate: sugar phosphotransferase system (PTS) to transport carbohydrates such as glucose. EI catalyzes the phosphotransferase reaction from the glycolytic intermediate PEP to HPr. Subsequently, HPr transfers the phosphate group to different EIIAs, and then to EIIB. Finally, the sugar is transported across the membrane by EIIC and EIID while being phosphorylated by EIIB.
[0271] As used herein, the term "1,5 - anhydroalcohol - 6 - phosphate isomerase" includes 1,5 - anhydroglucitol - 6 - phosphate isomerase, which catalyzes the formation of 1 - deoxyfructose - 6 - phosphate from 1,5 - anhydroglucitol - 6 - phosphate; and 1,5 - anhydromannitol - 6 - phosphate isomerase, which catalyzes the formation of 1 - deoxyfructose - 6 - phosphate from 1,5 - anhydromannitol - 6 - phosphate.
[0272] In some embodiments, the 1,5 - anhydroalcohol - 6 - phosphate isomerase is 1,5 - anhydroglucitol - 6 - phosphate isomerase YbiW and 1,5 - anhydromannitol - 6 - phosphate isomerase PflD.
[0273] In some embodiments, the 1,5 - anhydroalcohol - 6 - phosphate isomerase comprises the amino acid sequence shown in SEQ ID NO:1 or a functional variant thereof. In some embodiments, the functional variant is a natural isoenzyme of the amino acid sequence shown in SEQ ID NO:1.
[0274] In some specific embodiments, the natural isoenzymes of the amino acid sequence shown in SEQ ID NO: 1 are from: Lactiplantibacillus plantarum, Escherichia coli, Lactobacillus selangorensis, Streptococcus uberis, Olsenella sp., Leptotrichia wadei, Streptococcus parauberis, Anaerostipes hadrus, Senella sp., Selenomonas ruminantium, Orenia metallireducens, Bifidobacterium primatium, Leptotrichia hofstadii, Ligilactobacillus agilis, Senella profusa, Clostridium butyricum, Vibrio ishigakensis, Coriobacteriaceae, Coriobacterium glomerans, Eggerthia catenaformis, Clostridium baratii str. Sullivan, Clostridiales, Firmicutes, Clostridium vincentii, Streptococcus downei, Erysipelotrichaceae, Quinella sp., Sebaldella termitidis, Ligilactobacillus animalis, Liquorilactobacillus satsumensis, Clostridium botulinum, Acetivibrio ethanolgignens, Aeromonas sobria, Clostridium cadaveris, Streptococcus bovimastitidis, Sodalis ligni, Lactococcus raffinolactis, Lactobacillus ultunensis, Leptotrichia sp., Lucifera butyrica, Fonticella tunisiensis, Cronobacter sakazakii, Liquorilactobacillus uvarum, Anaeromassilibacillus sp., Anaerotruncus sp.) Beauveria bassiana, Cedecea lapagei, Streptococcus pneumoniae, Streptococcus suis, Aeromonas veronii, Lactococcus raffinolactis, Streptococcus sanguinis, Actinomyces succiniciruminis, Vagococcus humatus, Vibrio alginolyticus, Ligilactobacillus acidipiscis, Pilibacter termitis, Lachnospiraceae, Aeromonas hydrophila, Enterococcus ratti, Kandleria vitulina, Clostridium pasteurianum, Aeromonas allosaccharophila, Pantoea alhagi, Peptacetobacter hiranonis, Edwardsiella piscicida, Cedecea neteri, Chelonobacter oris, Aeromonas sp., Clostridium sp., Vibrio gazogenes, Melissococcus plutonius, Tolumonas sp., Loigolactobacillus coryniformis, Zooshikella ganghwensis, Vibrio sp., Photobacterium lipolyticum, Agrilactobacillus composti, Clostridium symbiosum, and Aerococcus sp..
[0275] In some specific embodiments, the natural isozyme of the amino acid sequence shown in SEQ ID NO:1 comprises the amino acid sequence shown in any one of SEQ ID NOs:2-96.
[0276] In some embodiments, the polypeptide shown in any one of SEQ ID NOs:1-96 has 1,5-anhydroglucitol-6-phosphate isomerase activity, and the substrate is 1,5-anhydroglucitol-6-phosphate.
[0277] In some specific embodiments, when the polypeptide has 1,5-anhydroglucitol-6-phosphate isomerase activity, it isomerizes 1,5-anhydroglucitol-6-phosphate, and the product generated is 1-deoxyfructose-6-phosphate.
[0278] In some embodiments, the 1,5-anhydroglucitol-6-phosphate isomerase comprises the amino acid sequence shown in SEQ ID NO:97 or a functional variant thereof, and the functional variant is a natural isozyme of the amino acid sequence shown in SEQ ID NO:97.
[0279] In some embodiments, the natural isoenzymes of the amino acid sequence shown in SEQ ID NO: 97 are from: Escherichia coli, Streptococcus dysgalactiae subsp. Equisimilis, Firmicutes, Pseudoleptotrichia goodfellowii, Edwardsiella tarda, Serratia odorifera, Gilliamella apicola, Vibrio spp., Lactobacillus selangorensis, Caloranaerobacter sp., Pilibacter termitis, Caloranaerobacter azorensis, Salmonella enteritidis, Tolumonas auensis, Senella porci, Mycobacteriaceae, Fonticella tunisiensis, Coriobacteriales, Bacillus sp., Actinobacillus rossii, Lactobacillus ultunensis, Clostridium estertheticum, Geosporobacter ferrireducens, Vibrio ishigakensis, Streptococcus merionis, Shigella boydii, Agrilactobacillus composti, Lactobacillus selangorensis, Vagococcus elongatus, Clostridium acidisoli, Caloramator quimbayensis, Clostridium uliginosum, Enterobacter asburiae, Atopobium minutum, Thermophilibacter immobilis, Photobacterium lipolyticum, Citrobacter amalonaticus, Clostridium pasteurianum, Sebaldella termitidis, Acididesulfobacillus acetoxydans, and Clostridium spp.
[0280] In some specific embodiments, the natural isozyme of the amino acid sequence shown in SEQ ID NO: 97 comprises the amino acid sequence shown in any one of SEQ ID NOs: 98-144.
[0281] In some embodiments, the polypeptide shown in any one of SEQ ID NOs: 97-144 has 1,5-anhydro-D-mannitol-6-phosphate isomerase activity, and the substrate is 1,5-anhydro-D-mannitol-6-phosphate.
[0282] In some specific embodiments, when the polypeptide has 1,5-anhydro-D-mannitol-6-phosphate isomerase activity, it isomerizes 1,5-anhydro-D-mannitol-6-phosphate, and the product generated is 1-deoxy-D-fructose-6-phosphate.
[0283] In some embodiments, the functional variant is generated by one or more amino acid insertions, substitutions, and / or deletions based on the amino acid sequence shown in SEQ ID NO: 1 or 97 or its natural isozyme, wherein the insertions, substitutions, and / or deletions do not occur in the active site.
[0284] In some embodiments, the number of the amino acid insertions, substitutions, and / or deletions is 1-30, preferably 1-20, more preferably 1-10, and the obtained functional variant substantially maintains the unchanged 1,5-anhydro-sugar-6-phosphate isomerase (such as 1,5-anhydroglucitol-6-phosphate isomerase or 1,5-anhydro-D-mannitol-6-phosphate isomerase) activity.
[0285] In some embodiments, the functional variant differs from the amino acid sequence shown in SEQ ID NO: 1 or 97 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid insertions, substitutions, and / or deletions.
[0286] In some embodiments, the polypeptide is an isolated polypeptide.
[0287] In some embodiments, the polypeptide belongs to the glycine radical enzyme (GRE) family. When the polypeptide has 1,5-anhydroglucitol-6-phosphate isomerase or 1,5-anhydro-D-mannitol-6-phosphate isomerase activity, its catalytic action involves glycine and cysteine radicals.
[0288] The nucleic acid molecule of the present application can be combined with other DNA sequences, such as promoters, polyadenylation signals, other restriction enzyme cleavage sites, polylinker sites, other coding segments, etc., so that their total lengths can be significantly different. Therefore, polynucleotide fragments of almost any length are considered; the total length is preferably limited by the convenience of preparation and use in the expected recombinant DNA protocol.
[0289] Any one of a variety of well-established techniques known and available in the art can be used to prepare, manipulate, and / or express polynucleotides and their fusions. Methods well-known in the art can be used to modify the nucleic acid molecules of the present application, including but not limited to altering the cloning, processing, expression, and / or activity of gene products.
[0290] In some embodiments, the nucleic acid molecules are produced by artificial synthesis, such as direct chemical synthesis or enzymatic synthesis.
[0291] In some embodiments, the nucleic acid molecules are produced by recombinant techniques.
[0292] In some embodiments, the nucleic acid molecules are isolated nucleic acid molecules.
[0293] The present application provides expression cassettes that contain the above-described nucleic acid molecules.
[0294] In some specific embodiments, the expression cassette may further contain a 5' leader sequence that can enhance translation.
[0295] When preparing the expression cassette, various DNA fragments can be manipulated to provide DNA sequences in the appropriate orientation and, where appropriate, in the appropriate reading frame. To achieve this, linkers or adaptors can be used to ligate the DNA fragments, or other manipulations can be involved to provide convenient restriction sites, remove excess DNA, remove restriction sites, etc. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, replacement, such as transition and transversion, can be involved.
[0296] The present application provides expression vectors that contain the above-described nucleic acid molecules or expression cassettes.
[0297] Any suitable expression vector can be used in the present application. For example, the expression vector can be a vector suitable for the Escherichia coli system of the present application. In some embodiments, the expression vector can be any one of vectors such as HT, pACYC, etc.
[0298] In some embodiments, the nucleic acid molecule encoding any one of the polypeptides shown in SEQ ID NO: 1-96, or the nucleic acid molecule encoding any one of the polypeptides shown in SEQ ID NO: 97-144, is cloned into a vector to construct a recombinant vector containing the nucleic acid molecule of the present application.
[0299] In some embodiments, the expression vector for cloning polynucleotides is a plasmid vector.
[0300] In some embodiments, the above expression vector further comprises a regulatory sequence for regulating the expression of a nucleic acid molecule, wherein the nucleic acid molecule is operably linked to the regulatory sequence.
[0301] In some embodiments, an expression vector comprising a nucleotide sequence encoding a polypeptide shown in any one of SEQ ID NOs: 1-96 or a nucleotide sequence encoding a polypeptide shown in any one of SEQ ID NOs: 97-144 and appropriate transcriptional / translational regulatory elements is constructed using methods well known to those skilled in the art.
[0302] The present application also provides a cell comprising the above nucleic acid molecule or expression cassette or expression vector. In a specific embodiment, the cell is an Escherichia coli cell, such as Escherichia coli MG1655 cell.
[0303] In some embodiments, the cell is capable of expressing and producing 1,5-anhydroglucitol-6-phosphate isomerase, which comprises the amino acid sequence shown in any one of SEQ ID NOs: 1-144.
[0304] In some embodiments, the cell is capable of expressing and producing 1,5-anhydroglucose-6-phosphate isomerase, which comprises the amino acid sequence shown in any one of SEQ ID NOs: 1-96.
[0305] In some embodiments, the cell is capable of expressing and producing 1,5-anhydromannitol-6-phosphate isomerase, which comprises the amino acid sequence shown in any one of SEQ ID NOs: 97-144.
[0306] In some embodiments, the cell further expresses an activating enzyme, an aldolase, a hydroxyacetone reductase, and / or a transport complex.
[0307] In a specific embodiment, the activating enzyme is an S-adenosylmethionine radical enzyme family glycine radical enzyme activating enzyme (enzyme classification number is EC: 1.97.1.4). In a specific embodiment, the aldolase is 1-deoxyfructose-6-phosphate aldolase (also known as fructose-6-phosphate aldolase, its enzyme classification number is EC: 4.1.2). In a specific embodiment, the hydroxyacetone reductase (also known as glycerol dehydrogenase, its enzyme classification number is EC: 1.1.1.6).
[0308] In some specific embodiments, the S-adenosylmethionine radical enzyme family glycine radical enzyme activating enzyme is the activating enzyme of 1,5-anhydrohexitol-6-phosphate isomerase. In some embodiments, the S-adenosylmethionine radical enzyme family glycine radical enzyme activating enzyme comprises an [Fe-S] cluster. In some embodiments, the S-adenosylmethionine radical enzyme family glycine radical enzyme activating enzyme comprises a [4Fe-4S] cluster, i.e., it contains 4 Fe and 4 S. In some embodiments, the S-adenosylmethionine radical enzyme family glycine radical enzyme activating enzyme catalyzes the cleavage of S-adenosylmethionine (SAM).
[0309] In some specific embodiments, the transport complex comprises SEQ ID NO: 150-153 or a functional variant thereof, and the transport complex has phosphoenolpyruvate-dependent phosphotransferase system transport activity.
[0310] In some embodiments, SEQ ID NO: 150-153 respectively represent the amino acid sequences of polyphosphate transfer protein (PtsA), PTS system fructose-like EⅡB component 2 (FrwB), PTS system fructose-like EⅡC component 2 (FrwC), and PTS system fructose-like EⅡB component 3 (FrwD).
[0311] In some embodiments, the four sequences shown in SEQ ID NO: 150-153 constitute a phosphoenolpyruvate-sugar phosphotransferase system, wherein PtsA contains EⅠ and EⅡA domains, FrwC is EⅡC, and FrwB and FrwD are EⅡB.
[0312] In some specific embodiments, PtsA, FrwB, FrwC, and FrwD interact to form a transport complex and exert phosphoenolpyruvate-dependent phosphotransferase system transport activity. In some embodiments, the transport complex transports 1,5-anhydrohexitol (such as 1,5-anhydroglucitol, 1,5-anhydromannitol) into the host cell and phosphorylates it (such as obtaining 1,5-anhydroglucitol-6-phosphate, 1,5-anhydromannitol-6-phosphate) for subsequent glycolysis processes.
[0313] In some embodiments, the functional variant of any one of SEQ ID NO: 150-153 differs from the amino acid sequence shown in any one of the corresponding SEQ ID NO: 150-153 by about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid insertions, substitutions, and / or deletions.
[0314] In some embodiments, the available host cells are cells containing the above expression vector, which can be eukaryotic cells. For example, a yeast cell culture system can be used for the expression of the polypeptides of the present application. The host cells can also be prokaryotic cells containing the above expression vector, and can be selected from, for example, the genus Escherichia (such as Escherichia coli), the genus Klebsiella, the genus Streptococcus, the genus Lactobacillus, the genus Bifidobacterium, the phylum Bacteroidetes, and the phylum Firmicutes, etc.
[0315] In some specific embodiments, the host cell is a yeast cell or Escherichia coli.
[0316] In some specific embodiments, the nucleic acid molecule encoding one or more enzymes of the present application can exist in the host cell in the form of a free vector, or can also be integrated into the genome of the host cell.
[0317] In some embodiments, the isolated nucleic acid is operably linked to a regulatory sequence that can be recognized by a host cell transformed with the expression vector.
[0318] Any technique known in the art can be used to introduce the expression vector into the host cell, including transformation, transduction, transfection, viral infection, gene gun, or Ti-mediated gene transfer. As an example, when the host is a prokaryote such as Escherichia coli, competent cells can be harvested after the exponential growth phase and transformed by the CaCl 2 method.
[0319] In some specific embodiments, 1,5-anhydroglucitol is transported into the host cell by the transport complex (such as a transport complex having phosphoenolpyruvate-dependent phosphotransferase system transport activity) and phosphorylated (such as at the C-6 position) to generate 1,5-anhydroglucitol-6-phosphate; 1,5-anhydroglucitol-6-phosphate is catalyzed by 1,5-anhydroglucitol-6-phosphate isomerase to generate 1-deoxyfructose-6-phosphate; 1-deoxyfructose-6-phosphate is cleaved by aldolase (such as 1-deoxyfructose-6-phosphate aldolase) to generate hydroxyacetone and glyceraldehyde 3-phosphate; and hydroxyacetone is reduced by hydroxyacetone reductase to generate 1,2-propanediol.
[0320] In some specific embodiments, 1,5-anhydroglucitol is transported into host cells by the transport complex (e.g., a transport complex having phosphoenolpyruvate-dependent phosphotransferase system transport activity) and phosphorylated (e.g., at the C-6 position) to generate 1,5-anhydroglucitol-6-phosphate; 1,5-anhydroglucitol-6-phosphate is converted to 1-deoxyfructose-6-phosphate under the catalysis of 1,5-anhydroglucitol-6-phosphate isomerase; 1-deoxyfructose-6-phosphate is cleaved by aldolase (e.g., 1-deoxyfructose-6-phosphate aldolase) to generate hydroxyacetone and glyceraldehyde 3-phosphate; and hydroxyacetone is reduced by hydroxyacetone reductase to generate 1,2-propanediol.
[0321] In some embodiments, the method for producing 1,2-propanediol described herein further includes the steps of collecting the culture and purifying 1,2-propanediol.
[0322] Examples
[0323] The following examples are illustrative only and are not intended to limit the scope of the embodiments of the present application or the scope of the appended claims.
[0324] Example 1. Identification, Characterization, and Testing of the YbiW-Related Pathway
[0325] Materials and Methods
[0326] Experimental Materials
[0327] Tryptone and yeast extract used to prepare LB medium were purchased from Oxoid Limited (Hampshire, UK). Ultra-pure deionized water from Millipore Direct-Q was used. TALON resin was purchased from Clontech Laboratories Inc (California, USA). 1,5-anhydroglucitol (1,5-AG) was purchased from Shanghai Yuanye Bio-Technology Co., Ltd., and 1,5-anhydroglucitol-6-phosphate (1,5-AG-6P) was chemically synthesized by Tianjin SinoScien Chemical Technology Co., Ltd. Direct-Q oligonucleotide primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd. All protein purification chromatography experiments were performed on a pure FPLC system (GE Healthcare, USA). Anaerobic experiments were performed in a Lab2000 glove box (Etelux) protected by N 2 (oxygen concentration less than 5 ppm).
[0328] Gene Synthesis and Cloning
[0329] The gene fragments of LpYbiW (Uniprot accession number: A0A807DR53), LpYbiY (Uniprot accession number: A0A162FGG2), and codon-optimized LpFsaA from Escherichia coli (Uniprot accession number: A0A0M4CJJ6) were synthesized by Beijing Tsingke Biotechnology Co., Ltd. LpYbiW and LpFsaA were inserted into the SspI site of the HT plasmid (optimized pET28 vector) to express proteins with an N-terminal His 6 tag. While LpYbiY was inserted into the NdeI site of the pACYC-MBP vector to express proteins with an N-terminal His 6 tag and maltose-binding protein (MBP).
[0330] For the purpose of biochemical characterization, EcYbiW (Uniprot accession number: P75793) and EcYbiY (Uniprot accession number: P75794) were amplified from the Escherichia coli MG1655 genome using primers 18F / 18R and 19F / 19R (Table 6). EcYbiW was inserted into the SspI site of the HT plasmid (optimized pET28 vector) to express proteins with an N-terminal His6 tag. While EcYbiY was inserted into the NdeI site of the pACYC-MBP vector to express proteins with an N-terminal His 6 tag and maltose-binding protein (MBP).
[0331] Expression and purification of LpYbiW, LpYbiY, and LpFsaA
[0332] The plasmids HT-LpYbiW, pACYC-MBP-LpYbiY, and HT-LpFsaA were transformed into Escherichia coli BL21(DE3) cells to express the corresponding proteins. LpYbiW and LpFsaA were screened on LB agar plates containing 50 μg / mL kanamycin, while LpYbiY positive clones were screened on LB agar plates containing 25 μg / mL chloramphenicol. The cells were cultured overnight in 4 mL of LB medium and then transferred to fresh LB medium (usually 1 L in a 2.6 L flask) and grown in an orbital shaker incubator at 37 °C and 220 rpm. When OD 600When it reaches approximately 0.8, the temperature is reduced to 18 °C, and isopropyl β-D-1-thiogalactopyranoside (IPTG) with a final concentration of 0.3 mM is added to induce the production of the target protein. After 16 - 20 hours, the cells are collected by centrifugation (8000 g, 10 minutes at 4 °C). The collected cells are resuspended in 40 mL of lysis buffer (50 mM Tris / HCl, pH 8.0, 100 mM KCl, 1 mM phenylmethylsulfonyl fluoride (PMSF), 0.2 mg / mL lysozyme, 0.03% Triton X-100, and 0.02 mg / mL DNase I) and stored frozen in a -80 °C refrigerator.
[0333] The frozen cells are thawed and incubated at room temperature (RT, 25 °C) for 20 minutes, during which cell lysis occurs. 5 mM β-mercaptoethanol (BME) is added, and nucleic acids are removed by precipitation with 1% streptomycin sulfate. At 4 °C, the cell debris is removed by centrifugation at 10000 × g for 10 minutes. For LpYbiW and LpFsaA, the supernatant is filtered through a 0.22 μm filter and loaded onto a 5 mL TALON Co 2+ column (TakaraBio USA, Inc.) pre-equilibrated with buffer A (20 mM Tris / HCl, pH 7.5, 200 mM KCl, and 5 mM BME), and the contaminating proteins are washed away with 10 column volumes of buffer A, and the protein is eluted with 5 column volumes of buffer A containing 150 mM imidazole. The eluted protein (~20 mL) is dialyzed against 2 L of buffer A at 4 °C for 3 hours, concentrated and aliquoted, frozen in liquid nitrogen, and stored at -80 °C. For LpYbiY, the supernatant is filtered and loaded onto a column packed with 10 mL of amylose resin (New England Biolabs, Massachusetts, U.S.A.). The contaminating proteins are washed away with 10 column volumes of buffer A, and the target protein is eluted with buffer A containing 10 mM maltose.
[0334] The purified proteins are detected by SDS-PAGE using a commercial gel (SurePAGE, Bis-Tris, 4 - 20%). The absorbance of the proteins at 280 nm is measured using a ultra-micro UV-visible spectrophotometer (Hangzhou Mio Instruments Co., Ltd.) to calculate their concentrations. [LpYbiW (ε 280 = 104,630 M -1 cm -1 ), MBP-LpYbiY (ε 280 = 100,730 M -1 cm -1 ), LpFsaA (ε 280 = 20,400 M -1 cm-1 )].
[0335] Expression and Purification of EcYbiW and EcYbiY for Biochemical Characterization
[0336] The protein expression and purification methods and procedures, SDS-PAGE detection method, and concentration determination method are the same as those of LpYbiW and LpYbiY above. [EcYbiW (ε 280 = 99,700 M -1 cm -1 ), MBP-EcYbiY (ε 280 = 97,750 M -1 cm -1 )].
[0337] Reconstitution and Characterization of the LpYbiY Cofactor [Fe-S] Cluster
[0338] Sequence alignment showed that LpYbiY contains only one [4Fe–4S] cluster in the radical SAM domain, with a theoretical maximum of 4Fe and 4S per monomer. After degassing and deoxygenating the LpYbiY protein solution with argon, it was transferred into a glove box. To the deoxygenated protein solution described above, 100 mM Tris / HCl, pH 7.5, 10 mM DTT, 4 equivalents of ammonium ferrous sulfate, and sodium sulfide were added, and the mixture was incubated overnight in a metal bath (Dry Bath H2O3-100C; Coyote Bioscience, Beijing, China) at 4 °C. Then, 4 equivalents of EDTA solution were added, and the mixture was repeatedly concentrated using a centrifugal filtration ultrafiltration tube (1.5 mL Ym-30 Amicon; Millipore) and diluted and exchanged using a buffer (20 mM Tris-HCl, pH 7.5 and 100 mM KCl).
[0339] Phenanthroline [3-(2-pyridyl)-5,6-diphenyl-1,2,4-triazine-p,p'-disulfonic acid monosodium salt] was used to determine the iron content of unconstructed and constructed LpYbiY. Using an AAS iron standard, a standard curve of Fe in the range of 0–600 μM was established. The sulfur content in unconstructed and constructed LpYbiY was determined by measuring the absorbance of methylene blue formed by reacting with N,N-dimethyl-p-phenylenediamine dihydrochloride (DPD). Using Na 2 S, a standard curve of S in the range of 0–600 μM was established.
[0340] The UV-Vis absorption spectrum of LpYbiY in the range of 200 - 800 nm was measured using a NanoPhotometer NP80 Mobile (Germany). The unconstructed and reconstituted LpYbiY was diluted to 10 μM using a buffer containing 20 mM Tris / HCl, pH 7.5, and 100 mM KCl, and transferred to a septum-sealed anaerobic cuvette for measurement. In the reconstituted LpYbiY solution, 10 equivalents of titanium(III) citrate were added and incubated for 10 minutes to determine its reduced form.
[0341] LC-MS analysis of the cleavage of S-adenosylmethionine (SAM) catalyzed by LpYbiY
[0342] A reaction system (500 μL) containing 20 mM Tris / HCl, pH 7.5, 100 mM KCl, 200 μM titanium(III) citrate, 20 μM reconstituted LpYbiY, and 1 mM SAM was incubated overnight at room temperature in a glove box. Titanium(III) citrate was not added to the negative control. The reaction was quenched by adding formic acid (final concentration 5% v / v) and incubated in a boiling water bath for 1 minute to denature the protein. The precipitated protein was removed by centrifugation at 14000×g for 15 minutes. The supernatant was filtered through a 0.22 μm PES membrane for LC-MS analysis. The method was as follows: 20 μL of the sample was loaded onto an Agilent 6420 Triple Quadrupole LC / MS instrument (Agilent Technologies) equipped with a C18 reversed-phase column, and the ultraviolet absorption at 257 nm was detected. The mobile phase system consisted of water (A) and acetonitrile (B), and a linear gradient of 0–16% B was eluted for 30 minutes at a flow rate of 0.5 mL / min. Commercial 5'-dA was used as a standard to verify the formation of the SAM cleavage product catalyzed by LpYbiY by mass spectrometry.
[0343] Electron paramagnetic resonance (EPR) spectroscopy was used to detect the generation of LpYbiW radicals
[0344] Characterization of LpYbiW glycine radicals using continuous-wave X-band electron paramagnetic resonance (EPR) spectroscopy. A reaction system (200 μL) containing 20 mM Tris / HCl, pH 7.5, 100 mM KCl, 100 μM titanium(III) citrate, 1 mM SAM, 80 μM reconstituted LpYbiY, and 40 μM LpYbiW was incubated in a glove box at room temperature for 15 minutes. 10% glycerol was added and then loaded into an EPR tube (Wilmad Lab Glass, 734-LPV-7) with an outer diameter of 4 mm and a length of 8 inches. It was sealed with a rubber stopper, removed from the glove box, and frozen using liquid nitrogen before EPR analysis. The experimental spectra of glycine radicals were modeled by Bruker Xepr spin fitting to obtain g values, hyperfine coupling constants, and line widths. The double integral of the simulated spectra was used to measure the spin concentration. The EPR spectra were obtained by superimposing 30 scans, and the test conditions were as follows: temperature, 90 K; central field, 3370.00 gauss; range, 200 gauss; microwave power, 10 μW; microwave frequency, 9.43 MHz; modulation amplitude, 0.5 mT; modulation frequency, 100 kHz; time constant, 20.48 ms; conversion time, 25 ms; scan time, 20 seconds; receive gain, 43 dB.
[0345] LC-MS analysis of LpYbiW activity assay
[0346] As described in the above EPR experiment, LpYbiW was activated without adding glycerol. A 200 μL reaction mixture containing 10 μM activated LpYbiW, 0.1 mM titanium(III) citrate, and 10 mM 1,5-AG-6P was incubated in a glove box at room temperature for 1 h. Negative controls were without 1,5-AG-6P, SAM, or activated LpYbiW, respectively. 200 μL of acetonitrile was added to the reaction system to precipitate proteins, and the precipitate was removed by centrifugation. The supernatant was filtered through a 0.22 μm PES membrane for LC-MS analysis.
[0347] LC-MS analysis was performed using an Agilent 6420 Triple Quadrupole LC / MS instrument (Agilent Technologies). The dry gas temperature was maintained at 300 °C, the flow rate was 9 L / min, and the nebulizer pressure was 15 psi. LC-MS analysis was performed using a ZIC-HILIC column (5 mm, 150×4.6 mm; Merck). The HPLC conditions were as follows: mobile phase A was 90% 20 mM ammonium acetate and 10% acetonitrile, and mobile phase B was acetonitrile; gradient elution was performed from 90% B to 70% B in 10 minutes and from 70% B to 50% B in 20 minutes. The flow rate was set at 0.5 mL / min. The mass spectrometer was operated in the ESI negative ion mode.
[0348] LC-MS analysis of EcYbiW activity assay
[0349] The experimental method of LC-MS analysis for EcYbiW activity assay is the same as that for LpYbiW activity assay.
[0350] LC-MS analysis of the activity of LpFsaA coupled with LpYbiW
[0351] After incubating a reaction mixture (200 μL) containing 10 μM activated LpYbiW, 0.1 mM titanium(III) citrate, and 10 mM 1,5-AG-6P at room temperature for 1 h in a glove box, the enzyme activity of LpFsaA coupled with LpYbiW was assayed. 10 μM LpFsaA was added to the above reaction system, and after reacting for another 1 h in the glove box, 50 μL of the reaction sample was mixed with 550 μL of 0.73 M sodium acetate (pH 5.0), and then mixed with 400 μL of freshly prepared 2,4-dinitrophenylhydrazine (DNPH) solution (20 mg dissolved in 50 mL of methanol), and then incubated at 50 °C for 1 h. The mixture was centrifuged at 13000×g for 5 min and filtered before LC–MS analysis. The product standard was prepared by treating 3-phosphoglyceraldehyde (5 mM, Sigema-Aldrich) and hydroxyacetone (2 mM, TCI) standards with sodium acetate (pH 5.0) and freshly prepared 2,4-dinitrophenylhydrazine (DNPH) in the same way for 1 h.
[0352] LC–MS analysis was performed using 20 μL of the sample on an Agilent ZORBAX SB-C18 reversed-phase column (4.6×250 mm) in the ESI negative ion mode. The solvent system consisted of solvent C (deionized ultrapure water containing 0.1% formic acid) and D (chromatographic acetonitrile containing 0.1% formic acid). The liquid phase analysis was carried out according to the following program: eluting from 15% to 100% of D at a flow rate of 1.0 mL / min within 15 min, and the detection wavelength was set at 360 nm.
[0353] LC-MS analysis of LpFsaA activity
[0354] The activity of LpFsaA catalyzing the aldol condensation reaction of hydroxyacetone and 3-phosphoglyceraldehyde was also assayed: A 200 μL reaction system containing 50 mM Tris / HCl, pH 8.0, 100 mM KCl, 5 mM 3-phosphoglyceraldehyde, 10 mM hydroxyacetone, and 10 μM LpFsaA was incubated at room temperature for 1 h. 3-Phosphoglyceraldehyde, hydroxyacetone, or LpFsaA was not added to the negative control. LC-MS analysis was performed using a ZIC-HILIC column with the same sample preparation method and elution conditions as described in the LpYbiW activity assay.
[0355] Determination of Michaelis-Menten kinetic parameters of LpYbiW
[0356] The Michaelis-Menten kinetic parameters of LpYbiW were determined by coupling LpFsaA and EcGldA. The reaction rate of LpYbiW was monitored by detecting the consumption of NADH at point A 340nm The absorbance change of the reaction system at 340 nm was detected every 5 s using the cuvette mode (1 cm optical path) of a nano-photometer, an ultra-micro ultraviolet-visible spectrophotometer in the glove box. These reaction systems consisted of 100 nM activated LpYbiW, 20 mM Tris / HCl, pH 7.5, 100 mM KCl, different concentrations of 1,5-anhydroglucitol-6-phosphate, 5 μM LpFsaA, 5 μM EcGldA, and 0.4 mM NADH.
[0357] Construction of an expression plasmid of EcYbiW for crystallography research
[0358] The Escherichia coli gene encoding YbiW (EcYbiW, Uniprot accession number: P75793) was amplified by PCR using the primer pair 5F / 5R and inserted into the NdeI site of the vector pACYC. Then, site-directed mutagenesis of the plasmid pACYC-EcYbiW was performed using the primer pair 6F / 6R to obtain the plasmid pACYC-EcYbiW (E114A, E115A, and K117A, which means that the amino acids at positions 114, 115, and 117 were mutated from glutamate (E) and lysine (K) to alanine (A)) to express mutants with reduced surface entropy of EcYbiW and improve the success rate of protein crystallization screening.
[0359] Expression and purification of EcYbiW for crystallography research
[0360] The plasmid pACYC-EcYbiW (E114A, E115A, and K117A) was transformed into Escherichia coli BL21(DE3) cells, and positive clones were screened using LB agar plates containing 25 μg / mL chloramphenicol. Single colonies were picked and cultured overnight in 4 mL of LB medium, then inoculated into 1 L of fresh LB medium and cultured at 37 °C and 220 rpm until OD 600Approximately 0.8, 0.3 mM IPTG was added and induced at 18 °C for 16 h. Cells in 1 L of culture were collected by centrifugation (8000×g, 10 min) and resuspended in 40 mL of lysis buffer (50 mM Tris / HCl, pH 8.0, 100 mM KCl, 0.03% Triton X-100). Cells were lysed by sonication and centrifuged at 10000×g for 10 min at 4 °C to remove insoluble cell pellets. The supernatant was filtered through a 0.45 μm filter and applied to a 10 mL TALONC Co 2+ column, then washed with 10 column volumes of buffer A (20 mM Tris / HCl, pH 7.5, 200 mM KCl and 5 mM BME), and eluted with 5 column volumes of buffer A containing 150 mM imidazole. The eluate was dialyzed against 2 L of buffer B (20 mM Tris / HCl, pH 7.5, 5 mM BME) for 3 h, then loaded onto a 10 mL DEAE column and eluted linearly with 30 column volumes of buffer B with a salt gradient from 0 to 500 mM KCl. The fractions containing EcYbiW were collected and concentrated to approximately 5 mL by ultrafiltration. Then the protein solution was injected into a Superdex 200 gel filtration column (300 mL) and eluted with buffer C (20 mM Tris / HCl, pH 7.5, 100 mM KCl, 1 mM DTT). The sample eluate from the gel filtration column was reconcentrated to 13.3 mg / mL for crystallography studies.
[0361] Crystallization, data collection and structure determination of EcYbiW
[0362] The initial screening of EcYbiW crystals was performed by the sitting-drop method using an automated liquid handling robotic system (Gryphon, Art Robbins) in 96-well format. Screening was carried out at 291 K using various crystal screening kits from Hampton Research and Molecular Dimensions. After further optimization by the hanging-drop method in 24-well plates, crystals for single-crystal X-ray diffraction studies were obtained. The optimal conditions for generating EcYbiW bulk crystals were 0.2 M NaCl, 0.1 M Tris, pH 8.0, 25% PEG3350 plus 10 mM 1,5-AG-6P, and a 6.7 mg / mL EcYbiW protein solution. The crystallization solution containing 15% glycerol was used as a cryoprotectant and rapidly cooled in liquid nitrogen. Diffraction data were collected and processed at BL10U2 of the Shanghai Synchrotron Radiation Facility (SSRF) at a resolution of The crystal structure model created with the website PHYRE2 was subjected to molecular replacement on the PHENIX software. The structure was manually built using the Coot software according to the electron cloud orientation, further optimized in the PHENIX software, and then uploaded to the RCSB Protein Data Bank (accession code 8ID7). The appendix table contains the crystal structure data for data collection and final optimization (Table 1). All structure diagrams were generated using UCSF Chimera( Figure 4 A,4B).
[0363] Identification of the active center of 1,5-anhydroglucitol-6-phosphate isomerase
[0364] For the PDB data of the crystal of the obtained EcYbiW complexed with 1,5-AG-6P (resolution ), the UCSF Chimera software was used for display. Centering on the substrate 1,5-AG-6P, the amino acid residues within the range of the substrate center were selected for display. According to the hydrogen bond distances formed between the substrate and the amino acid residues, the key amino acid residues binding to the substrate in the active center of 1,5-anhydroglucitol-6-phosphate isomerase were determined. Combining with the catalytic mechanism of glycine radical 1,2-lyase in the literature, the key amino acid residues in the active center of 1,5-anhydroglucitol-6-phosphate isomerase were determined.
[0365] Identification of the isoenzymes of 1,5-anhydroglucitol-6-phosphate isomerase
[0366] To identify the isoenzymes of 1,5-anhydroglucitol-6-phosphate isomerase in the glycine radical enzyme (GRE) family, a sequence similarity network (SSN) of 25,347 unique sequences in the InterPro family IPR004184 was constructed using the web-based Enzyme Function Initiative-Enzyme Similarity Tool (EFI-EST). The alignment score threshold was set to 250, the minimum sequence length was set to 650, and the 80% similarity representative node network (RepNode network) was displayed using Cytoscape v3.519. Under these settings, previously characterized GREs with different catalytic activities were divided into different clusters.
[0367] Sequences with 80% or more similarity are represented by a single node. The sequences are folded together to reduce the total number of nodes, making the less complex network easier to load in Cytoscape. For the clusters formed by YbiW, a representative sequence is selected from each node according to different nodes. Based on the crystal structure of the complex formed by EcYbiW and the substrate, the amino acid residues interacting with the substrate are taken as conserved sites for multiple sequence alignment. Sequences containing these conserved sites simultaneously are retained. Further analysis is carried out on the neighboring genes of these sequences, and the sequences containing aldolase in the gene cluster are retained, and finally representative sequences are selected.
[0368] Results, Analysis and Discussion
[0369] When performing bioinformatics analysis on the glycine radical enzyme (GRE) sequences in the UniProt database, the inventors of the present application noticed that a GRE (YbiW) with unknown function appeared in the gene cluster involved in sugar metabolism. In addition to YbiW and its activating enzyme (YbiY), this gene cluster also contains an aldolase (FsaA). This aldolase can catalyze the formation of corresponding 2-keto-hexose-6-phosphate from hydroxyacetone, 1,3-dihydroxyacetone and glyceraldehyde 3-phosphate. Based on this, the inventors of the present application speculated that this GRE is involved in sugar metabolism and its substrate may be a hexose phosphate. Combining the results of molecular docking, the inventors of the present application speculated that the substrate of YbiW is 1,5-anhydroglucitol-6-phosphate (1,5-AG-6P), and proposed a new radical-dependent glycolysis pathway. In this pathway, 1,5-AG-6P is catalyzed by YbiW to break the C-O bond, generating 1-deoxyfructose-6-phosphate. This product is further cleaved by aldolase FsaA to produce hydroxyacetone and glyceraldehyde 3-phosphate ( Figure 1 A).
[0370] To confirm the conjecture, the inventors of the present application selected the YbiW, YbiY and FsaA genes from Lactiplantibacillus plantarum, and then carried out heterologous expression in Escherichia coli BL21(DE3) cells and characterized the activities of these proteins.
[0371] The inventors of the present application reconstructed the cofactor [Fe-S] 2+ cluster of the activating enzyme LpYbiY and characterized it. The anaerobic reconstruction of the [4Fe-4S] cluster resulted in 1.54 ± 0.12 Fe and 2.01 ± 0.08 S per monomer (a radical SAM domain, the theoretical maximum of the [4Fe-4S] cluster is 4 Fe and 4 S) and a typical UV-visible spectrum of the protein containing [4Fe-4S], with a molar extinction coefficient extinction coefficient ε 410nm of 8.85 mM -1 cm-1 ( Figure 7 B). The ε of each [4Fe-4S] cluster 410nm is approximately 15 mM -1 cm -1 , so the inventors of the present application estimate that each monomer contains approximately 0.59 [4Fe-4S], which is roughly consistent with the measured Fe and S contents ( Figure 7 A). LC-MS detection results show that, like other radical SAM enzymes, LpYbiY catalyzes the cleavage of SAM in the presence of the reducing agent titanium(III) citrate to form 5'-deoxyadenosine ( Figure 7 C-7D). EPR spectroscopy shows that incubating LpYbiW, LpYbiY, SAM, and Ti(III) forms radicals, and these generated radicals are quantified as 0.017 Gly· / dimer ( Figure 2 A).
[0372] To determine the activity of LpYbiW, activated LpYbiW was incubated with 1,5-AG-6P and analyzed by LC-MS ( Figure 2 B-2D). It can be seen that there is a new peak with m / z(-) = 243.0 in the full reaction group at t R = 18.40 min. In the activity experiment of LpFsaA catalyzing the aldol condensation reaction of hydroxyacetone and glyceraldehyde 3-phosphate, a new peak (m / z(-) = 243.0, t R = 18.40 min) is also generated in the full reaction group ( Figure 9 A,9C). The Michaelis-Menten kinetic parameters of LpYbiW were also determined ( Figure 10 , k cat = 43.38 ± 2.96 s -1 / LpYbiW, K M = 36.52 ± 6.66 mM). LpFsaA was coupled with LpYbiW for the reaction, and the production of the corresponding products hydroxyacetone and glyceraldehyde 3-phosphate was detected by LC-MS analysis ( Figure 2 E-2H). These data indicate that LpYbiW catalyzes the cleavage of the C-O bond in 1,5-AG-6P to produce 1-deoxyfructose-6-phosphate (1-deoxy-F6P).
[0373] According to the LC-MS analysis results, it can be seen that there is a new peak with m / z(-) = 243.0 in the full reaction group at t R = 18.40 min ( Figure 18 A) is generated, and the mass spectrum corresponding to this new peak is Figure 18 B, and the mass spectrum corresponding to the substrate is Figure 18C. The LC-MS results showed that EcYbiW has 1,5-anhydroglucitol-6-phosphate isomerase activity.
[0374] To further study the catalytic mechanism of YbiW, the inventors of the present application determined the crystal structure of the complex of EcYbiW with 1,5-AG-6P (resolution ). Each asymmetric unit of YbiW contains one monomer. Each monomer exhibits the typical β / α barrel fold common to other GREs ( Figure 4 A), as well as a radical-like conformation with Gly· and Cys· loops. From this crystal structure, the inventors of the present application could see that the S atom of the Cys· residue Cys441 is adjacent to the H atom at the C2 position of the substrate, with a distance of . This is consistent with the catalytic mechanism involving "C2 hydrogen atom abstraction by Cys·". The 2-OH group of the substrate 1,5-AG-6P forms a hydrogen bond with Glu443; the phosphate group coordinates with His165, His334, and Arg453 of YbiW; the 1-O atom forms a hydrogen bond with His334, and the 3-OH forms a hydrogen bond with S662 ( Figure 4 C). Glu443 is involved in the protonation of the 2-OH of the substrate, which is consistent with the role of the base in the catalytic mechanism of GRE 1,2-elimination enzymes.
[0375] Based on the crystal structure of YbiW, the inventors of the present application proposed the following catalytic mechanism of YbiW. Similar to other GRE 1,2-elimination enzymes, Cys441· abstracts the H atom at the C2 position from the substrate 1,5-AG-6P, generating a substrate radical at the C2 position. Then, Glu443 deprotonates the 2-OH of the substrate, and the substrate radical translocates to the C1 position, followed by cleavage of the C-O bond to form a product radical. The product radical then abstracts the H atom that Cys441 abstracted from the substrate, generating the product 1-deoxy-F6P and regenerating Cys441· ( Figure 4 E).
[0376] Based on the crystal structure of the complex formed by EcYbiW and the substrate 1,5-anhydroglucitol-6-phosphate. By referring to the hydrogen bond distances formed between the substrate and amino acid residues, the key amino acid residues in the active center of 1,5-anhydroglucitol-6-phosphate isomerase that bind to the substrate were determined. Combining with the catalytic mechanism of glycine radical 1,2-lyase in the literature, the key amino acid residues in the active center of 1,5-anhydroglucitol-6-phosphate isomerase were determined. In EcYbiW (SEQ ID NO:1), they are the amino acid residues H165, H282, S283, H334, C441, E443, R453, T455, L562, S662, I664, and G786.
[0377] Based on the analysis of SSN (Sequence Similarity Network) data, the YbiW cluster showed a total of 207 nodes and 2333 consensus sequences. The inventors of this application selected a representative sequence from each node. According to the crystal structure of EcYbiW (Uniprot accession number: P75793), the amino acid residues interacting with the substrate (H165, H282, S283, H334, C441, E443, R453, T455, L562, S662, I664, and G786 in reference to SEQ ID NO:1) were used as conserved sites for multiple sequence alignment. Sequences containing these conserved sites simultaneously were retained, and a total of 173 isoenzyme sequences were screened out. Further analysis was performed on the neighboring genes of these 173 sequences, and sequences containing aldolase FsaA in the gene cluster were retained. Finally, a total of 95 representative sequences ( Figure 14 and Figure 15 ) were listed. Table 2 shows the accession numbers, strain sources, and amino acid sequence numbers of 95 1,5-anhydromannitol-6-phosphate isomerase isoenzymes found in the Uniprot database.
[0378] Example 2. Identification, Characterization, and Testing of the PflD-Related Pathway
[0379] Experimental Materials
[0380] Tryptone and yeast extract used to prepare LB medium were purchased from Oxoid Limited (Hampshire, UK). Ultra-pure deionized water from Millipore Direct-Q was used. TALON resin was purchased from Clontech Laboratories Inc (California, USA). 1,5-anhydromannitol (1,5-AM) and 1,5-anhydromannitol-6-phosphate (1,5-AM-6P) were chemically synthesized by Tianjin Sine Chemical Technology Co., Ltd. Direct-Q oligonucleotide primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd. All protein purification chromatography experiments were carried out on a pure FPLC system (GE Healthcare, USA). Anaerobic experiments were carried out in a Lab2000 glove box (Etelux) protected by N 2 (oxygen concentration less than 5 ppm).
[0381] Gene Synthesis and Cloning
[0382] EcPflD (Uniprot accession number: P32674), EcPflC (Uniprot accession number: P32675), EcFsaB (Uniprot accession number: P32669), and EcGldA (Uniprot accession number: P0A9S5) were obtained by amplifying the Escherichia coli MG1655 genome using primer pairs 1F / 1R, 2F / 2R, 3F / 3R, and 4F / 4R, respectively (Table 3). EcPflD, EcFsaB, and EcGldA were inserted into the SspI site of the HT plasmid (optimized pET28 vector) to express proteins with an N-terminal His 6 tag. EcPflC was inserted into the SspI site of the HMT vector to express a protein with an N-terminal His 6 tag and maltose-binding protein (MBP).
[0383] For biochemical characterization purposes, gene fragments of SdPflD (NCBI accession number OCX05109.1) and SdPflC (NCBI accession number OCX05103.1) were synthesized by Beijing Tsingke Biotechnology Co., Ltd. SdPflD was inserted into the SspI site of the HT plasmid (optimized pET28 vector) to express a protein with an N-terminal His 6 tag. SdPflC was inserted into the NdeI site of the pACYC-MBP vector to express a protein with an N-terminal His6 tag and maltose-binding protein (MBP).
[0384] Expression and purification of EcPflD, EcPflC, EcFsaB, and EcGldA
[0385] The plasmids HT-EcPflD, HMT-EcPflC, HT-EcFsaB, and HT-EcGldA were transformed into Escherichia coli BL21(DE3) cells to express the corresponding proteins. Positive clones were screened using LB agar plates containing 50 μg / mL kanamycin. The cells were cultured overnight in 4 mL of LB medium and then transferred to fresh LB medium (usually 1 L in a 2.6 L flask) and cultured in an orbital shaker at 37 °C and 220 rpm. When OD 600When it reaches approximately 0.8, the temperature is reduced to 18 °C, and isopropyl β-D-1-thiogalactopyranoside (IPTG) with a final concentration of 0.3 mM is added to induce the expression of the target protein. After 16 - 20 hours, the cells are collected by centrifugation (8000×g, 10 minutes at 4 °C). The collected cells are resuspended in 40 mL of lysis buffer (50 mM Tris / HCl, pH 8.0, 100 mM KCl, 1 mM phenylmethylsulfonyl fluoride (PMSF), 0.2 mg / mL lysozyme, 0.03% Triton X-100, and 0.02 mg / mL DNase I) and stored frozen in a -80 °C refrigerator.
[0386] The frozen cells are thawed and incubated at room temperature (RT, 25 °C) for 20 minutes, during which cell lysis occurs. 5 mM β-mercaptoethanol (BME) is added, and nucleic acids are removed by precipitation with 1% streptomycin sulfate. At 4 °C, the cell debris is removed by centrifugation at 10000×g for 10 minutes. For EcPflD, EcFsaB, and EcGldA, the supernatant is filtered through a 0.22 μm filter and loaded onto a 5 mL TALON Co 2+ column (Takara Bio USA, Inc.) pre-equilibrated with buffer A (20 mM Tris / HCl, pH 7.5, 200 mM KCl, and 5 mM BME), and the contaminating proteins are washed away with 10 column volumes of buffer A, and the protein is then eluted with 5 column volumes of buffer A containing 150 mM imidazole. The eluted protein (~20 mL) is dialyzed against 2 L of buffer A at 4 °C for 3 hours, concentrated and aliquoted, frozen in liquid nitrogen, and stored at -80 °C. For EcPflC, the supernatant is filtered and loaded onto a column packed with 10 mL of amylose resin (New England Biolabs, Massachusetts, U.S.A.), the contaminating proteins are washed away with 10 column volumes of buffer A, and the target protein is eluted with buffer A containing 10 mM maltose.
[0387] The purified proteins are detected by SDS-PAGE using a commercial gel (SurePAGE, Bis-Tris, 4 - 20%). The absorbance of the proteins at 280 nm is measured using a ultra-micro UV-visible spectrophotometer (Hangzhou Mio Instruments Co., Ltd.) to calculate their concentrations. [EcPflD (ε 280 = 74,720 M -1 cm -1 ), MBP-EcPflC (ε 280 = 88,810 M -1 cm -1 ), EcFsaB (ε 280 = 18,450 M-1 cm -1 ), EcGldA(ε 280 = 32,890 M -1 cm -1 )].
[0388] Expression and Purification of SdPflD and SdPflC for Biochemical Characterization
[0389] The protein expression and purification methods and procedures, SDS-PAGE detection method, and concentration determination method are the same as those for LpYbiW and LpYbiY. [SdPflD(ε 280 = 86,070 M -1 cm -1 ), MBP-SdPflC(ε 280 = 107,260 M -1 cm -1 )].
[0390] Reconstitution and Characterization of the [Fe-S] Cluster of the EcPflC Prosthetic Group
[0391] Sequence alignment showed that EcPflC contains only one [4Fe–4S] cluster in the radical SAM domain, and the theoretical maximum for each monomer is 4Fe and 4S. After degassing and deoxygenating the EcPflC protein solution with argon, it was transferred into a glove box. 100 mM Tris-HCl, pH 7.5, 10 mM DTT, 4 equivalents of ammonium ferrous sulfate, and sodium sulfide were added to the deoxygenated protein solution above, and it was incubated overnight in a metal bath (Dry Bath H2O3-100C; Coyote Bioscience, Beijing, China) at 4 °C. 4 equivalents of EDTA solution were added, and then it was repeatedly concentrated using a centrifugal filtration ultrafiltration tube (1.5 mL Ym-30 Amicon; Millipore) and diluted and exchanged using a buffer (20 mM Tris / HCl, pH 7.5 and 100 mM KCl).
[0392] Phenanthroline [3-(2-pyridyl)-5,6-diphenyl-1,2,4-triazine-p,p'-disulfonic acid monosodium salt] was used to determine the iron content of unconstructed and constructed EcPflC. Using an AAS iron standard, a standard curve of Fe in the range of 0–600 μM was established. The sulfur content in unconstructed and constructed EcPflC was determined by measuring the absorbance of methylene blue formed by reacting with N,N-dimethyl-p-phenylenediamine dihydrochloride (DPD). Using Na 2 S, a standard curve of S in the range of 0–600 μM was established.
[0393] The UV-Vis absorption spectrum of EcPflC in the range of 200 - 800 nm was measured using a NanoPhotometer NP80 Mobile (Germany). The unconstructed and reconstituted EcPflC was diluted to 10 μM using a buffer containing 20 mM Tris-HCl, pH 7.5, and 100 mM KCl, and transferred to a septum-sealed anaerobic cuvette for measurement. In the reconstituted EcPflC solution, 10 equivalents of titanium(III) citrate were added and incubated for 10 minutes to determine its reduced form.
[0394] LC-MS analysis of EcPflC-catalyzed SAM cleavage
[0395] A reaction system (500 μL) containing 20 mM Tris / HCl, pH 7.5, 100 mM KCl, 200 μM titanium(III) citrate, 20 μM reconstituted EcPflC, and 1 mM SAM was incubated overnight at room temperature in a glove box. Titanium(III) citrate was not added to the negative control. The reaction was quenched by adding formic acid (final concentration 5% v / v) and incubated in a boiling water bath for 1 minute to denature the protein. The precipitated protein was removed by centrifugation at 14000 × g for 15 minutes. The supernatant was filtered through a 0.22 μm PES membrane for LC-MS analysis. The method was as follows: 20 μL of the sample was loaded onto an Agilent 6420 Triple Quadrupole LC / MS instrument (Agilent Technologies) equipped with a C18 reversed-phase column, and the UV absorption was detected at 257 nm. The mobile phase system consisted of water (A) and acetonitrile (B), and a linear gradient elution from 0 - 16% B was carried out for 30 minutes at a flow rate of 0.5 mL / min. Commercial 5'-dA was used as a standard to verify the formation of the EcPflC-catalyzed SAM cleavage product by mass spectrometry.
[0396] Electron paramagnetic resonance (EPR) spectroscopy was used to detect the generation of EcPflD radicals
[0397] Characterization of the glycine radical of EcPflD by continuous-wave X-band electron paramagnetic resonance (EPR) spectroscopy. A reaction system (200 μL) containing 20 mM Tris / HCl, pH 7.5, 100 mM KCl, 100 μM citric peptide Ti(III), 1 mM SAM, 80 μM reconstituted EcPflC, and 40 μM EcPflD was incubated at room temperature for 15 minutes in a glove box. 10% glycerol was added and then loaded into an EPR tube (Wilmad Lab Glass, 734-LPV-7) with an outer diameter of 4 mm and a length of 8 inches. It was sealed with a rubber stopper, taken out of the glove box, and frozen using liquid nitrogen before EPR analysis. The experimental spectrum of the glycine radical was modeled by Bruker Xepr spin fitting to obtain the g-value, hyperfine coupling constant, and line width. The double integral of the simulated spectrum was used to measure the spin concentration. The EPR spectrum was obtained by superimposing 30 scans, and the test conditions were as follows: temperature, 90 K; center field, 3370.00 Gauss; range, 200 Gauss; microwave power, 10 μW; microwave frequency, 9.43 MHz; modulation amplitude, 0.5 mT; modulation frequency, 100 kHz; time constant, 20.48 ms; conversion time, 25 ms; scan time, 20 s; receive gain, 43 dB.
[0398] LC-MS analysis of EcPflD activity assay
[0399] A 200 μL reaction mixture containing 10 μM activated EcPflD, 0.1 mM titanium(III) citrate, and 10 mM 1,5-AM-6P was incubated at room temperature for 1 h in a glove box. Negative controls were prepared without 1,5-AM-6P, SAM, or activated EcPflD, respectively. 200 μL of acetonitrile was added to the reaction system to precipitate proteins, and the precipitate was removed by centrifugation. The supernatant was filtered through a 0.22 μm PES membrane for LC-MS analysis.
[0400] LC-MS analysis was performed using an Agilent 6420 Triple Quadrupole LC / MS instrument (Agilent Technologies). The drying gas temperature was maintained at 300 °C, the flow rate was 9 L / min, and the nebulizer pressure was 15 psi. LC-MS analysis was performed using a ZIC-HILIC column (5 mm, 150 × 4.6 mm; Merck). The HPLC conditions were as follows: mobile phase A was 90% 20 mM ammonium acetate and 10% acetonitrile, and mobile phase B was acetonitrile; gradient elution was performed from 90% B to 70% B in 10 minutes and from 70% B to 50% B in 20 minutes. The flow rate was set at 0.5 mL / min. The mass spectrometer was operated in the ESI negative ion mode.
[0401] LC-MS Analysis of SdPflD Activity
[0402] The LC-MS analysis experimental method of SdPflD of Streptococcus dysgalactiae subsp. Equisimilis species is the same as the LC-MS analysis method for EcPflD activity determination.
[0403] LC-MS Analysis of the Activity of EcFsaB Coupled with EcPflD
[0404] After incubating a reaction mixture (200 μL) containing 10 μM activated EcPflD, 0.1 mM titanium(III) citrate, and 10 mM 1,5-AM-6P at room temperature for 1 h in a glove box, the enzyme activity of EcFsaB coupled with EcPflD was determined. 10 μM EcFsaB was added to the above reaction system, and after reacting for another 1 h in the glove box, 50 μL of the reaction sample was mixed with 550 μL of 0.73 M sodium acetate (pH 5.0), and then mixed with 400 μL of freshly prepared 2,4-dinitrophenylhydrazine (DNPH) solution (20 mg dissolved in 50 mL of methanol), and then incubated at 50 °C for 1 h. The mixture was centrifuged at 13000×g for 5 min and filtered before LC–MS analysis. The positive control was prepared by treating 3-phosphoglyceraldehyde (5 mM, Sigema-Aldrich) and hydroxyacetone (2 mM, TCI) standards with sodium acetate (pH 5.0) and freshly prepared DNPH solution in the same way for 1 h.
[0405] LC–MS analysis was performed using 20 μL of the sample on an Agilent ZORBAX SB-C18 reverse-phase column (4.6×250 mm) in the ESI negative ion mode. The solvent system consisted of solvent C (deionized ultrapure water containing 0.1% formic acid) and D (chromatographic acetonitrile containing 0.1% formic acid). The liquid phase analysis was carried out according to the following procedure: eluting from 15% to 100% of D at a flow rate of 1.0 mL / min within 15 min, and the detection wavelength was set at 360 nm.
[0406] Spectrophotometric Determination of the Coupling of EcPflD, EcFsaB, and EcGldA
[0407] The reaction mixture containing 20 mM Tris / HCl, pH 7.5, 100 mM KCl, 10 mM 1,5-AM-6P, 40 nM activated EcPflD, 5 μM EcFsaB, 5 μM EcGldA, and 0.4 mM NADH was incubated at room temperature in a 1 cm Eppendorf cuvette in a glove box. The absorbance at 340 nm was monitored every 5 s using the cuvette mode of a ultra-micro UV-visible spectrophotometer (Hangzhou Mio Instruments Co., Ltd.) in the glove box. The negative control was prepared by omitting 1,5-AM-6P, SAM, or EcPflD.
[0408] LC-MS analysis of EcFsaB activity
[0409] The activity of EcFsaB catalyzing the aldol condensation reaction of hydroxyacetone and glyceraldehyde 3-phosphate was also determined: 200 μL of the reaction mixture containing 50 mM Tris / HCl, pH 8.0, 100 mM KCl, 5 mM glyceraldehyde 3-phosphate, 10 mM hydroxyacetone, and 10 μM EcFsaB was incubated at room temperature for 1 h. Glyceraldehyde 3-phosphate, hydroxyacetone, or EcFsaB was not added in the negative control. LC-MS analysis was performed using a ZIC-HILIC column with the same sample preparation method and elution conditions as described in the EcPflD activity assay.
[0410] Determination of Michaelis-Menten kinetic parameters of EcPflD
[0411] The reaction system containing 20 mM Tris / HCl, pH 7.5, 100 mM KCl, 40 nM activated EcPflD, and different substrate concentrations of 1,5-AM-6P, 2 μM EcFsaB, 2 μM EcGldA, and 0.4 mM NADH was carried out in a 1 cm Eppendorf cuvette using the cuvette mode of a ultra-micro UV-visible spectrophotometer (Hangzhou Mio Instruments Co., Ltd.) in the glove box. The decrease in A 340nm was monitored at 5 s intervals.
[0412] Construction of the SdPflD expression plasmid for crystallography study
[0413] The DNA fragment encoding PflD in Streptococcus dysgalactiae subsp. equisimilis (SdPflD, NCBI accession number: OCX05109.1) optimized for E. coli codons was synthesized by Beijing Tsingke Biotechnology Co., Ltd. and inserted into the SspI site of vector HT.
[0414] Expression and purification of SdPflD for crystallographic study
[0415] For crystallographic study of SdPflD, Escherichia coli BL21(DE3) carrying plasmid HT-SdPflD was cultured in 2 L of LB medium containing 50 μg / mL kanamycin. Cells were collected and lysed using the same method as for EcYbiW, and the supernatant of the cell lysate was purified using a 10 mL TALON Co 2+ column. The eluate was premixed with recombinant His 6 -tagged TEV protease (the molar ratio of TEV protease to SdPflD was approximately 1:10) and dialyzed overnight against 2 L of buffer A (20 mM Tris / HCl, pH 7.5, 200 mM KCl, and 5 mM BME) containing 5 mM BME. The dialyzed sample was loaded onto a 10 mL TALON Co 2+ column to retain TEV protease and His 6 -tag. The flow-through was collected and dialyzed against 2 L of buffer B (20 mM Tris / HCl, pH 7.5, 5 mM BME), and then loaded onto a 10 mL DEAE column using the same method as described above. The main peak containing SdPflD was concentrated and purified using a Superdex200 gel filtration column. The sample from the gel filtration column was concentrated to a final concentration of 9.9 mg / mL.
[0416] Crystallization, data collection, and structure determination of SdPflD
[0417] The initial screening of SdPflD crystals was performed by the sitting-drop method using an automated liquid handling robotic system (Gryphon, Art Robbins) in 96-well format. Screening was carried out at 291 K using various crystal screening kits from Hampton Research and Molecular Dimensions. After further optimization using the hanging-drop method in 24-well plates, crystals for single-crystal X-ray diffraction study were obtained. The optimal conditions for generating SdPflD block-shaped crystals were a 5.0 mg / mL SdPflD protein solution, 1.2 M sodium citrate, 0.1 M sodium HEPES, pH 8.0, and 10 mM 1,5-AM-6P. The block-shaped crystals were cryoprotected with 10% glycerol. Diffraction data were collected and processed at BL10U2 of the Shanghai Synchrotron Radiation Facility (SSRF) at a resolution of The crystal structure model created with the website PHYRE2 was subjected to molecular replacement on the PHENIX software. The structure was manually built using the Coot software according to the electron cloud orientation and further optimized in the PHENIX software, and then uploaded to the RCSB Protein Data Bank (accession code 8ID0). The appendix table contains the crystal structure data for data collection and final optimization (Table 1). All structure diagrams were generated using UCSF Chimera( Figure 4 B and 4D).
[0418] Identification of the active center of 1,5-anhydro-D-mannitol-6-phosphate isomerase
[0419] For the PDB data of the crystal of SdPflD complexed with 1,5-AM-6P obtained (resolution ), the UCSF Chimera software was used for display. Centered on the substrate 1,5-AM-6P, the amino acid residues within the range of the substrate center were selected for display. According to the hydrogen bond distance formed between the substrate and the amino acid residues, the key amino acid residues binding to the substrate in the active center of 1,5-anhydro-D-mannitol-6-phosphate isomerase were determined. Combining with the catalytic mechanism of glycine radical 1,2-lyase in the literature, the key amino acid residues in the active center of 1,5-anhydro-D-mannitol-6-phosphate isomerase were determined.
[0420] Isozyme identification of 1,5-anhydro-D-mannitol-6-phosphate isomerase
[0421] To identify the isozymes of 1,5-anhydro-D-mannitol-6-phosphate isomerase in the glycine radical enzyme (GRE) family, a sequence similarity network (SSN) of 25,347 unique sequences in the InterPro family IPR004184 was constructed using the web-based Enzyme Function Initiative Enzyme Similarity Tool (EFI-EST). The alignment score threshold was set to 250, the minimum sequence length was set to 650, and the 80% similarity representative node network (RepNode network) was displayed using Cytoscape v3.519. According to these set values, previously characterized GREs with different catalytic activities were divided into different clusters.
[0422] Sequences with 80% or more similarity are represented by a single node. The sequences are folded together to reduce the total number of nodes, making the less complex network easier to load in Cytoscape. For the clusters formed by PflD, a representative sequence is selected from each node according to different nodes. Based on the crystal structure of the complex formed by SdPflD and the substrate, the amino acid residues interacting with the substrate are used as conserved sites for multiple sequence alignment. Sequences containing these conserved sites simultaneously are retained. Further analysis is performed on the neighboring genes of these sequences, and sequences containing aldolase in the gene cluster are retained. Finally, representative sequences are selected.
[0423] Results, Analysis, and Discussion
[0424] There is a gene cluster involved in sugar metabolism in the Escherichia coli MG1655 genome. Through bioinformatics analysis of this gene cluster, the inventors of this application noticed that an unknown function GRE (PflD) is involved. In addition to PflD and the glycine radical enzyme activator (PflC) of the S-adenosylmethionine radical enzyme family, this gene cluster also contains a 1-deoxyfructose-6-phosphate aldolase (FsaB), a hydroxyacetone reductase (GldA), and there is also a complete phosphoenolpyruvate-dependent phosphotransferase system transport complex (PTS), which includes PtsA, FrwB, FrwC, and FrwD. The function of PTS is to transfer the phosphate group of phosphoenolpyruvate (PEP) to the sugar entering the cell through a series of sequential steps involving different components of PTS. PTS consists of cytoplasmic components and membrane-associated enzymes. The cytoplasmic components lack sugar specificity, and the membrane-associated enzymes are specific for at most a few sugars. This PTS transport complex may be involved in the uptake of hexoses and the phosphorylation of substrates. Aldolase FsaB can catalyze the formation of the corresponding 2-keto-hexose-6-phosphate from hydroxyacetone, 1,3-dihydroxyacetone, and glyceraldehyde 3-phosphate. GldA catalyzes the dehydrogenation of glycerol or propylene glycol to produce 1,3-dihydroxyacetone or hydroxyacetone. Based on this, the inventors of this application speculated that this GRE is involved in sugar metabolism, and its substrate may be a hexose phosphate. Combining the results of molecular docking, the inventors of this application speculated that the substrate of PflD is 1,5-anhydro-D-mannitol-6-phosphate (1,5-AM-6P), and a new radical-dependent glycolysis pathway was proposed. In this pathway, 1,5-AM-6P is catalyzed by PflD to break the C-O bond, generating 1-deoxy-F6P. This product is further cleaved by aldolase FsaB to produce hydroxyacetone and glyceraldehyde 3-phosphate. Hydroxyacetone is reduced by hydroxyacetone reductase GldA to produce 1,2-propanediol ( Figure 1 B).
[0425] To prove the conjecture, the inventors of the present application selected the PflD, PflC, FsaB, and GldA genes from Escherichia coli MG1655, and then carried out heterologous expression in Escherichia coli BL21(DE3) cells and characterized the activities of these proteins.
[0426] The inventors of the present application reconstructed the cofactor [Fe-S] 2+ cluster of the activating enzyme EcPflC and characterized it. Anaerobic reconstruction of the [4Fe-4S] cluster resulted in 2.15 ± 0.12 Fe and 2.30 ± 0.07 S per monomer (a radical SAM domain, the theoretical maximum of the [4Fe-4S] cluster is 4 Fe and 4 S) and a typical UV-visible spectrum of the [4Fe-4S] protein, with a molar extinction coefficient ε 410nm of 9.45 mM -1 cm -1 . The ε 410nm of each [4Fe-4S] cluster was approximately 15 mM -1 cm -1 , so the inventors of the present application estimated that each monomer contained approximately 0.63 [4Fe-4S], which was roughly consistent with the measured Fe and S contents ( Figure 8 A-8B). LC-MS detection results showed that, like other radical SAM enzymes, EcPflC catalyzed the cleavage of SAM in the presence of the reducing agent titanium(III) citrate to form 5'-deoxyadenosine ( Figure 8 C-8D). EPR spectroscopy showed that incubation of EcPflD, EcPflC, SAM, and Ti(III) formed radicals, and the radicals generated were quantified as 0.060 Gly· / dimer ( Figure 3 A).
[0427] To determine the activity of EcPflD, activated EcPflD was incubated with 1,5-AM-6P and analyzed by LC-MS. It was found that there was a new peak with m / z(-) = 243.0 in the full reaction group at t R = 18.40 min ( Figure 3 B-3D). In the activity experiment of EcFsaB catalyzing the aldol condensation reaction of hydroxyacetone and glyceraldehyde 3-phosphate, a new peak (m / z(-) = 243.0, t R = 18.40 min) was also generated in the full reaction group ( Figure 9 B-9D). The Michaelis-Menten kinetic parameters of EcPflD were also determined ( Figure 11 , k cat = 33.47 ± 0.79 s -1 / EcPflD, K M= 1.33 ± 0.12 mM). The reaction was carried out by coupling EcFsaB with EcPflD, and the production of the corresponding products hydroxyacetone and glyceraldehyde 3-phosphate was detected by LC-MS analysis ( Figure 3 E-3H). In the spectrophotometric determination coupled with EcPflD, EcFsaB and EcGldA, it was obvious that only in the full reaction group, A 340nm decreased, indicating that the substrate 1,5-AM-6P underwent C-O bond cleavage catalyzed by EcPflD to produce 1-deoxy-F6P, and the product was cleaved by EcFsaB to produce hydroxyacetone and glyceraldehyde 3-phosphate; hydroxyacetone was reduced by EcGldA to generate 1,2-propanediol ( Figure 3 I).
[0428] The PflD gene cluster in Streptococcus dysgalactiae subsp. Equisimilis is as Figure 19 shown in A. According to the LC-MS analysis results, it can be seen that in the full reaction group, there is a new peak with m / z(-) = 243.0 at t R = 18.40 min ( Figure 19 B) generated, and the mass spectrum corresponding to this new peak is Figure 19 C, and the mass spectrum corresponding to the substrate is Figure 19 D. The LC-MS results indicate that SdPflD has 1,5-anhydro-D-mannitol-6-phosphate isomerase activity.
[0429] To further study the catalytic mechanism of PflD, the inventors of this application determined the crystal structure of the complex of SdPflD with 1,5-AM-6P (resolution ). Each asymmetric unit of PflD contains one monomer. Each monomer exhibits the typical β / α barrel fold common to other GREs ( Figure 4 B), as well as a radical-like conformation with Gly· and Cys· loops. From this crystal structure, the inventors of this application can see that the S atom of the Cys· residue Cys431 is adjacent to the H atom at the C2 position of the substrate, with a distance of This is consistent with the catalytic mechanism involving "the C2 hydrogen atom is abstracted by Cys·". The 2-OH group of the substrate 1,5-AM-6P forms a hydrogen bond with Glu433; the phosphate group coordinates with Gln162, Ser277 and Arg323 of PflD; the 1-O atom forms hydrogen bonds with His169, Glu445, and the 3-OH forms a hydrogen bond with S278 ( Figure 4 D). Glu433 is involved in the deprotonation of the 2-OH of the substrate, which is consistent with the role of the base in the catalytic mechanism of GRE 1,2-elimination enzymes.
[0430] Based on the crystal structure of PflD, which is similar to other GRE 1,2-elimination enzymes, the inventors of the present application proposed the following PflD catalytic mechanism. Cys431· abstracts the H atom at the C2 position from the substrate 1,5-AM-6P, generating a substrate radical at the C2 position. Then, Glu433 deprotonates the 2-OH of the substrate, and the substrate radical translocates to the C1 position, followed by cleavage of the C-O bond to form a product radical. The product radical then abstracts the H atom that Cys431 abstracted from the substrate, generating the product 1-deoxy-F6P and regenerating Cys431·( Figure 4 F).
[0431] Based on the crystal structure of the complex formed by SdPflD and the substrate 1,5-anhydro-D-mannitol-6-phosphate, referring to the hydrogen bond distances formed by the substrate and amino acid residues, the key amino acid residues binding to the substrate in the active center of 1,5-anhydro-D-mannitol-6-phosphate isomerase were determined. Combining with the catalytic mechanism of glycine radical 1,2-lyase in the literature, the key amino acid residues in the active center of 1,5-anhydro-D-mannitol-6-phosphate isomerase were determined. They are the amino acid residues Q162, H169, S277, S278, R323, F331, P335, C431, E433, D445, Y628, V630, and G752 in SdPflD.
[0432] According to the SSN sequence analysis, the PflD cluster showed a total of 89 nodes and 953 consensus sequences. The inventors of the present application selected a representative sequence from each node. According to the crystal structure of SdPflD (NCBI accession number OCX05109.1), the amino acid residues interacting with the substrate (Q162, H169, S277, S278, R323, F331, P335, C431, E433, D445, Y628, V630, and G752) were used as conserved sites for multiple sequence alignment. Sequences containing these conserved sites simultaneously were retained, and a total of 77 isoenzyme sequences were screened out. Further analysis was performed on the neighboring genes of these 77 sequences, and sequences containing aldolase FsaB in the gene cluster were retained. Finally, a total of 47 representative sequences were listed( Figure 14 and Figure 16 ).
[0433] Example 3. Experiments on Escherichia coli Utilizing 1,5-Anhydroglucitol and 1,5-Anhydro-D-mannitol
[0434] Gene Knockout of Escherichia coli MG1655
[0435] Using the CRISPR-assisted homologous recombination strategy, ybiW and pflD in Escherichia coli MG1655 were knocked out separately. The inventors of this application designed primer pairs 7F / 7R and 8F / 8R to amplify the upstream and downstream sequences of ybiW, 500 bp at the 5' end and 504 bp at the 3' end, to generate fragments 1 and 2. Fragments 1 and 2 were assembled by PCR using primers 7F and 8R to generate fragment 3. Using the pRed_Cas9_recA plasmid as a template, fragments 4 and 5 were obtained by PCR amplification using primer pairs 9F / 9R and 10F / 10R. Fragments 3, 4, and 5 were subjected to Gibson assembly to generate the recombinant pRed_Cas9_recA_ΔybiW plasmid, which contains the guide RNA sequence "GCCTGCCAGAAAGTCTGCGG" (SEQ ID NO:187), aiming to introduce Cas9-catalyzed cleavage near the homologous recombination site to increase the rate of the desired homologous recombination.
[0436] The construction method of the recombinant plasmid pRed_Cas9_recA_ΔpflD is similar to that of pRed_Cas9_recA_ΔybiW. Primer pairs 11F / 11R and 12F / 12R were used to amplify the upstream (500 bp) and downstream (505 bp) sequences of pflD to generate fragments 6 and 7. Similarly, using fragments 6 and 7 as templates and 11F and 12R as primers, fragment 8 was generated. Using primer pairs 9F / 13R and 13F / 10R, fragments 9 and 10 were amplified by PCR using pRed_Cas9_recA as a template. The pRed_Cas9_recA_ΔpflD containing the guide RNA sequence "AAATACCAGAACCCGCGCGG" (SEQ ID NO:188) was constructed by Gibson assembly using fragments 8, 9, and 10. DNA sequencing was performed using primers 14F, 14R, and 15F to confirm the recombinant plasmids pRed_Cas 9_recA_ΔybiW and pRed_Casa9_recA_ΔpflD.
[0437] To obtain the Escherichia coli MG1655_ΔybiW and Escherichia coli MG16.55_ΔpflD strains, pRed_Cas9_recA_ΔybiW and pRed_Cas9_recA_ΔpflD were transformed into competent cells of Escherichia coli MG1655 strain by electroporation, respectively. Positive transformants were selected on LB agar plates containing 50 μg / mL kanamycin in a 30 °C incubator. Single colonies were cultured in 5 mL of LB culture containing 50 mg / L kanamycin and 2 g / L arabinose at 30 °C for 24 hours. The cells were harvested and spread on LB agar plates containing 50 g / L kanamycin and 2 g / L arabinose at 30 °C. Single colonies were picked and streaked on LB agar plates and cultured at 37 °C to eliminate the recombinant plasmid. Colony PCR verification was performed using primers 16F / 16R for ΔybiW and primers 17F / 17R for ΔpflD, and a DNA fragment of approximately 1500 bp was amplified in theory. Agarose gel electrophoresis showed successful genomic knockout, and this result was further confirmed by DNA sequencing using the same primer pairs.
[0438] Anaerobic growth of Escherichia coli strains on 1,5-AG / 1,5-AM as the sole carbon source
[0439] Single colonies of Escherichia coli MG1655 WT, ΔybiW, and ΔpflD strains freshly grown on LB agar plates were inoculated into 5 mL of LB medium and cultured in a shaker at 37 °C for 4 hours. The cells in 100 μL of the culture were centrifuged and transferred to an anaerobic bottle containing 5 mL of anaerobic LB medium and cultured at 37 °C for 6 hours. The cells in 100 μL of the culture were collected by centrifugation and transferred to an anaerobic vial containing 5 mL of anaerobic M9 medium and cultured at 37 °C for 3 days. 1 mL of cells was harvested, washed three times with anaerobic M9 medium without glucose, and resuspended in this medium. 100 μL of the cell suspension was transferred to anaerobic bottles, each containing 5 mL of M9 medium without glucose or the same medium supplemented with 20 mg of sugar (glucose, 1,5-AG, or 1,5-AM). Then the anaerobic bottles were placed in a 37 °C incubator, photographed after 7 days, and the cells were collected for SDS-PAGE gel analysis.
[0440] Identification of proteins by SDS / PAGE and mass spectrometry
[0441] Centrifuge to harvest the cells, lyse the cells by boiling in Laemmli loading buffer, and analyze on a 10% SDS / PAGE gel. Manually excise the prominent protein bands induced in the cells cultured with glucose, 1,5-anhydroglucitol, and 1,5-anhydromannitol. After in-gel digestion and extraction, analyze the peptide mixture by a Fusion Lumos mass spectrometer coupled with an Easy nLC 1200 system (Thermo Fisher Scientific). Use the internal Proteome Discoverer (version 2.2) search algorithm to search the MS / MS spectra of each LC-MS / MS run against the Escherichia coli protein database (released on April 1, 2021), which contains 15,862 sequence entries from UniProt. Perform protein identification based on Sequest HT.
[0442] GC analysis of the fermentation broth
[0443] Culture wild-type Escherichia coli MG1655 in different carbon sources at 37 °C for 7 days, and remove the cells by centrifugation. Pipette 200 μL of the fermentation broth, add 800 μL of chromatographically pure anhydrous ethanol, vortex to mix well, centrifuge to remove the insoluble precipitate, and then filter with a 0.45 μm organic filter membrane. Analyze the obtained filtrate by gas chromatography. Dissolve the (R)-1,2-propanediol commercial standard in chromatographically pure anhydrous ethanol.
[0444] Perform gas chromatography (GC) analysis using an Agilent 6820 type G1176A gas chromatograph (Agilent Technologies). The chromatographic column used for GC analysis is an AT TM -Aquawax-DA (Alltech) gas chromatographic column (30 m × 0.53 mm, 1.0 μm). The GC conditions are as follows: The carrier gas is high-purity nitrogen, and the column flow rate is a constant flow of 1.0 mL / min; the inlet temperature is 230 °C, and the detector temperature is 240 °C; the hydrogen flow rate is 20 mL / min; the air flow rate is 200 mL / min. Use a programmed temperature rise: The initial column temperature is 60 °C, hold for 2 minutes, increase the temperature at a rate of 20 °C / min to 80 °C, hold for 3 minutes, increase the temperature at a rate of 20 °C / min to 160 °C, hold for 2 minutes; then increase the temperature at a rate of 15 °C / min to 220 °C, and hold for 10 minutes.
[0445] Results, analysis, and discussion
[0446] Escherichia coli MG1655_wild type and Escherichia coli MG1655_ΔybiW strain were anaerobically cultured using M9 medium with 1,5-AG as the sole carbon source; the positive control used glucose as the sole carbon source, and the negative control did not add any carbon source. The Escherichia coli MG1655_wild type strain could grow when glucose and 1,5-AG were used as carbon sources respectively; while the Escherichia coli MG1655_ΔybiW strain could only grow using glucose as the sole carbon source( Figure 5 A). Further SDS-PAGE analysis results showed that when the Escherichia coli MG1655_wild type strain used 1,5-AG as the sole carbon source, the corresponding proteins in the YbiW-dependent pathway were induced to express. Combining with proteomic analysis, the induced bands were respectively identified. The two bands of ~95 kDa both contained PtsA and YbiW; the band of ~42 kDa was identified as GldA, and the band of ~27 kDa contained FsaB and FasA( Figure 5 B).
[0447] Similarly, using M9 medium with 1,5-AM as the sole carbon source, Escherichia coli MG1655_wild type and Escherichia coli MG1655_ΔpflD strain were anaerobically cultured; the positive control used glucose as the sole carbon source, and the negative control did not add any carbon source. The Escherichia coli MG1655_wild type strain could grow when glucose and 1,5-AM were used as carbon sources respectively; while the Escherichia coli MG1655_ΔpflD strain could only grow using glucose as the sole carbon source( Figure 5 C). Further SDS-PAGE analysis results showed that when the Escherichia coli MG1655_wild type strain used 1,5-AM as the sole carbon source, the corresponding proteins in the PflD-dependent pathway were induced to express. Combining with proteomic analysis, the induced bands were respectively identified. The band of ~95 kDa contained PtsA; the band of ~90 kDa contained PflD; the band of ~42 kDa was identified as GldA, and the band of ~27 kDa contained FsaB( Figure 5 D). GC result analysis showed that when 1,5-AG and 1,5-AM were used as the sole carbon sources respectively, Escherichia coli MG1655 could produce 1,2-propanediol under anaerobic conditions, and its retention time was 8.85 min( Figure 13 ).
[0448] There are YbiW and PflD gene clusters in the Escherichia coli MG1655 genome( Figure 5E). Combining the growth results of the strains on different carbon sources, SDS-PAGE analysis, and proteomic analysis results, the inventors of the present application believe that 1,5-AG can induce the expression of the YbiW and PflD-related gene clusters in Escherichia coli MG1655. 1,5-AG enters the cell using the PTS transport system in the PflD gene cluster, induces the high expression of FsaB and GldA in the PflD gene cluster, and simultaneously induces the high expression of YbiW and FsaA in the YbiW gene cluster. 1,5-AG is transferred into the cell by the PTS transport system, and the C-6 position of the substrate is phosphorylated to produce 1,5-AG-6P; under the catalysis of YbiW, the C-O bond is broken to produce 1-deoxy-F6P; this product is cleaved by FsaB and FsaA to produce hydroxyacetone and glyceraldehyde 3-phosphate; hydroxyacetone is reduced by EcGldA to generate 1,2-propanediol.
[0449] However, 1,5-AM can only induce the high expression of the PflD-related pathway proteins. The substrate is transferred into the cell by the PTS transport system in the gene cluster, and the C-6 position is phosphorylated to produce 1,5-AM-6P. Under the catalysis of PflD, the C-O bond is broken to produce 1-deoxy-F6P; this product is cleaved by FsaB to produce hydroxyacetone and glyceraldehyde 3-phosphate; hydroxyacetone is reduced by GldA to generate 1,2-propanediol ( Figure 5 F).
[0450] Example 4 Experiment on the production of 1,2-propanediol from starch by 1,5-AG and 1,5-AM respectively
[0451] Materials and Methods
[0452] Experimental Materials
[0453] Tryptone and yeast extract used to prepare LB medium were purchased from Oxoid Limited (Hampshire, UK). Ultra-pure deionized water from Millipore Direct-Q was used. TALON resin was purchased from Clontech Laboratories Inc (California, USA). 1,5-anhydroglucitol (1,5-AG) was purchased from Shanghai Yuanye Bio-Technology Co., Ltd., and 1,5-anhydromannitol (1,5-AM) was chemically synthesized by Tianjin SinoScien Chemical Technology Co., Ltd. Soluble starch was purchased from Tianjin Yuanli Chemical Industry Co., Ltd. Maltose was purchased from Beijing Solarbio Science & Technology Co., Ltd. Direct-Q oligonucleotide primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd. All protein purification chromatography experiments were carried out on a pure FPLC system (GE Healthcare, USA). Anaerobic experiments were carried out in an N2 Performed in a protected Lab2000 glove box (Etelux) (oxygen concentration less than 5 ppm).
[0454] Gene synthesis and cloning
[0455] A DNA fragment of the Gracilariopsis lemaneiformis gene encoding α-1,4-glucan lyase (α-1,4-glucan lyase, uniprot accession number: Q9STC1), the gene encoding Sus scrofa 1,5-anhydro-D-fructose reductase (Gafr, uniprot accession number: P82125), and the gene encoding Ensifer adhaerens 1,5-anhydro-D-fructose reductase (Mafr, uniport accession number: Q2I8V6) codon-optimized for Escherichia coli were synthesized by Beijing Tsingke Biotechnology Co., Ltd. and inserted into the SspI site of the HT plasmid (optimized pET28 vector). To improve the solubility of the protein, the α-1,4-glucan lyase gene was recloned using the 20F / 20R and 21F / 21R primer pairs (Table 7), with the plasmid HT-α-1,4-glucan lyase as a template, resulting in two fragments, and a recombinant plasmid α-1,4-glucan lyase-His was generated by Gibson assembly 6 with a 6×His tag at its C-terminus. Mafr was recloned using the 22F / 22R primer pair (Table 7) and inserted into the SspI site of the HMT vector. In addition, a DNA fragment of the FDH gene codon-optimized for Escherichia coli from Pseudomonas sp. 101 (FDH) was also synthesized and cloned into the NcoI site of the expression vector pET28a vector
[0456] The resulting HT plasmid contains a His 6 tag and a tobacco etch virus (TEV) protease cleavage site, and HMT contains an N-terminal His 6 tag, maltose-binding protein (MBP), and a TEV protease cleavage site; the pET28a plasmid contains an N-terminal His6 tag, a thrombin site, followed by the target gene
[0457] The gene fragment of the sugar kinase TlGlkA (Uniprot number: Q7M537) was synthesized by Beijing Tsingke Biotechnology Co., Ltd. and inserted into the SspI site of the HT plasmid (optimized pET28 vector) to express a protein with an N-terminal His6 tag
[0458] Expression and purification of recombinant proteins
[0459] The α-1,4-glucan lyase-His6 , HT-Gafr, HMT-Mafr, and pET28a-FDH plasmids were transformed into Escherichia coli BL21(DE3) cells to express the corresponding proteins. Positive clones were screened using LB agar plates containing 50 μg / mL kanamycin. The cells were cultured overnight in 4 mL of LB medium and then transferred to fresh LB medium (usually 1 L in a 2.6 L flask) and grown in an orbital shaker incubator at 37 °C and 220 rpm. When the OD 600 reached approximately 0.8, the temperature was lowered to 18 °C, and isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to a final concentration of 0.2 mM to induce the production of the target protein. After 16 - 20 hours, the cells were collected by centrifugation (8000×g, 10 minutes at 4 °C). The collected cells were resuspended in 40 mL of lysis buffer (50 mM Tris / HCl, pH 8.0, 100 mM KCl, 1 mM phenylmethylsulfonyl fluoride (PMSF), 0.2 mg / mL lysozyme, 0.03% Triton X-100, and 0.02 mg / mL DNase I) and stored frozen in a -80 °C refrigerator.
[0460] The frozen cells were thawed and incubated at room temperature (RT, 25 °C) for 20 minutes, during which cell lysis occurred. 5 mM β-mercaptoethanol (BME) was added, and nucleic acids were removed by precipitation with 1% streptomycin sulfate. The cell debris was removed by centrifugation at 10000×g for 10 minutes at 4 °C. The supernatant was filtered through a 0.22 μm filter and loaded onto a 5 mL TALON Co2+ column (Takara Bio USA, Inc.) pre-equilibrated with buffer A (20 mM Tris / HCl, pH 7.5, 200 mM KCl, and 5 mM BME). The column was washed with 10 column volumes of buffer A to remove contaminating proteins, and the protein was eluted with 5 column volumes of buffer A containing 150 mM imidazole. The eluted protein (~20 mL) was dialyzed against 2 L of buffer B (20 mM PBS buffer, pH 7.2, 200 mM KCl, and 5 mM BME) for 3 hours at 4 °C, concentrated, aliquoted, frozen in liquid nitrogen, and stored at -80 °C.
[0461] The purified proteins were detected by SDS-PAGE using a commercial gel (SurePAGE, Bis-Tris, 4 - 20%). The absorbance of the proteins at 280 nm was measured using an ultra-micro UV-visible spectrophotometer (Hangzhou Mio Instruments Co., Ltd.) to calculate their concentrations. [α-1,4-glucan lyase (ε 280 = 218,420 M -1 cm -1 ), Gafr (ε 280 = 36,900 M-1 cm -1 ), MBP-Mafr(ε 280 = 95,800 M -1 cm -1 ), and FDH(ε 280 = 58,330 M -1 cm -1 )]
[0462] The expression and purification methods and procedures of glucokinase TlGlkA, the SDS-PAGE detection method, and the concentration determination method are the same as those of LpYbiW and LpYbiY. [TlGlkA(ε 280 = 51,800 M -1 cm -1 )]. The results are as Figure 26 shown.
[0463] LC-MS analysis for the determination of α-1,4-glucan lyase activity
[0464] Incubate 200 μL of the reaction mixture containing 50 mM PBS buffer (pH 7.2), 100 mM KCl, 10 mM maltose / 10 mg / ml soluble starch, and 5 μM α-1,4-glucan lyase at RT for 2 hours. The negative controls do not add the substrate (maltose / soluble starch) or α-1,4-glucan lyase, respectively. Add 100 μL of acetonitrile to precipitate the protein in the reaction system, remove the precipitate by centrifugation, filter the supernatant using a 0.22 μm PES membrane, and perform LC-MS analysis.
[0465] Perform LC-MS analysis using an Agilent 6420 Triple Quadrupole LC / MS instrument (Agilent Technologies). The dry gas temperature is maintained at 300 °C, the flow rate is 9 L / min, and the nebulizer pressure is 15 psi. Perform LC-MS analysis using a ZIC-HILIC column (5 mm, 150 × 4.6 mm; Merck). The HPLC conditions are as follows: mobile phase A is 90% 20 mM ammonium acetate and 10% acetonitrile, mobile phase B is acetonitrile; perform gradient elution from 90% B to 70% B in 10 minutes and from 70% B to 50% B in 20 minutes. The flow rate is set at 0.5 mL / min. The mass spectrometer operates in the ESI positive ion mode.
[0466] LC-MS analysis for the determination of Gafr, Mafr, and FDH activities
[0467] For the activity detection of Gafr, a 200 μL reaction mixture containing 50 mM PBS buffer (pH 7.2), 100 mM KCl, 10 mM maltose / 10 mg / mL soluble starch, 5 μM α-1,4-glucan lyase, 5 μM Gafr, 1 mM NADPH, 5 μM FDH, and 20 mM formate was incubated at RT for 2 h. Negative controls were prepared by omitting the substrate (maltose / soluble starch), α-1,4-glucan lyase, or FDH, respectively. The product standard was 1,5-anhydroglucitol (5 mM). Proteins were precipitated with 100 μL of acetonitrile and removed by centrifugation. Before LC-MS analysis, the supernatant was filtered through a 0.22 μm nylon membrane filter.
[0468] For the activity detection of Mafr, a 200 μL reaction mixture containing 50 mM PBS buffer (pH 7.2), 100 mM KCl, 10 mM maltose / 10 mg / mL soluble starch, 5 μM α-1,4-glucan lyase, 5 μM Mafr, 1 mM NADPH, 5 μM FDH, and 20 mM formate was incubated at RT for 2 h. Negative controls were prepared by omitting the substrate (maltose / soluble starch), α-1,4-glucan lyase, or FDH, respectively. The product standard was 1,5-anhydromannitol (5 mM). Proteins were precipitated with 100 μL of acetonitrile and removed by centrifugation. Before LC-MS analysis, the supernatant was filtered through a 0.22 μm nylon membrane filter. The LC-MS detection method was exactly the same as that for the LC-MS analysis of α-1,4-glucan lyase activity.
[0469] LC-MS analysis of TlGlkA activity assay
[0470] A 200 μL reaction mixture containing 50 mM Tris (pH = 7.5), 100 mM KCl, 2 mM MgCl 2 , 5 mM ADP, 20 mM 1,5-AG, 10 μM TlGlkA was incubated at room temperature for 1 h. Negative controls were prepared by omitting 1,5-AG or TlGlkA, respectively. 200 μL of acetonitrile was added to the reaction system to precipitate proteins, and the precipitate was removed by centrifugation. The supernatant was filtered through a 0.22 μm PES membrane for LC-MS analysis. The experimental method for the LC-MS analysis of TlGlkA activity assay was the same as that for the LC-MS analysis of LpYbiW activity assay, and the results were as Figure 26 shown.
[0471] Activity assay of α-1,4-glucan lyase, Gafr, Mafr, FDH in M9 medium
[0472] The purified α-1,4-glucan lyase, Gafr, Mafr, and FDH protein solutions were degassed with argon to remove oxygen and placed in a glove box. 1 g of soluble starch was dissolved in 100 mL of anaerobic M9 medium without glucose to obtain "starch M9 medium". The first 200 μL reaction mixture contained 100 μL of "starch M9 medium" and 5 μM α-1,4-glucan lyase. The second 200 μL reaction mixture contained 100 μL of "starch M9 medium", 5 μM α-1,4-glucan lyase, 5 μM Gafr, and 1 mM NADPH. The third reaction system was composed of adding 5 μM FDH and 20 mM formate to the second one. The fourth (fifth) reaction mixture was similar to the second (third) reaction mixture, except that it contained 5 μM Mafr instead of Gafr. Before LC-MS analysis, these five reaction mixtures were incubated at RT for 2 hours, and the LC-MS measurement method was exactly the same as that described for the α-1,4-glucan lyase activity assay. The "starch M9 medium" was also treated in the same way and subjected to LC-MS analysis.
[0473] E. coli MG1655_WT grew anaerobically using soluble starch as the sole carbon source.
[0474] A single colony of the E. coli MG1655 WT strain freshly grown on an LB agar plate was inoculated into 5 mL of LB medium and cultured in a shaker at 37 °C for 4 hours. 100 μL of the cells in the culture were transferred to an anaerobic bottle containing 5 mL of anaerobic LB medium and cultured at 37 °C for 6 hours. 5 mL of the cells were harvested, washed 3 times with anaerobic M9 medium without glucose, and resuspended in 2 mL of anaerobic M9 medium without glucose.
[0475] Anaerobic vials 1 and 2 contained 5 mL of anaerobic "starch M9 medium", 3 contained 5 mL of M9 culture solution without glucose, and 4 contained 5 mL of M9 culture supplemented with 20 mg of glucose. An oxygen-depleted α-1,4-glucan lyase protein solution with a final concentration of 0.3 μM was added to 5 mL of anaerobic "starch M9 medium" to obtain vial 5. Protein solutions of oxygen-depleted α-1,4-glucan lyase, Gafr, and FDH were added to 5 mL of anaerobic starch M9 medium, and the final concentrations of the enzymes were 0.3, 1.8, and 0.6 μM, respectively. In addition, NADPH with a final concentration of 0.2 mM and sodium formate with a concentration of 2 mM were added to obtain vial 6. Vial 7 was prepared in the same manner as vial 6, except that it contained 1.8 μM MBP instead of Gafr. After incubation at room temperature for 4 hours in a glove box, 100 μL of cell suspension was transferred to these anaerobic vials. Then, these anaerobic vials were placed in an incubator at 37 °C for 3 - 7 days, after which they were photographed, the cells were collected for SDS-PAGE gel analysis, and the supernatant was extracted with ethanol for GC analysis.
[0476] Identification of proteins by SDS / PAGE and mass spectrometry
[0477] Cells were harvested by centrifugation, lysed by boiling in Laemmli loading buffer, and analyzed on a 10% SDS / PAGE gel. Distinct protein bands induced in cells co-cultured with α-1,4-glucan lyase, Gafr, FDH, and Escherichia coli MG1655_WT and in cells co-cultured with α-1,4-glucan lyase, Mafr, FDH, and Escherichia coli MG1655_WT were excised manually. After in-gel digestion and extraction, the peptide mixture was analyzed by a Fusion Lumos mass spectrometer coupled with an Easy nLC 1200 system (Thermo Fisher Scientific). The MS / MS spectra of each LC-MS / MS run were searched against the Escherichia coli protein database (released on April 1, 2021) using the internal Proteome Discoverer (version 2.2) search algorithm, which contains 15,862 sequence entries from UniProt. Protein identification was based on Sequest HT.
[0478] GC analysis of the fermentation broth
[0479] The above 7 groups of anaerobic vials were cultured at 37 °C for 7 days, and the cells were removed by centrifugation. 200 μL of the fermentation broth was aspirated, 800 μL of chromatographically pure anhydrous ethanol was added, vortexed thoroughly, the insoluble precipitate was removed by centrifugation, and then the filtrate was filtered through a 0.45 μm organic filter membrane. The resulting filtrate was analyzed by gas chromatography. The (R)-1,2-propanediol commercial standard was dissolved in chromatographically pure anhydrous ethanol.
[0480] Gas chromatography (GC) analysis was performed using an Agilent 6820 type G1176A gas chromatograph (Agilent Technologies). The chromatographic column used for GC analysis was an AT TM -Aquawax-DA (Alltech) gas chromatography column (30 m × 0.53 mm, 1.0 μm). The GC conditions were as follows: The carrier gas was high-purity nitrogen, and the column flow rate was a constant flow of 1.0 mL / min; the injection port temperature was 230 °C, and the detector temperature was 240 °C; the hydrogen flow rate was 20 mL / min; the air flow rate was 200 mL / min. Programmed temperature rise was adopted: the initial column temperature was 60 °C, held for 2 minutes, heated at a rate of 20 °C / min to 80 °C, held for 3 minutes, heated at a rate of 20 °C / min to 160 °C, held for 2 minutes; then heated at a rate of 15 °C / min to 220 °C, held for 10 minutes.
[0481] Results, Analysis and Discussion
[0482] The inventors discovered two new glycolytic pathways involving glycine radical enzymes (GREs) for the production of 1,2-propanediol from 1,5-AG and from 1,5-AM. In this example, the inventors studied the complete pathway for the production of 1,2-propanediol from starch via 1,5-AG or 1,5-AM. The inventors selected the α-1,4-glucan lyase from the red alga Gracilariopsis lemaneiformis (α-1,4-glucan lyase, uniprot accession number: Q9STC1), the gene of 1,5-anhydro-D-fructose reductase from Sus scrofa (Gafr, uniprot accession number: P82125), the 1,5-anhydro-D-fructose reductase from Ensifer adhaerens (Mafr, uniport accession number: Q2I8V6), and the formate dehydrogenase (FDH) from Pseudomonas 101. These genes were optimized for E. coli codons and synthesized. Heterologous expression was carried out using the E. coli system to obtain their soluble proteins ( Figure 20 ).
[0483] Through in vitro enzyme activity experiments, the inventors performed activity assays on the purified proteins. Through LC-MS analysis, using soluble starch and maltose as substrates respectively, the α-1,4-glucan lyase could catalyze and produce 1,5-anhydrofructose (1,5-AF) ( Figure 21 A, 21B; Figure 22 A, 22B); adding Gafr and NADPH to this reaction system, it was found that 1,5-anhydroglucitol (1,5-AG) was produced; then adding FDH and sodium formate, it was found that the yield of 1,5-AG increased significantly (Figure 21 C, 21D; Figure 22 C). These experiments demonstrated the in vitro activity of these purified enzymes, and through the catalysis of these enzymes, the production of 1,5-AG from starch could be achieved.
[0484] When Mafr and NADPH were added to the reaction system of α-1,4-glucan lyase with soluble starch and maltose as substrates respectively, the inventors found the production of 1,5-anhydromannitol (1,5-AM); when FDH and sodium formate were further added, it was found that the yield of 1,5-AM increased significantly ( Figure 21 E, 21F; Figure 22 D). These experiments demonstrated the in vitro activity of these purified enzymes, and through the catalysis of these enzymes, the production of 1,5-AM from starch could be achieved.
[0485] The inventors expected to achieve the production of 1,2-propanediol from starch through the co-culture of in vitro enzymes and bacteria. Using M9 medium with soluble starch as the sole carbon source, wild-type Escherichia coli MG1655 was anaerobically cultured by adding different enzymes. First, the activity of the enzymes in the medium was tested. When α-1,4-glucan lyase was added to the "starch M9 medium", and then Gafr and NADPH were added, the production of the product 1,5-AG was detected. When FDH and sodium formate were further added to the medium, it could be seen that the yield of 1,5-AG in the medium further increased ( Figure 23 A, 23C). When α-1,4-glucan lyase was added to the "starch M9 medium", and then Mafr and NADPH were added, the production of the product 1,5-AM was detected. When FDH and sodium formate were further added to the medium, it could be seen that the yield of 1,5-AM in the medium further increased ( Figure 23 B, 23D).
[0486] Through the co-culture experiment of enzymes and cells, it could be seen that Escherichia coli MG1655 could not use starch as the sole carbon source for growth; when α-1,4-glucan lyase was added to the "starch M9 medium", there was still no obvious growth of Escherichia coli MG1655, indicating that it could not use 1,5-AF for growth. However, when α-1,4-glucan lyase, Gafr, FDH, NADPH and sodium formate were added to the "starch M9 medium", obvious growth of Escherichia coli MG1655 was visible; when α-1,4-glucan lyase, MBP-Mafr, FDH, NADPH and sodium formate were added to the "starch M9 medium", obvious growth of Escherichia coli MG1655 was visible ( Figure 24 A).
[0487] Cells from different experimental groups were collected and analyzed by SDS-PAGE. The inventors of the present application could observe that when α-1,4-glucan lyase, Gafr, FDH, NADPH, and sodium formate were added to the culture medium, E. coli MG1655 cells were induced to produce bands at ~95 kDa, ~42 kDa, and ~27 kDa. These band sizes were consistent with the experimental results when 1,5-AG was used as the sole carbon source. When α-1,4-glucan lyase, MBP-Mafr, FDH, NADPH, and sodium formate were added to the culture medium and M9 medium was used, E. coli cells were induced to produce bands at ~42 kDa and ~27 kDa. These band sizes were consistent with the experimental results when 1,5-AM was used as the sole carbon source; however, due to the presence of a large amount of MBP-Mafr in the culture medium, no obvious band at ~95 kDa was observed. Figure 24 B).
[0488] By performing GC analysis on the fermentation broth, the inventors of the present application could observe that the co-culture of α-1,4-glucan lyase, Gafr, and FDH with cells could produce 1,2-propanediol; similarly, the co-culture of α-1,4-glucan lyase, MBP-Mafr, and FDH with cells could also produce 1,2-propanediol. Figure 24 C). The YbiW and PflD gene clusters exist in the E. coli MG1655 genome. Figure 25 A). Combining the growth results of the E. coli MG1655 strain co-cultured with different enzymes in "starch M9 medium", SDS-PAGE analysis, and the GC results of the fermentation broth, the inventors found that through the transformation of the in vitro enzymes α-1,4-glucan lyase, Gafr, and FDH, E. coli MG1655 could produce 1,2-propanediol from starch via 1,5-AG. Figure 25 B). Similarly, through the in vitro transformation of α-1,4-glucan lyase, MBP-Mafr, and FDH, E. coli MG1655 could also produce 1,2-propanediol from starch via 1,5-AM. Figure 25 C).
[0489] Table 1. Data collection and refinement statistics for EcYbiW and SdPflD crystals
[0490]
[0491]
[0492] Note: Statistics for the highest-resolution shell are shown in parentheses.
[0493] Table 2. Accession numbers, strain sources, and amino acid sequence numbers of 1,5-anhydroglucitol-6-phosphate isomerase isozymes
[0494]
[0495]
[0496]
[0497]
[0498]
[0499] Table 3. Primers for plasmid construction
[0500]
[0501]
[0502] Note: * represents the genome of Escherichia coli MG1655
[0503] Table 4. Accession numbers, strain sources, and amino acid sequence numbers of 47 1,5-anhydro-D-mannitol-6-phosphate isomerase isozymes
[0504]
[0505]
[0506]
[0507] Table 5. Primers for constructing Escherichia coli ΔybiW and ΔpflD strains
[0508]
[0509]
[0510] Note: represents the genome of Escherichia coli MG1655 WT; # represents the genome of ΔybiW; * represents the genome of ΔPflD.
[0511] Table 6. Primers for plasmid construction
[0512]
[0513] Note: * represents the genome of Escherichia coli MG1655
[0514] Table 7 Primers for plasmid construction
[0515]
[0516] Exemplary embodiments of the various inventions of the present application have been described above. However, without departing from the essence and scope of the present application, those skilled in the art can modify or improve the exemplary embodiments described in the present application, and the resulting variant embodiments or equivalent embodiments also fall within the scope of the present application.
Claims
1. A method for producing 1,2 - propanediol, which comprises: a) reacting a mixture I containing an α - 1,4 - glucan lyase, 1,5 - anhydro - D - fructose reductase, and reduced nicotinamide adenine dinucleotide (NADH) or reduced nicotinamide adenine dinucleotide phosphate (NADPH) with a substrate containing an α - 1,4 - glycosidic bond; or reacting a culture broth of cells capable of expressing and secreting an α - 1,4 - glucan lyase and / or 1,5 - anhydro - D - fructose reductase with NADH or NADPH and a substrate containing an α - 1,4 - glycosidic bond; b) reacting the reaction product obtained in step a) with a mixture II containing a glucokinase, 1,5 - anhydro - sugar - 6 - phosphate isomerase, radical enzyme activating enzyme, aldolase, and hydroxyacetone reductase, or co - culturing with cells capable of expressing 1,5 - anhydro - sugar - 6 - phosphate isomerase, radical enzyme activating enzyme, aldolase, hydroxyacetone reductase, and a transport complex to obtain 1,2 - propanediol, wherein the transport complex is preferably the phosphoenolpyruvate - phosphotransferase system.
2. A method for producing 1,2 - propanediol, which comprises: reacting 1,5 - anhydro - sugar with a mixture II containing a glucokinase, 1,5 - anhydro - sugar - 6 - phosphate isomerase, radical enzyme activating enzyme, aldolase, and hydroxyacetone reductase, or co - culturing with cells capable of expressing 1,5 - anhydro - sugar - 6 - phosphate isomerase, radical enzyme activating enzyme, aldolase, hydroxyacetone reductase, and a transport complex to obtain 1,2 - propanediol, preferably, the 1,5 - anhydro - sugar is 1,5 - anhydro - glucitol or 1,5 - anhydro - mannitol.
3. The method according to claim 1, wherein the mixture I further comprises other enzymes that regenerate NAD(P) + to NAD(P)H, such as formate dehydrogenase (FDH); the cells capable of expressing and secreting α-1,4-glucan lyase and / or 1,5-anhydro-D-fructose reductase are also capable of expressing other enzymes that regenerate NAD(P) + to NAD(P)H, such as FDH, and secreting the expressed enzymes extracellularly.
4. The method according to claim 1 or 3, wherein the 1,5 - anhydro - D - fructose reductase is 1,5 - anhydro - D - fructose reductase (Gafr) from Sus scrofa or 1,5 - anhydro - D - fructose reductase (Mafr) from Ensifer adhaerens.
5. The method according to claim 1 or 3, wherein the α - 1,4 - glucan lyase is derived from Gracilariopsis lemaneiformis, and / or the FDH is derived from Pseudomonas sp.
6. The method according to claim 1 or 3, wherein the reaction product obtained in step a) is 1,5 - anhydro - sugar; preferably, the 1,5 - anhydro - sugar is 1,5 - anhydro - glucitol or 1,5 - anhydro - mannitol.
7. The method according to claim 1 or 3, wherein the substrate containing an α - 1,4 - glycosidic bond is selected from starch, maltose, or glycogen, preferably, the reaction in step a) is carried out in a solution containing starch such as a culture medium.
8. The method according to claim 1 or 2, wherein the cells are eukaryotic cells or prokaryotic cells; preferably, the eukaryotic cells are yeast cells; and / or Preferably, the prokaryotic cells are selected from the genera Escherichia, Klebsiella, Streptococcus, Lactobacillus, Bifidobacterium, Bacteroidetes, and Firmicutes, etc.
9. The method according to claim 8, wherein the cell is an Escherichia coli cell, preferably an Escherichia coli cell with high expression induced by 1,5-AG and / or 1,5-AM, or an Escherichia coli cell with high expression of the YbiW and / or PflD gene cluster driven by a genetically engineered strong promoter.
10. The method according to claim 1 or 2, wherein the 1,5-glycitol-6-phosphate isomerase comprises the amino acid sequence shown in SEQ ID NO: 1 or 97 or a functional variant thereof, and the functional variant has 1,5-glycitol-6-phosphate isomerase activity.
11. The method according to claim 10, wherein the 1,5-glycitol-6-phosphate isomerase comprises the amino acid sequence shown in SEQ ID NO: 1 or a functional variant thereof; Preferably, the 1,5-glycitol-6-phosphate isomerase has an active site defined as follows in its spatial conformation: the active site comprises the H165, H282, S283, H334, C441, E443, R453, T455, L562, S662, I664, and G786 amino acid residues that are close to each other in spatial conformation and are referenced to SEQ ID NO:
1.
12. The method according to claim 10, wherein the 1,5-glycitol-6-phosphate isomerase comprises the amino acid sequence shown in SEQ ID NO: 97 or a functional variant thereof; Preferably, the 1,5-glycitol-6-phosphate isomerase has an active site defined as follows in its spatial conformation: the active site comprises the Q162, H169, S277, S278, R323, F331, P335, C431, E433, D445, Y628, V630, and G752 amino acid residues that are close to each other in spatial conformation and are referenced to SEQ ID NO:
97.
13. The method according to claim 1 or 2, wherein the sugar kinase or the transport complex phosphorylates the reaction product obtained in step a), preferably phosphorylates 1,5-glycitol to 1,5-glycitol-6-phosphate.
14. The method according to claim 13, wherein the transport complex comprises at least one of SEQ ID NOs: 150-153 or a functional variant thereof, and the transport complex has phosphoenolpyruvate-dependent phosphotransferase system transport activity.
15. The method according to claim 1 or 2, wherein the radical enzyme activating enzyme is an S-adenosylmethionine radical enzyme family glycine radical enzyme activating enzyme, and / or the aldolase is 1-deoxyfructose-6-phosphate aldolase.
16. Use of a composition comprising an α-1,4-glucan lyase, a 1,5-anhydro-D-fructose reductase, and nicotinamide adenine dinucleotide reduced (NADH) or nicotinamide adenine dinucleotide phosphate reduced (NADPH) in catalyzing a substrate containing an α-1,4-glycosidic bond to produce 1,5-anhydro sugar alcohols. Preferably, the composition further comprises other enzymes that regenerate NAD(P) + to NAD(P)H, such as formate dehydrogenase (FDH), and preferably, the substrate containing an α-1,4-glycosidic bond is selected from starch, maltose, or glycogen.
17. Use of a composition comprising a sugar kinase, 1,5-glycitol-6-phosphate isomerase, radical enzyme activating enzyme, aldolase, and hydroxyacetone reductase in catalyzing the formation of 1,2-propanediol from 1,5-glycitol.
18. The use according to claim 16 or 17, wherein the 1,5-anhydro sugar alcohol is 1,5-anhydroglucitol or 1,5-anhydromannitol.