Human genome region 1p21.1 related to occurrence of acute mountain sickness and application of single nucleotide polymorphic site of human genome region 1p21.1

Abstract

The invention discloses a human genome region 1p21.1 related to occurrence of acute mountain sickness and application of a single nucleotide polymorphism site of the human genome region 1p21.1. A single nucleotide polymorphism site rs4381210 in a human genome region 1p21.1 and the susceptibility of the acute mountain sickness are subjected to correlation analysis, it is determined that the 1p21.1 is a susceptibility-related gene region of the acute mountain sickness, the gene can be effectively used for screening acute mountain sickness susceptible people, scientific intervention is carried out, and the application prospect is wide. And the risk of acute mountain sickness of susceptible people is reduced in a targeted manner. The single nucleotide polymorphism site rs4381210 in the human genome region 1p21.1 can be used for screening individuals carrying acute mountain sickness susceptibility genes, predicting the susceptibility of people to acute mountain sickness, screening acute mountain sickness susceptible individuals and evaluating the risk of acute mountain sickness.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of the human genomic region 1p21.1 and its single nucleotide polymorphism sites related to the occurrence of acute mountain sickness. Background Art

[0002] Acute mountain sickness (AMS) is the most common disease in high-altitude areas and usually occurs shortly after a rapid ascent to an oxygen-deficient environment. The incidence of AMS increases with the increase in altitude. At an altitude of 2,850 meters, the incidence is 5.8%; at an altitude of 3,050 meters, the incidence is 2.1%; at an altitude of 3,650 meters, the incidence is 14.8%; at an altitude of 4,559 meters, the incidence is 21.9%.

[0003] The main symptoms of AMS include headache, loss of appetite, nausea, dizziness, fatigue, and insomnia. Although altitude sickness itself is not life-threatening, the disease may develop into more serious conditions such as high-altitude pulmonary edema (HAPE) and high-altitude cerebral edema (HACE), which may be fatal if not treated promptly. With more and more people traveling, working, and exercising in high-altitude areas, altitude sickness has become an important public health problem.

[0004] However, people still know very little about the exact pathophysiology of AMS. Studies have shown that genetic factors play an important role in the susceptibility to AMS, and certain genotypes are beneficial for rapid adaptation to high-altitude environments. Candidate gene-based association studies have found several single nucleotide polymorphisms (SNPs) sites significantly associated with the risk of AMS. The genes associated with these SNPs are mainly divided into the following four categories: 1. Hypoxia-inducible factor (HIF) pathway genes, such as EPAS1 (index SNP, rs6756667, rs4953348) and EGLN1 (rs12097901, rs2790859); 2. Genes involved in angiogenesis, vascular permeability, and vascular smooth muscle relaxation, such as VEGFA (rs3025039), eNOS3 (rs1799983), and EDN1 (rs2070699); 3. Heat shock protein (HSP) genes, such as HSPA1A (rs1008438), HSPA1B (rs10661581), and HSPA1L (rs2227956); 4. Genes in the renin-angiotensin system, such as ACE(rs4340) and AGT (rs699).

[0005] However, due to the limited understanding of the physiological mechanisms underlying AMS susceptibility, the selection of candidate genes has been restricted. In addition, this method cannot fully explain the overall heritability of AMS. There is currently no research report on the correlation between polymorphisms in the genomic region 1p21.1 ( COL11A1 ) and the susceptibility to AMS. SUMMARY OF THE INVENTION

[0006] In view of the deficiencies of the prior art, the present invention provides the application of the human genomic region 1p21.1 and its single nucleotide polymorphism sites related to the occurrence of acute mountain sickness, which can, to a certain extent, help screen individuals carrying the susceptible genes for acute mountain sickness, predict the susceptibility of humans to acute mountain sickness, screen susceptible individuals for acute mountain sickness, and evaluate the risk of suffering from acute mountain sickness.

[0007] To solve the above technical problems and achieve the above technical effects, the present invention is realized through the following technical solutions: The present invention provides the application of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 in the preparation of products for screening and assisting in screening susceptible genotypes or non-susceptible genotypes for acute mountain sickness.

[0008] The present invention provides the application of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 in the preparation of products for detecting or assisting in detecting the susceptibility to acute mountain sickness.

[0009] The present invention provides the application of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 in the preparation of products for screening or assisting in screening susceptible individuals or non-susceptible individuals for acute mountain sickness.

[0010] The present invention provides the application of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 in the preparation of products for detecting or assisting in detecting the risk of suffering from acute mountain sickness.

[0011] The present invention provides the application of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 in the preparation of products for evaluating or assisting in evaluating the risk of suffering from acute mountain sickness.

[0012] The T allele of the single nucleotide polymorphism site rs4381210 is a susceptibility allele for acute mountain sickness, and the TT genotype of the single nucleotide polymorphism site rs4381210 is a susceptibility genotype for acute mountain sickness.

[0013] To discover novel susceptibility genes for acute mountain sickness (AMS), the inventors of the present invention recruited two batches of population cohorts at different times and all reached high altitude areas within a short period. After all participants received a comprehensive introduction to the research details, they all provided written informed consent. Among them, on the night of arrival at the plateau, participants with headache symptoms and a Lake Louise Score (LLS) ≥ 3 were classified into the case group, while participants without obvious symptoms were classified into the control group. Thus, population cohort 1 included 78 cases and 148 controls, and population cohort 2 included 122 cases and 245 controls. The present invention combined the two population cohorts for joint analysis, adopted a case - control strategy, and carried out a genome - wide association study. Finally, the genomic region 1p21.1 was successfully mapped as the susceptibility region for acute mountain sickness and verified separately in the two populations.

[0014] In a first aspect, as described above, the present invention analyzed the susceptibility genomic regions, susceptibility alleles, and susceptibility genotypes related to the occurrence of AMS, that is, the T allele of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 is a susceptibility allele for acute mountain sickness, and the TT genotype is a susceptibility genotype for acute mountain sickness. Moreover, the present invention provides an idea for determining the susceptibility of a population or an individual to the occurrence of AMS by detecting rs4381210. When the rs4381210 of an individual shows the TT genotype, it indicates that the individual has a higher likelihood of suffering from AMS. The present invention analyzed expression Quantitative Trait Loci (eQTL), and the protective allele C of rs4381210 was significantly correlated with the high expression of genes in the COL11A1 hippocampus of the brain (P = 1.13 × 10 -6 ). These results indicate that COL11A1 is a major susceptibility candidate gene for AMS on chromosome 1p21.1.

[0015] In a second aspect, the present invention also analyzes the application method of the single nucleotide polymorphism site rs4381210 in the susceptible genomic region 1p21.1 associated with the risk of AMS in the prevention and control of AMS patients. For example, since the present invention has confirmed the association between the TT genotype of rs4381210 and the susceptibility to AMS, in the prevention and control of AMS patients, it is necessary to detect the genotype of rs4381210 in the consulted object to determine whether the object carries the AMS-susceptible genotype, that is, the TT genotype of rs4381210. For individuals with the TT genotype of rs4381210, scientific intervention can be carried out on them, such as suggesting early therapeutic prevention, etc., so as to specifically reduce the risk of AMS in these susceptible populations.

[0016] In a third aspect, based on the foregoing first and second aspects, the present invention also studies a detection method for screening AMS patients. The inventors of the present invention adopted a case-control strategy to complete the association analysis on two populations, and finally found that rs4381210 is significantly associated with the AMS susceptibility risk. Therefore, this detection method can effectively detect AMS-susceptible populations.

[0017] The application of the present invention can be specifically extended to provide products containing substances that detect the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1, including: a) Products for detecting single nucleotide polymorphisms or genotypes related to AMS; b) Products for identifying or assisting in identifying single nucleotide polymorphisms or genotypes related to AMS; c) Products for screening or assisting in screening AMS patients; d) Products for detecting or assisting in detecting AMS susceptibility.

[0018] In the above applications and products, detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 can specifically be detecting the nucleotide type of the single nucleotide polymorphism site rs4381210. The T allele of the single nucleotide polymorphism site rs4381210 is the susceptible allele of AMS, and the TT genotype of the single nucleotide polymorphism site rs4381210 is the susceptible genotype of AMS. Both the TT genotype or the T allele of the single nucleotide polymorphism site rs4381210 are indicators of AMS susceptibility.

[0019] Specifically, the frequency of the rs4381210 risk allele T in AMS patients is significantly higher than that in the control samples. Thus, when the genotype of rs4381210 is TT, it can predict that the individual to be tested is susceptible to AMS. In addition, the rs4381210 protective allele C is significantly correlated with the high expression of the COL11A1 gene in the hippocampus of the brain. Therefore, the primer set for detecting rs4381210 can be effectively used to screen the AMS-susceptible population, and further can assist in predicting AMS individuals in a short time, at low cost, and with high accuracy at an early stage, providing a theoretical basis for clinical treatment and prognosis evaluation, etc.

[0020] In the above application and product, the substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 contains PCR primers and / or single-base extension primers for amplifying a human genomic DNA fragment including the single nucleotide polymorphism site rs4381210.

[0021] In the above application and product, the product can be a kit for screening the susceptibility to acute mountain sickness, and the kit contains reagents for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1.

[0022] The reagents include primers and / or probes. The methods of using the reagents include, but are not limited to, TaqMan genotyping and Sequenom genotyping, etc.

[0023] The primers include a forward primer and a reverse primer, wherein, The nucleotide sequence of the forward primer is: TACAAATTTCTGTGTTTTGGGTGGC (SEQ ID NO:1); The nucleotide sequence of the reverse primer is: AAAGCCTCTACTTTTGTTCTCTACT (SEQ ID NO:2); Using the forward primer and the reverse primer can effectively detect the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1.

[0024] The probe is a FAM probe and / or a HEX probe, wherein, The nucleotide sequence of the FAM probe is: AGATTTTACACGGTCATTCTG (SEQ ID NO:3); The nucleotide sequence of the HEX probe is: AGATTTTACATGGTCATTCTG (SEQ ID NO:4); The use of the FAM probe and / or the HEX probe can effectively detect the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1.

[0025] In the above applications and products, the product can be a device for screening AMS patients, and the device includes: A sequencing device for sequencing a predetermined region in the whole genome of a patient to obtain a sequencing result; An alignment device connected to the sequencing device for determining the genotype of rs4381210 based on the obtained sequencing result; An analysis device connected to the alignment device for determining the susceptibility risk of AMS based on the determined type of rs4381210.

[0026] Furthermore, the predetermined region is 1 Kb upstream and downstream of rs4381210, whereby sequencing can be carried out more effectively.

[0027] Through experiments, the present invention also found that 1p21.1 is a relatively large genomic fragment, and there are multiple polymorphism sites in this region that are in strong linkage disequilibrium with rs4381210, and they can also indicate the occurrence risk of AMS. Therefore, the present invention can also provide the following applications: Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in the human genomic region 1p21.1 that are in strong linkage disequilibrium with the single nucleotide polymorphism site rs4381210 in the preparation of products for screening and assisting in screening acute mountain sickness susceptible genotypes or acute mountain sickness non-susceptible genotypes.

[0028] Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in the human genomic region 1p21.1 that are in strong linkage disequilibrium with the single nucleotide polymorphism site rs4381210 in the preparation of products for detecting or assisting in detecting the risk of acute mountain sickness.

[0029] Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in the human genomic region 1p21.1 that are in strong linkage disequilibrium with the single nucleotide polymorphism site rs4381210 in the preparation of products for screening or assisting in screening acute mountain sickness susceptible individuals or non-susceptible individuals.

[0030] Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in the human genomic region 1p21.1 that are in strong linkage disequilibrium with the single nucleotide polymorphism site rs4381210 in the preparation of a product for detecting or assisting in the detection of the susceptibility to acute mountain sickness.

[0031] Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in the human genomic region 1p21.1 that are in strong linkage disequilibrium with the single nucleotide polymorphism site rs4381210 in the preparation of a product for assisting in the evaluation of the risk of acute mountain sickness.

[0032] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention performs an association analysis between the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 and the susceptibility to acute mountain sickness, determines that 1p21.1 is a susceptibility-related gene region for acute mountain sickness, can be effectively used to screen susceptible populations to acute mountain sickness, and perform scientific interventions to specifically reduce the risk of acute mountain sickness in these susceptible populations.

[0033] The above description is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention and be implemented in accordance with the content of the specification, the following takes the preferred embodiments of the present invention and describes them in detail in conjunction with the accompanying drawings. The specific implementation manners of the present invention are given in detail by the following embodiments and their accompanying drawings. Brief Description of the Drawings

[0034] The drawings described herein are used to provide a further understanding of the present invention, form a part of this application, and the schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation to the present invention. In the drawings: Figure 1 Are the Manhattan plot (a) and quantile plot (b) of the genome-wide association study of the population cohort in Example 1 of the present invention.

[0035] Figure 2 Is the association region map of the region around SNP rs4381210 in Example 2 of the present invention. Detailed Description of the Preferred Embodiments

[0036] The following will describe the preferred embodiments of the present invention in detail with reference to the accompanying drawings, so as to more clearly understand the purpose, features, and advantages of the invention. It should be understood that the embodiments shown in the drawings do not limit the scope of the present invention, but only illustrate the essential spirit of the technical solution of the present invention.

[0037] In the following description, certain specific details are set forth in order to provide a thorough understanding of the various disclosed embodiments. However, one of ordinary skill in the relevant art will recognize that the embodiments may be practiced without one or more of these specific details. In other instances, well-known devices, structures, and techniques associated with the present application may not be shown or described in detail so as not to unnecessarily obscure the description of the embodiments.

[0038] Unless the context requires otherwise, throughout the specification and claims, the words "comprising" and its variations such as "comprises" and "having" shall be construed in an open, inclusive sense, i.e., to mean "including, but not limited to".

[0039] References to "one embodiment" or "an embodiment" in the course of this specification mean that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment. Thus, the appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment. Additionally, the particular features, structures, or characteristics may be combined in any manner in one or more embodiments.

[0040] As used in this specification and the appended claims, the singular forms "a" and "the" include plural referents unless the context clearly dictates otherwise. It should be noted that the term "or" is generally used in its "and / or" sense unless the context clearly dictates otherwise.

[0041] Furthermore, the technical features involved in the different embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

[0042] Example 1 Genome-wide Association Study of Acute Mountain Sickness (AMS) Susceptibility 1. Materials and Methods; 1.1. Research Subjects; The present invention included a total of two population cohorts. The first population cohort (Population Cohort 1) took a train from a low-altitude area to a high-altitude area (altitude 4,600 meters) in May 2022, and a total of 226 participants were recruited; the second population cohort (Population Cohort 2) took a bus from a low-altitude area to a high-altitude area (altitude 4,600 meters) in May 2023, and a total of 367 participants were recruited. After all participants listened to a comprehensive introduction of the research details, they all gave written informed consent. The present invention collected the sociodemographic information of all participants, and before they ascended to the plateau, approximately 2 mL of fasting venous blood was drawn from each participant and stored in an environment of -80°C. On the night of arrival, each participant filled out the Lake Louise Questionnaire. Participants with headache symptoms and a Lake Louise Score (LLS) ≥ 3 were classified into the case group, while participants without obvious symptoms were classified into the control group.

[0043] 1.2, Genotyping, quality control, and imputation analysis; The present invention collected peripheral whole blood samples from all participants, and genomic DNA was extracted from 1 mL of blood using the QIAamp DNA Blood Kit (Qiagen, Crawley, UK). The DNA quality was evaluated by two methods: (1) evaluating DNA degradation and contamination on a 1% agarose gel; (2) measuring the DNA concentration using the Qubit DNA Assay Kit with a Qubit 2.0 fluorometer. The samples were genotyped using the Illumina Infinium Global Screening Array-24 v1.0 BeadChip.

[0044] Subsequently, the present invention performed strict quality control on the samples and single nucleotide polymorphisms (SNPs) to ensure the robustness of the association test. The present invention excluded samples with low call rates (<90%), undetermined gender, close relatives (PI_HAT value greater than 0.2 in PLINK v.1.9), high heterozygosity (greater than 3 standard deviations from the mean), or outliers determined by principal component analysis. For SNPs, the present invention excluded SNPs with genotype call rates below 90%, deviation from Hardy-Weinberg equilibrium (control HWE deviation P < 1e-6, case HWE deviation P < 1e-10), minor allele frequencies below 5%, and SNPs located on the XY chromosomes.

[0045] To improve the genomic region coverage, the present invention uses the human genome hg19 and takes the 1000 Genomes Project data as a reference. The present invention uses SHAPEIT (v.4.1.2) and IMPUTE5 (v.1.1.5) to estimate the genotyping data. Finally, SNPs with an information score lower than 0.6 or a minor allele frequency lower than 0.01 are excluded.

[0046] 1.3, Association study The present invention uses a logistic regression model in PLINK v.1.9 for genome-wide association analysis, taking gender, age, and the top 10 principal components as covariates. A quantile-quantile plot (Q-Q plot) was generated in R (4.3.1) to evaluate the distribution of P-values and the lambda (λ) inflation factor (genomic inflation factor) was evaluated to detect the presence of systematic bias.

[0047] See Figure 1 As shown in Figure 1 a, the present invention draws Manhattan plots based on population cohort 1, population cohort 2, and the combined human association results. Figure 1 The horizontal line in P a represents the genome-wide significance threshold. Among them, the genome-wide significance threshold for population cohort 1 P = 0.05, the genome-wide significance threshold for population cohort 2 P = 5×10 -5 .

[0048] See Figure 1 As shown in Figure 1 b, the present invention draws quantile plots based on population cohort 1, population cohort 2, and the combined human association results. Figure 1 b describes that the inflation coefficient λ for population cohort 1 is 1.053, the inflation coefficient λ for population cohort 2 is 1.04, and the inflation coefficient λ for the combined cohort is 1.026.

[0049] The present invention believes that SNPs with P < 5×10 -5 in the combined population and P < 0.05 in population 1 and population 2 are significantly different AMS-susceptible SNPs.

[0050] Subsequently, the present invention used CAVIAR (v.2.2) and FINEMAP (v.1.3.1) for fine-mapping analysis. A set of credible SNPs was determined for each locus, defined as the smallest set of variants that contains all causal variants with a certainty greater than 0.95. Subsequently, the present invention used RegulomeDB (V2) and Haploreg to identify potential functional SNPs.

[0051] 2. Results; 2.1 Genome-wide SNP data quality control results; To discover the AMS susceptibility regions in the Chinese population, the present invention genotyped SNPs in two population cohorts. Since the same genotyping platform was used for both population cohorts, the present invention performed unified quality control on the genotyping data of these two populations. As shown in Tables 1 and 2, after strict quality control, Population Cohort 1 finally retained 74 cases and 145 controls, as well as 7,010,527 SNPs. Population Cohort 2 finally retained 84 cases and 176 controls, as well as 7,784,294 SNPs. For the combined cohort, 156 cases and 3,313 controls, as well as 7,047,059 SNPs were finally retained.

[0052] Table 1 Quality control of population samples

[0053] Table 2 SNP quality control process

[0054] 2.2 Association analysis results The present invention performed association analysis on the combined population and verified it by performing association analysis on the two populations separately, thereby identifying the genomic region 1p21.1 that was significantly associated with AMS ( P < 5×10 -5 , P < 0.05, P < 0.05). In the combined population cohort (Population Cohort 1 + Population Cohort 2), on chromosome 1p21.1 (rs4381210; odds ratio [OR] of the C allele = 0.4859; 95% confidence interval [CI] = 0.352 - 0.6706; P = 1.13×10 -5 ). On chromosome 1p21.1 in Population Cohort 1 (index SNP rs4381210; ratio of the C allele [OR] = 0.5754; 95% confidence interval [CI] = 0.3523 - 0.9397; P = 2.27×10 -2); in population cohort 2, for chromosome 1p21.1 (rs4381210; odds ratio [OR] of the C allele = 0.4418; 95% confidence interval [CI] = 0.2792 - 0.6991; P = 4.85×10 -4 ). As can be seen from Figure 1 , there are significant differences in the allele frequencies of the above - mentioned loci between the case group and the control group.

[0055] Example 2 AMS Susceptibility Gene Mapping Analysis To identify potential AMS susceptibility genes on SNPs, the present invention performed eQTL analysis using 5 publicly available datasets: 1) QTLbase collected genome - wide QTL statistical summaries of many human molecular traits under more than 95 tissue / cell types and various biological conditions; this database includes tens of millions of important genotype - molecular trait associations under different conditions; 2) Genotype - Tissue Expression database (GTEx, version 8), covering 48 tissues (including blood and lung), detecting SNPs by whole - genome sequencing and measuring mRNA expression levels by RNA sequencing; 3) ImmuNexUT, covering 9852 immune cell samples from 416 donors, including 10 different immune - mediated diseases and 28 immune cell types from healthy donors; 4) FIVEx, including eQTL and sQTL data from 16 different studies in the EBI eQTL catalog; 5) scQTLbase is a comprehensive portal for human single - cell eQTLs, which includes 304 datasets of 57 cell types and 95 cell states.

[0056] These datasets include approximately 16 million SNPs related to gene expression in specific cells, and approximately 690,000 disease - related sc - eQTLs from 3333 traits / diseases. The present invention only focused on protein - coding genes within the 2Mb region (1Mb upstream and downstream) around the SNP, and regarded P < 0.001 as statistically significant. As shown in Figure 2 , Figure 2 shows genes included in the 1Mb upstream and downstream of the index SNP rs4381210 locus located at genomic 1p21.1 COL11A1. The results show the P-values of SNPs in the region of 2 Mb around the index SNP rs4381210, calculated by a logistic regression model (adjusted for age, sex, and the top 10 PCs). The genomic positions are based on the human genome hg19. The P-value of rs4381210 is shown as a diamond. The linkage disequilibrium (LD) values (r2) of other SNPs with the index SNP (rs4381210) are represented by the marker colors. According to the results of QTLbase2, the protective allele C of rs4381210 is significantly associated with the high expression of the COL11A1 gene in the hippocampus of the brain (P = 1.13 × 10 -6 ). These results suggest that COL11A1 is a major candidate gene on chromosome 1p21.1.

[0057] This invention uses GWAS for genotyping, with sensitivity and specificity supplemented by TT / TC + CC: Table 3 Genotypes and sample numbers of the combined population

[0058] Sensitivity: 0.47, Specificity: 0.71, Accuracy: 0.63.

[0059] Table 4 Genotypes and sample numbers of population 1

[0060] Sensitivity: 0.39, Specificity: 0.70, Accuracy: 0.60.

[0061] Table 5 Genotypes and sample numbers of population 2

[0062] Sensitivity: 0.50, Specificity: 0.68, Accuracy: 0.62.

[0063] COL11A1 The gene encodes the alpha-1 chain of type XI collagen, and its related Gene Ontology (GO) annotations include extracellular matrix structural constituent and extracellular matrix binding. The C allele at the rs4381210 locus can regulate the expression of this gene in the hippocampus. The hippocampus is a crucial structure in the brain, responsible for processing and storing memories, emotional responses, learning, and spatial navigation, among other functions, and has an important impact on our daily life, cognitive abilities, emotional regulation, and spatial orientation. Therefore, this finding suggests that COL11A1 the gene may be associated with high-altitude cognitive impairment. Of course, this conjecture needs to be proven by further research.

[0064] In summary, both the association study and functional study of the present invention suggest that the AMS susceptibility genes in the region (1p21.1) where rs4381210 is located include COL11A1 genes. The present invention confirms the association between the rs4381210 allele T and AMS susceptibility. In the prevention and control of AMS in the population, the genotypes of rs4381210 should be detected in the counseling objects for scientific intervention to specifically reduce the risk of AMS in these susceptible populations.

[0065] Based on the above analysis results, the present invention can provide any of the following uses: 1. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 in the preparation of a product for screening or assisting in screening susceptible or non-susceptible individuals to acute mountain sickness.

[0066] 2. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 in the preparation of a product for detecting or assisting in detecting the susceptibility to acute mountain sickness.

[0067] 3. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 in the preparation of a product for detecting or assisting in detecting the risk of acute mountain sickness.

[0068] 4. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 in the preparation of a product for evaluating or assisting in evaluating the risk of acute mountain sickness.

[0069] 5. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 in the preparation of a product for screening and assisting in screening susceptible or non-susceptible genotypes to acute mountain sickness.

[0070] 6. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in strong linkage disequilibrium with the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 in the preparation of a product for screening or assisting in screening susceptible or non-susceptible individuals to acute mountain sickness.

[0071] 7. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in the human genomic region 1p21.1 that are in strong linkage disequilibrium with the single nucleotide polymorphism site rs4381210 in the preparation of a product for detecting or assisting in the detection of the susceptibility to acute mountain sickness.

[0072] 8. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in the human genomic region 1p21.1 that are in strong linkage disequilibrium with the single nucleotide polymorphism site rs4381210 in the preparation of a product for detecting or assisting in the detection of the risk of acute mountain sickness.

[0073] 9. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in the human genomic region 1p21.1 that are in strong linkage disequilibrium with the single nucleotide polymorphism site rs4381210 in the preparation of a product for assisting in the evaluation of the risk of acute mountain sickness.

[0074] 10. Use of a substance for detecting the polymorphism or genotype (i.e., allele) of other single nucleotide polymorphism sites in the human genomic region 1p21.1 that are in strong linkage disequilibrium with the single nucleotide polymorphism site rs4381210 in the preparation of a product for screening and assisting in the screening of susceptible genotypes or non-susceptible genotypes to acute mountain sickness.

[0075] 11. A product containing a substance for detecting the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1, including: a) A product for detecting single nucleotide polymorphisms or genotypes related to acute mountain sickness; b) A product for identifying or assisting in the identification of single nucleotide polymorphisms or genotypes related to acute mountain sickness; c) A product for screening or assisting in the screening of patients with acute mountain sickness; d) A product for detecting or assisting in the detection of the susceptibility to acute mountain sickness.

[0076] In the above applications and products, the polymorphism or genotype (i.e., allele) of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 can specifically be the nucleotide type of the single nucleotide polymorphism site rs4381210. The C allele of the single nucleotide polymorphism site rs4381210 is a susceptible allele to acute mountain sickness, and the TT genotype of the single nucleotide polymorphism site rs4381210 is a susceptible genotype to acute mountain sickness. The TT genotype or T allele of the single nucleotide polymorphism site rs4381210 is an indication of susceptibility to acute mountain sickness.

[0077] Specifically, the frequency of the rs4381210 risk allele T in acute mountain sickness patients is significantly higher than its frequency in the control sample. Thus, when the genotype of rs4381210 is TT, it can predict that the individual to be tested is susceptible to acute mountain sickness. In addition, the rs4381210 protective allele C is significantly correlated with the high expression of genes in the COL11A1 hippocampus of the brain. Therefore, the primer set for detecting rs4381210 can be effectively used to screen the susceptible population of acute mountain sickness, and further can assist in predicting acute mountain sickness individuals in a short time, at low cost, and with high accuracy in the early stage, providing a theoretical basis for clinical treatment and prognosis evaluation, etc.

[0078] In the above applications and products, the substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 contains PCR primers and / or single-base extension primers for amplifying the human genomic DNA fragment including the single nucleotide polymorphism site rs4381210.

[0079] In the above applications and products, the product can be a kit for screening the susceptibility to acute mountain sickness, and the kit contains reagents for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1.

[0080] The reagents include primers and / or probes. The usage methods of the reagents include, but are not limited to, TaqMan genotyping and Sequenom genotyping, etc.

[0081] The primers include a forward primer and a reverse primer, where the nucleotide sequence of the forward primer is: TACAAATTTCTGTGTTTTGGGTGGC (SEQ ID NO:1); the nucleotide sequence of the reverse primer is: AAAGCCTCTACTTTTGTTCTCTACT (SEQ ID NO:2); Using the forward primer and the reverse primer can effectively detect the single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1.

[0082] The probe is a FAM probe and / or a HEX probe, where the nucleotide sequence of the FAM probe is: AGATTTTACACGGTCATTCTG (SEQ ID NO:3); the nucleotide sequence of the HEX probe is: AGATTTTACATGGTCATTCTG (SEQ ID NO:4); The single nucleotide polymorphism site rs4381210 in the human genomic region 1p21.1 can be effectively detected by using the FAM probe and / or the HEX probe.

[0083] In the above application and product, the product may be a device for screening patients with acute mountain sickness, and the device includes: A sequencing device for sequencing a predetermined region in the whole genome of a patient to obtain a sequencing result; wherein, the predetermined region is 1 Kb upstream and downstream of rs4381210, whereby sequencing can be performed more effectively; An alignment device connected to the sequencing device for determining the genotype of rs4381210 based on the obtained sequencing result; An analysis device connected to the alignment device for determining the susceptibility risk of acute mountain sickness based on the determined type of rs4381210.

[0084] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and changes. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Use of a substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs4381210 in the human genome region 1p21.1 in the preparation of a product for screening and assisting screening of an acute mountain sickness susceptible genotype or an acute mountain sickness non-susceptible genotype.

2. Use of a substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs4381210 in the human genome region 1p21.1 in the preparation of a product for detecting or assisting in detecting susceptibility to acute mountain sickness.

3. Use of a substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs4381210 in the human genome region 1p21.1 in the preparation of a product for screening or assisting in screening of individuals susceptible to or non-susceptible to acute mountain sickness.

4. Use of a substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs4381210 in the human genome region 1p21.1 in the preparation of a product for detecting or assisting in detecting the risk of acute mountain sickness.

5. Use of a substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs4381210 in the human genome region 1p21.1 in the preparation of a product for evaluating or assisting in the evaluation of the risk of acute mountain sickness.

6. The use according to any one of claims 1 to 5, characterized in that: The T allele of the single nucleotide polymorphism site rs4381210 is a susceptible allele for acute mountain sickness, and the TT genotype of the single nucleotide polymorphism site rs4381210 is a susceptible genotype for acute mountain sickness.

7. The use according to any one of claims 1 to 5, characterized in that: The material for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs4381210 in the human genome region 1p21.1 contains PCR primers and / or single base extension primers for amplifying a human genome DNA fragment including the single nucleotide polymorphism site rs4381210.

8. Use of substances for detecting polymorphisms or genotypes of other single nucleotide polymorphism sites in the human genome region 1p21.1 that are in a strong linkage disequilibrium with the single nucleotide polymorphism site rs4381210 in the preparation of products for screening and assisting in screening of acute mountain sickness susceptible genotypes or acute mountain sickness non-susceptible genotypes, or for detecting or assisting in detecting susceptibility to acute mountain sickness, or for screening or assisting in screening of individuals susceptible to acute mountain sickness or non-susceptible individuals, or for detecting or assisting in detecting the risk of acute mountain sickness, or for assisting in evaluating the risk of acute mountain sickness.

9. A kit for screening susceptibility to acute mountain sickness, characterized in that: A reagent containing a substance for detecting the polymorphism or genotype of the single nucleotide polymorphism site rs4381210 in the human genome region 1p21.

1.

10. The kit according to claim 10, characterized in that: The reagents include primers and / or probes; wherein, The nucleotide sequence of the primer is: TACAAATTTCTGTGTTTTGGGTGGC, and AAAGCCTCTACTTTTGTTCTCTACT; The nucleotide sequence of the probe is: AGATTTTACACGGTCATTCTG, and / or AGATTTTACATGGTCATTCTG.

Images