Positive quality control product for detecting colorectal cancer gene large fragment deletion and preparation method thereof

Abstract

The invention discloses a positive quality control product for detecting colorectal cancer gene large fragment deletion and a preparation method thereof, the gene contains hereditary colorectal cancer related genes MLH1 / MSH2 / MSH6 / PMS 2 / EPCAM / MUTYH / STK11, and the positive quality control product is a recombinant plasmid containing four gene fragments of a first exon of a gene to be detected, a plant sequence, a last exon of the gene and RNase P. A human genome RNase P sequence is inserted into a plasmid vector according to a fragment ratio of 2: 1, and the copy number of a to-be-detected gene is verified by adopting a fluorescent quantitative qPCR method, so that whether the obtained plasmid can be used as a positive quality control product for detection is judged, and the quality inspection of the positive quality control product is completed. The preparation method provided by the invention is simple and easy to operate and good in stability, and the positive quality control product obtained by adopting the preparation method can be used as a positive internal standard quality control material for detecting large fragment deletion of the hereditary colorectal cancer gene, so that the whole experiment process is monitored, and the accuracy of experiment and detection results is improved.

Description

Technical Field

[0001] The present invention belongs to the fields of biotechnology and medicine, and particularly relates to a positive control product for detecting large fragment deletions of genes for hereditary colorectal cancer and a preparation method thereof. Background Art

[0002] In biological detection, the importance of positive control cannot be ignored. It can be used to verify the sensitivity and specificity of the detection system to ensure that the detection system can correctly identify the target substance.

[0003] Colorectal cancer (CRC) is one of the common malignant tumors in China. In 2020, the number of newly diagnosed CRC cases in China was 555,000, accounting for 12.2% of all newly diagnosed malignant tumors; the number of death cases was 286,000, accounting for 9.53% of all malignant tumor deaths. Among all colorectal cancer patients, about 25% have a corresponding family history, and about 10% are clearly related to genetic factors. At the genomic level, large fragment deletions of genes for hereditary colorectal cancer refer to the loss of relatively large ranges of DNA sequences on chromosomes, which may involve one or more genes and the regulatory regions between genes. Such large fragment deletions of genes can lead to the loss of gene function.

[0004] Fluorescence quantitative polymerase chain reaction (qPCR) is a method for detecting the total amount of products after each polymerase chain reaction cycle with fluorescent chemicals in a DNA amplification reaction. By designing primer probes for the deletion region of the target gene, measuring the ct value of the unknown sample, and calculating the copy number of the target gene in the sample, the deletion situation of the gene can be determined. This detection method has the advantages of high sensitivity, simple operation, and good specificity. However, when the qPCR method is used to detect large fragment deletions of genes for hereditary colorectal cancer, the experimental results are affected by factors such as the residual inhibitors after sample nucleic acid extraction and the concentration of nucleic acid to be amplified. Therefore, a stable positive control is needed as a reference. At present, there are problems such as difficulty in obtaining and easy degradation during storage when using human genomic positive controls. Therefore, a new positive control product is needed to avoid the above problems. Summary of the Invention

[0005] To solve the above problems, the purpose of the present invention is to provide a positive control product for detecting large fragment deletions of genes for colorectal cancer and a preparation method thereof.

[0006] To achieve the above purpose, the present invention provides the following technical solutions:

[0007] An object of the present invention is to provide a positive control product for detecting large fragment deletions of colorectal cancer genes. Specifically, 7 positive control products for detecting large fragment deletions of genes to be detected are prepared. The positive control products contain recombinant plasmids of genes to be detected, and the genes to be detected are colorectal cancer-related genetic genes MLH1 / MSH2 / MSH6 / EPCAM / MUTYH / PMS2 / STK11. The recombinant plasmid of the gene to be detected is a recombinant plasmid containing four gene fragments: the first exon of the gene to be detected, a plant sequence, the last exon of the gene, and RNase P.

[0008] Furthermore, the fragment sequence of the recombinant plasmid of the MLH1 gene designed and synthesized is as shown in SEQ ID NO.1. The recombinant plasmid of the MLH1 gene is composed of the following sequence fragments in sequence: RNase P sequence, MLH 1intron18+exon9 partial sequence, plant sequence, MLH1 exon 1+intron 1 partial sequence, RNase P sequence.

[0009] Furthermore, the fragment sequence of the recombinant plasmid of the MSH2 gene designed and synthesized is as shown in SEQ ID NO.2. The recombinant plasmid of the MSH2 gene is composed of the following sequence fragments in sequence: RNase P sequence, MSH2(intron15+exon16) partial sequence, plant sequence, MSH 2(exon1+intron1) partial sequence, RNase P sequence.

[0010] Furthermore, the fragment sequence of the recombinant plasmid of the MSH6 gene designed and synthesized is as shown in SEQ ID NO.3. The recombinant plasmid of the MSH6 gene is composed of the following sequence fragments in sequence: RNase P sequence, MSH6(exon7+intron7+exon8+intron8+exon9+intron9+exon10+intron10) partial sequence, plant sequence, MSH6(exon7+intron7+exon8+intron8+exon9+intron9+exon10+intron10) partial sequence, RNase P sequence.

[0011] Furthermore, the fragment sequence of the recombinant plasmid of the PMS2 gene designed and synthesized is as shown in SEQ ID NO.4. The recombinant plasmid of the PMS2 gene is composed of the following sequence fragments in sequence: RNase P sequence, PMS2(intron14+exon15) partial sequence, plant sequence, PMS2(exon1+intron1), RNase P sequence.

[0012] Further, the fragment sequence of the designed and synthesized EPCAM gene recombinant plasmid is as shown in SEQ ID NO.5, and the EPCAM gene recombinant plasmid is successively composed of the following sequence fragments: RNase P sequence, EPCAM (intron8 + exon9) partial sequence, plant sequence, EPCAM (exon1 + intron1) partial sequence, RNase P sequence.

[0013] Further, the fragment sequence of the designed and synthesized MUTYH gene recombinant plasmid is as shown in SEQ ID NO.6, and the MUTYH gene recombinant plasmid is successively composed of the following sequence fragments: RNase P sequence, MUTYH (exon15 + intron15 + exon16) partial sequence, plant sequence, MUTYH (exon1 + intron1) partial sequence, RNaseP sequence.

[0014] Further, the fragment sequence of the designed and synthesized STK11 gene recombinant plasmid is as shown in SEQ ID NO.7, and the STK11 gene recombinant plasmid is successively composed of the following sequence fragments: RNase P sequence, STK11 (intron7 + exon8 + intron9 + exon9) partial sequence, plant sequence, STK11 (exon1 + intron1), RNase P sequence.

[0015] Further, the RNaseP sequence of the MLH1 / MSH2 / MSH6 / EPCAM / MUTYH / PMS2 / STK11 gene recombinant plasmid is as shown in SEQ ID NO.8, SEQ ID NO.8:

[0016] GCGGAGGGAAGCTCATCAGTGGGGCCACGAGCTGAGTGCGTCCTGTCACTCCACTCCCATGTCCCTTGGGAAGGTCTGAGACTAGGG

[0017] Another object of the present invention is to provide a preparation method of a positive control product for detecting large fragment deletions of colorectal cancer genes, which specifically includes the following steps:

[0018] S1: Extract wild-type human peripheral whole blood genomic DNA;

[0019] S2: Extract positive plasmids;

[0020] S2-1: Design and synthesize primers for RNase P, the first exon and the last exon fragments of the gene sequence to be detected, and plant sequences required for ligation of 7 kinds of gene recombinant plasmids to be detected. The upstream and downstream of the primers should be added with corresponding homologous arm sequences according to the preset ligation order;

[0021] S2-2; PCR amplification and gel extraction of the target fragment contained in the primer in step S2-1. For the amplification of the gene to be detected and RNase P, the human genomic DNA extracted in step S1 is used as the template. The plant sequence is synthesized by Sangon Biotech (Shanghai) Co., Ltd. and ligated to the T vector as the template. The synthesized plant sequence is shown in SEQ ID NO.9:

[0022]

[0023] S2-3: Connect to construct the recombinant plasmid of the gene to be detected and transform it into the host bacteria, and select single colonies for PCR electrophoresis verification;

[0024] S2-4: Use the first-generation sequencing technology to confirm the PCR products of the colonies;

[0025] S2-5: Extract the positive plasmid from the positive host bacteria;

[0026] S3: Use the qPCR method to calculate the corresponding gene copy number in the recombinant plasmid of the gene to be detected through CopyCaller v2.1;

[0027] S4: Verification of the repeatability and stability of the positive control product;

[0028] During the preparation process, amplification primers for the first exon and the last exon fragments of the 7 genes MLH1 / MSH2 / MSH6 / PMS2 / EPCAM / MUTYH / STK11 insertion fragments were designed and synthesized.

[0029] Furthermore, the primers for RNase P, the last exon and the first exon fragments, and the plant fragment to be ligated to the recombinant plasmid of the MLH1 gene are as shown in Table 1 below. The upstream and downstream of the primers should be added with the corresponding homologous arm sequences according to the preset ligation order:

[0030] Table 1.

[0031]

[0032]

[0033] Furthermore, the primers for RNase P, the last exon and the first exon fragments, and the plant fragment to be ligated to the recombinant plasmid of the MSH2 gene are as shown in Table 2 below. The upstream and downstream of the primers should be added with the corresponding homologous arm sequences according to the preset ligation order:

[0034] Table 2.

[0035] Primer Name Primer Sequence Number RNaseP-F CATCTAGATATCGGATCCGCGGAGGGAAGCTCATCAGTGG SEQ ID NO.10 RNaseP-R AACTATCTATCCTTCAGATCCCTAGTCTCAGACCTTCCCA SEQ ID NO.20 MSH2(intron15+exon16)-F GGTCTGAGACTAGGGATCTGAAGGATAGATAGTTGCTACA SEQ ID NO.21 MSH2(intron15+exon16)-R TCCAAGCCTATAACTTCAAATTCCACAAACTACATGATTTTA SEQ ID NO.22 Plant Fragment-F TAGTTTGTGGAATTTGAAGTTATAGGCTTGGATTAAACGA SEQ ID NO.23 Plant Fragment-R ACCACACCCAATCAGCTTAACCCCAGAAGTTTTCACAATC SEQ ID NO.24 MSH2(exon1+intron1)-F TTGTGAAAACTTCTGGGGTTAAGCTGATTGGGTGTGGTCG SEQ ID NO.25 MSH2(exon1+intron1)-R ATGAGCTTCCCTCCGCAGGAGTATCGCATTTGCACTAGTC SEQ ID NO.26 RNaseP-F AGTGCAAATGCGATACTCCTGCGGAGGGAAGCTCATCAGT SEQ ID NO.27 RNaseP-R ACCATGATTACGCCAAGCTTCCCTAGTCTCAGACCTT SEQ ID NO.19

[0036] Furthermore, the primers for RNase P, the last exon and the first exon fragments, and the plant fragment to be ligated to the recombinant plasmid of the MSH6 gene are as shown in Table 3 below. The upstream and downstream of the primers should be added with the corresponding homologous arm sequences according to the preset ligation order:

[0037] Table 3.

[0038]

[0039] Furthermore, the primers for RNase P, the last exon and the first exon fragment, and the plant fragment to be ligated to the designed and synthesized EPCAM gene recombinant plasmid are as shown in Table 4 below. The upstream and downstream of the primers should be added with corresponding homologous arm sequences according to the preset ligation order:

[0040] Table 4.

[0041]

[0042]

[0043] Furthermore, the primers for RNase P, the last exon and the first exon fragment, and the plant fragment to be ligated to the designed and synthesized MUTYH gene recombinant plasmid are as shown in Table 5 below. The upstream and downstream of the primers should be added with corresponding homologous arm sequences according to the preset ligation order:

[0044] Table 5.

[0045] Primer Name Primer Sequence Number RNaseP-F CATCTAGATATCGGATCCGCGGAGGGAAGCTCATCAGTGG SEQ ID NO.10 RNaseP-R TACCATACAGGTCCCTGGCTGCCCTAGTCTCAGACCTTC SEQ ID NO.44 MUTYH(exon15+intron15+exon16)-F GAAGGTCTGAGACTAGGGCAGCCAGGGACCTGTATGGTAA SEQ ID NO.45 MUTYH(exon15+intron15+exon16)-R ATCCAAGCCTATAACTTAACTACAAAAATAAGCACTTTA SEQ ID NO.46 Plant Fragment-F GCTTATTTTTGTAGTTAAGTTATAGGCTTGGATTAAACGA SEQ ID NO.47 Plant fragment - R AGCCACGAGGAGACTACAACCCCAGAAGTTTTCACAATCG SEQ ID NO.48 MUTYH (exon1 + intron1) - F TGAAAACTTCTGGGGTTGTAGTCTCCTCGTGGCTAGTTCA SEQ ID NO.49 MUTYH (exon1 + intron1) - R CTGATGAGCTTCCCTCCGCCGGAGGGACTAGTCTCCAATA SEQ ID NO.50 RNaseP - F TATTGGAGACTAGTCCCTCCGGCGGAGGGAAGCTCATCAG SEQ ID NO.51 RNaseP - R ACCATGATTACGCCAAGCTTCCCTAGTCTCAGACCTT SEQ ID NO.19

[0046] Furthermore, the primers for RNase P, the last exon and the first exon fragment, and the plant fragment to be ligated to the designed and synthesized PMS2 gene recombinant plasmid are as shown in Table 6 below. The upstream and downstream of the primers should be added with corresponding homologous arm sequences according to the preset ligation order:

[0047] Table 6

[0048] Primer name Primer sequence Number RNaseP - F CATCTAGATATCGGATCCGCGGAGGGAAGCTCATCAGTGG SEQ ID NO.10 RNaseP - R GCTCTCACTCACAGACTCCCCTAGTCTCAGACCTTCCCA SEQ ID NO.52 PMS2 (intron14 + exon15) - F AAGGTCTGAGACTAGGGGAGTCTGTGAGTGAGAGCGTG SEQ ID NO.53 PMS2 (intron14 + exon15) - R TAATCCAAGCCTATAACTTGCAAGCAATGCTCCATCTGGT SEQ ID NO.54 Plant fragment - F TGGAGCATTGCTTGCAAGTTATAGGCTTGGATTAAACGAG SEQ ID NO.55 Plant fragment - R GTTCCCTCCAGGGCTCCAACCCCAGAAGTTTTCACAAT SEQ ID NO.56 PMS2 (exon1 + intron1) - F TGAAAACTTCTGGGGTTGGAGCCCTGGAGGGAACTTTC SEQ ID NO.57 PMS2 (exon1 + intron1) - R TGATGAGCTTCCCTCCGCGAGACCGAGTCTTGCTGCGTT SEQ ID NO.58 RNaseP - F GCAGCAAGACTCGGTCTCGCGGAGGGAAGCTCATCAGT SEQ ID NO.59 RNaseP - R ACCATGATTACGCCAAGCTTCCCTAGTCTCAGACCTT SEQ ID NO.19

[0049] Furthermore, the primers for RNase P, the last exon and the first exon fragment, and the plant fragment to be ligated to the designed and synthesized STK11 gene recombinant plasmid are as shown in Table 7 below. The upstream and downstream of the primers should be added with corresponding homologous arm sequences according to the preset ligation order:

[0050] Table 7

[0051] Primer Name Primer Sequence Number RNaseP-F CATCTAGATATCGGATCCGCGGAGGGAAGCTCATCAGTGG SEQ ID NO.10 RNaseP-R GATCTGCCGGATGGAGAACCCCTAGTCTCAGACCTT SEQ ID NO.60 STK11(intron7+exon8+intron9+exon9)-F GAAGGTCTGAGACTAGGGGTTCTCCATCCGGCAGATC SEQ ID NO.61 STK11(intron7+exon8+intron9+exon9)-R CGTTTAATCCAAGCCTATAACTCTGCAGGCGGCCAGCCTCA SEQ ID NO.62 Plant Fragment-F GAGGCTGGCCGCCTGCAGAGTTATAGGCTTGGATTAAACG SEQ ID NO.63 Plant Fragment-R GCGGGTCCACCACCTCCATAACCCCAGAAGTTTTCACAAT SEQ ID NO.64 STK11(exon1+intron1)-F GTGAAAACTTCTGGGGTTATGGAGGTGGTGGACCCGCAGC SEQ ID NO.65 STK11(exon1+intron1)-R GAGCTTCCCTCCGCCGGACCTCCTTCCAAGGTCATGGTGC SEQ ID NO.66 RNaseP-F ACCTTGGAAGGAGGTCCGGCGGAGGGAAGCTCATCAGTG SEQ ID NO.67 RNaseP-R ACCATGATTACGCCAAGCTTCCCTAGTCTCAGACCTT SEQ ID NO.19

[0052] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0053] (1) The positive control product provided by the present invention contains 7 genetic genes of colorectal cancer, and can perform quality control more accurately and specifically;

[0054] (2) The present invention constructs a recombinant plasmid by using the genetic genes of colorectal cancer, RNase P, and plant sequences, which can be used as a stable quality control product for the detection of large fragment deletions in colorectal cancer genes. By inserting the human genomic RNaseP sequence into the plasmid vector according to a fragment ratio of 2:1, and using the fluorescence quantitative qPCR method to verify the copy number of the gene to be detected, it is thus determined whether the obtained plasmid can be used as a positive quality control product for detection, and the quality inspection of the positive quality control product itself is completed; the preparation method provided by the present invention is simple, easy to operate, and has good stability. The positive quality control product obtained by using this preparation method can be used as a positive internal standard quality control substance for detecting large fragment deletions in colorectal cancer genes, monitoring the entire experimental process, and improving the accuracy of experimental and detection results.

[0055] (3) The positive quality control product prepared by the present invention is easy to store and replicate, is applicable to the field of genetic disease detection based on the qPCR method, and helps to promote large-scale use. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] Figure 1 Sequencing result of primers and probes at MLH1 Exon1 qPCR in Example 1 of the present invention

[0057] Figure 2 Sequencing result of primers and probes at MLH1 Exon19 qPCR in Example 1 of the present invention

[0058] Figure 3 Detection result graph of MLH1 in Example 1 of the present invention

[0059] Figure 4 Detection result graph of MLH1 in Example 1 of the present invention

[0060] Figure 5 is Sequencing result of primers and probes at MSH2 Exon1 qPCR in Example 2 of the present invention

[0061] Figure 6 Sequencing result of primers and probes at MSH2 Exon16 qPCR in Example 2 of the present invention

[0062] Figure 7 Detection result graph of MSH2 Exon1 in Example 2 of the present invention

[0063] Figure 8 Detection result graph of MSH2 Exon16 in Example 2 of the present invention

[0064] Figure 9 Sequencing result of primers and probes at MSH6 Exon1 qPCR in Example 3 of the present invention

[0065] Figure 10Sequencing results at the MSH6 Exon10 qPCR primer-probe in Example 3 of the present invention

[0066] Figure 11 Detection result diagram of MSH6 Exon1 in Example 3 of the present invention

[0067] Figure 12 Detection result diagram of MSH6 Exon10 in Example 3 of the present invention

[0068] Figure 13 Sequencing results at the PMS2 Exon1 qPCR primer-probe in Example 4 of the present invention

[0069] Figure 14 Sequencing results at the PMS2 Exon15 qPCR primer-probe in Example 4 of the present invention

[0070] Figure 15 Detection result diagram of PMS2 Exon 1 in Example 4 of the present invention

[0071] Figure 16 Detection result diagram of PMS2 Exon 15 in Example 4 of the present invention Detailed implementation manners

[0072] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0073] Unless otherwise specified, the technical means used in the embodiments are all conventional methods. Unless otherwise stated, the reagents and consumables involved in the embodiments can be obtained from commercial channels. In the following fluorescence quantitative PCR experiments of the embodiments, two repeated experiments are set, and the results are averaged. The construction processes of the seven plasmids designed in the present invention are the same. The following embodiments are detailed descriptions for the MLH1, MSH2, MSH6, and PMS2 genes. For the construction methods of the other three plasmids, only the practical primer-probes are different, and the experimental reagents and system methods involved are the same as those of the MLH1, MSH2, MSH6, and PMS2 genes.

[0074] Example 1

[0075] Construction method of MLH1 positive plasmid

[0076] S101: Extract the genomic DNA of 2 cases of wild-type human peripheral blood, and the extraction process is carried out according to the operation manual of (Tiangen, DP304);

[0077] S102: Construct a positive plasmid;

[0078] S102-1: Primer design and synthesis. MLH1 Exon1-F2R2 and MLH1 Exon1-probe2 are primer-probe combinations for detecting MLH1 exon1, and MLH1 Exon19-F2R2 and MLH1 Exon19-probe4 are primer-probe combinations for detecting MLH1 exon19. The following primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0079] The F1R1 primer pair (as shown in SEQ ID NO.10-11) amplifies the RNase P DNA fragment;

[0080] The F2R2 primer pair (as shown in SEQ ID NO.12-13) amplifies a partial DNA fragment of MLH1 intron18-exon19; the F3R3 primer pair (as shown in SEQ ID NO.14-15) amplifies the DNA fragment of plant papain.

[0081] The F4R4 primer pair (as shown in SEQ ID NO.16-17) amplifies a partial DNA fragment of MLH1 exon1+intron1;

[0082] The F5R5 primer pair (as shown in SEQ ID NO.18-19) amplifies the RNase P DNA fragment.

[0083] MLH1 Exon1 F2: AGACGTTTCCTTGGCTCTTCTG

[0084] MLH1 Exon1 R2: CAGTTCTCAATCATCTCTTTGATAGCA

[0085] MLH1 Exon1 probe2: TAGCTGGCCGCTGGATAACTTCCC

[0086] MLH1 Exon19 F2: CTCCTGGAAGTGGACTGTGGAA

[0087] MLH1 Exon19 R2: GTATAGATCAGGCAGGTTAGCAAGC

[0088] MLH1 Exon19 probe2: ACATTGTCTATAAAGCCTTGCGCTCACAC

[0089] S102-2: Amplification and recovery of target fragments

[0090] Amplify the fragment to be inserted into the vector according to the above primers. The amplification system and procedure are carried out according to the operation manual of Phanta SE Super-Fidelity DNA Polymerase (Novizan, 7E702K3), and the PCR product is recovered by cutting the gel according to the operation manual of SanPrep Column DNA Gel Recovery Kit (Sangon Biotech, B518131-0100). Among them, the amplification of the gene to be detected and RNase P uses the human genomic DNA extracted in step S101 as the template, and the plant sequence is synthesized by Sangon Biotech and then ligated to the T vector as the template, as shown in SEQ ID NO.9.

[0091] S102-3: Ligate and construct the recombinant plasmid. According to -Basic Seamless Cloning and Assembly Kit (TransGen Biotech, CU201-02) operation manual, carry out the ligation reaction of the obtained gene fragment and PUC57 vector.

[0092] S102-4: Extract the positive plasmid in the positive bacteria. According to the instruction manual of Trans1-T1 Phage Resistant Chemically Competent Cell (TransGen Biotech, CD501-02), transfer the recombinant plasmid obtained in step S102-3 into Trans1-T1 Phage Resistant Chemically Competent Cell. After overnight culture, spread on the plate to obtain monoclonal strains. After the monoclonal bacteria are expanded in culture, colony PCR electrophoresis verification is carried out with the universal primers M13F and M13R on the plasmid. Send the strains with positive electrophoresis verification to Sangon Biotech Co., Ltd. for first-generation sequencing. The detection results can be seen in Figure 1 and Figure 2 , confirm that the vector construction is successful and there is no mutation at the qPCR primer probe. After determining the positive host bacteria, extract the plasmid, add 50% glycerol to the bacterial solution, and store it at -80 °C.

[0093] 2. Verification of the repeatability and stability of the MLH1 positive control

[0094] (I) Fluorescent quantitative PCT system and conditions

[0095] After diluting the plasmid DNA extracted in step S102-4 above to 0.5 ng, then dilute it to 10 -5Using [[sample]] as the sample, qPCR fluorescence quantification was performed. MLH1 Exon1-F2R2, MLH1 Exon1-probe2, MLH1 Exon13-F2R2, and MLH1 Exon19-probe2 were used as the primer and probe for fluorescence quantitative PCR amplification to detect the copy numbers of exon1 and exon19 of MLH1. Four replicates were made for each sample, and samples with known MLH1 gene copy numbers were detected to verify the accuracy of the detection results of the system. The reaction system is as follows.

[0096] Table 8. Reaction system

[0097]

[0098] Note: System 1 is for the MLH1 exon1 amplification fragment with a GC content of 55% and 2 mM MgCL2, and system 2 is for the MLH1 exon19 amplification fragment with a GC content of 45% and 2 mM MgCL2

[0099] (2) qPCR for specific reactions

[0100] In the qPCR program for specific reactions, the experimental instrument used was: Applied Biosystems TM 7500 Real-Time Fluorescence Quantitative PCR System

[0101] Table 9. Implementation of the fluorescence quantitative PCR program

[0102]

[0103] (3) Obtaining the detection results

[0104] The detection results obtained from the above steps are shown in Table 10 and Table 11:

[0105] Table 10. Detection results table of MLH1 exon1

[0106] SampleName Target Reference CNCalculated CNPredicted Confidence Z-score GM04127 exon RNaseP 2.74 3 0.84 1.52 MLH1deletionqPCR-4 / 2 exon RNaseP 0.99 1 >0.99 0.0 MLH1deletionqPCR-5 / 2 exon RNaseP 0.93 1 >0.99 0.0 Sample1 exon RNaseP 1.98 2 >0.99 0.08 Sample2 exon RNaseP 2.06 2 >0.99 0.06 Sample3 exon RNaseP 1.94 2 >0.99 0.11 Sample4 exon RNaseP 2.07 2 >0.99 0.14 Sample5 exon RNaseP 2.01 2 >0.99 0.03 Sample6 exon RNaseP 1.88 2 >0.99 0.68 Sample7 exon RNaseP 2.03 2 >0.99 0.03 Sample8 exon RNaseP 2.12 2 >0.99 0.39

[0107] Table 11. Detection results table of MLH1 exon19

[0108] SampleName Target Reference CNCalculated CNPredicted Confidence Z-score GM04127 exon RNaseP 3.04 3 0.98 0.01 MLH1deletionqPCR-4 / 2 exon RNaseP 1.2 1 >0.99 2.51 MLH1deletionqPCR-5 / 2 exon RNaseP 1.12 1 >0.99 0.9 Sample1 exon RNaseP 1.97 2 >0.99 0.04 Sample2 exon RNaseP 1.93 2 >0.99 0.14 Sample3 exon RNaseP 1.97 2 >0.99 0.03 Sample4 exon RNaseP 1.89 2 >0.99 0.36 Sample5 exon RNaseP 1.92 2 >0.99 0.1 Sample6 exon RNaseP 1.89 2 >0.99 0.33 Sample7 exon RNaseP 2.04 2 >0.99 0.07 Sample8 exon RNaseP 2.26 2 0.99 1.74

[0109] Note: sample1-8 are negative samples with 2 copies, MLH1 deletion qPCR-4 / 2 and MLH1 deletion qPCR-5 / 2 are constructed positive plasmids, and GM04127 is a sample with an NGS result of 3 copies.

[0110] From Figure 1 、 Figure 2As can be seen from Table 10 and Table 11, the qPCR experimental results are consistent with the expectations for the copy number detection results of the positive control product, samples, and cell lines, indicating that the MLH1 positive control product prepared by the method provided by the present invention can be used as a positive control product for the detection of large fragment deletions in the MLH1 gene of colorectal cancer.

[0111] Example 2

[0112] 1. Construction method of MSH2 positive plasmid

[0113] S201-202 is the same as S101-S102 in Example 1, with the difference being that:

[0114] S202-1: Primer design and synthesis. MSH2 Exon1-F1R1 and MSH2 Exon1-probe1 are the primer-probe combinations for detecting MSH2 Exon1, and MSH2 Exon16-F1R1 and MSH2 Exon16-probe 1 are the primer-probe combinations for detecting MSH2 Exon16. The following primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0115] The F1R1 primer pair (shown in SEQ ID NO.10 and SEQ ID NO.20) amplifies the RnaseP DNA fragment;

[0116] The F2R2 primer pair (shown in SEQ ID NO.21-22) amplifies a partial DNA fragment of MSH2 Intron15+Exon16;

[0117] The F3R3 primer pair (shown in SEQ ID NO.23-24) amplifies the DNA fragment of plant papain;

[0118] The F4R4 primer pair (shown in SEQ ID NO.25-26) amplifies a partial DNA fragment of MSH2 Intron1+Exon1;

[0119] The F5R5 primer pair (shown in SEQ ID NO.27 and SEQ ID NO.19) amplifies the RnaseP DNA fragment.

[0120] RnaseP-F: 5’-CGGAGGGAAGCTCATCAG-3’

[0121] RnaseP-R: 5’-CCCTAGTCTCAGACCTTCCCA-3’

[0122] RnaseP-Probe: 5’-CCACGAGCTGAGTGCGTCCTGTC-3’

[0123] MSH2 Exon1-F1: 5’-GCTGATTGGGTGTGGTCGC-3’

[0124] MSH2 Exon1-R1: 5’-GCCCTGAAAGAAGCGCAC-3’

[0125] MSH2 Exon1-Probe1: 5’-AAGCCGACCTCGGCCGCGCT-3’

[0126] MSH2 Exon16-F1: 5’-ATAGTGTTAACTGTCAGTGCCCAT-3’

[0127] MSH2 Exon16-R1: 5’-AGCACATCACTTATTATTGCCTATGTC-3’

[0128] MSH2 Exon16-probe1: 5’-TGCAAACAGTCCTCAGTTACAGCTCTCA-3’

[0129] S202-4: The same as S102-4 in Example 1. For the detection results of the first-generation sequencing of the strain, please refer to Figure 5 and Figure 6 。

[0130] 2. Verification of the repeatability and stability of the MSH2 positive control

[0131] (I) Fluorescent quantitative PCR system and conditions

[0132] Using the same fluorescent quantitative PCR system and conditions as described in Example 1, samples with known MSH2 gene copy numbers were detected to verify the accuracy of the detection results of the system. The specific reaction system for the MSH2 gene is as follows:

[0133] Table 12. GC content of the amplified fragment of MSH2 exon1 is 60%

[0134]

[0135] Table 13. GC content of the amplified fragment of MSH2 exon16 is 31%

[0136]

[0137]

[0138] (II) PCR for specific reactions

[0139] Using the same specific reaction qPCR as in Example 1, the real-time fluorescent quantitative PCR program is shown in Table 9.

[0140] (III) Obtaining the detection result

[0141] For the specific detection results obtained in the above steps, please refer to Table 14 and Table 15:

[0142] Table 14. Detection result table of MSH2 exon1

[0143] Sample Target Reference CNCalculated CNPredicted Confidence Z-score MSH2-1 Exon RnaseP 1.17 1 >0.99 3.23 MSH2-2 Exon RnaseP 1.1 1 >0.99 2.16 negativesample Exon RnaseP 1.84 2 >0.99 1.14 Sample1 Exon RnaseP 2.01 2 >0.99 0.07 Sample2 Exon RnaseP 2.01 2 >0.99 0.09 Sample3 Exon RnaseP 1.92 2 >0.99 0.13 Sample4 Exon RnaseP 1.89 2 >0.99 0.51 Sample5 Exon RnaseP 2.1 2 >0.99 1.13 Sample6 Exon RnaseP 2.03 2 >0.99 0.24 Sample7 Exon RnaseP 2.02 2 >0.99 0.1 Sample8 Exon RnaseP 1.91 2 >0.99 0.2

[0144] Table 15. Detection result table of MSH2 exon16

[0145] Sample Target Reference CNcalculated CNpredicted Confidence Z-score MSH2-1 Exon RNaseP 1.27 1 >0.99 4.91 MSH2-2 Exon RNaseP 1.26 1 >0.99 4.85 negativesample Exon RNaseP 1.84 2 >0.99 0.85 Sample1 Exon RNaseP 1.91 2 >0.99 0.05 Sample2 Exon RNaseP 1.83 2 >0.99 1.05 Sample3 Exon RNaseP 1.94 2 >0.99 0.02 Sample4 Exon RNaseP 1.94 2 >0.99 0.03 Sample5 Exon RNaseP 1.97 2 >0.99 0.06 Sample6 Exon RNaseP 1.93 2 >0.99 0.03 Sample7 Exon RNaseP 2.05 2 >0.99 0.69 Sample8 Exon RNaseP 2.11 2 >0.99 1.43

[0146] Note: sample1 - 8 are samples of negative cell lines with 2 copies, negative sample is a random negative 2 - copy sample, and MSH2 - 1 and MSH2 - 2 are MSH2 plasmids constructed and diluted

[0147] From Figure 5, Figure 6 As can be seen from Table 14 and Table 15, the qPCR experimental results for the copy number detection of positive control products, samples, and cell lines are all consistent with the expectations, indicating that the MUTYH positive control product prepared by the method provided in the present invention can be used as a positive control product for the detection of large - fragment deletions of the MUTYH gene in colorectal cancer.

[0148] Example 3

[0149] 1. Construction method of MSH6 positive plasmid

[0150] S301 - 302 is the same as S101 - S102 in Example 1, with the difference being that:

[0151] S302 - 1: Primer design and synthesis. MSH6 Exon1 - F4R4 and MSH6 Exon1 - probe3 are primer - probe combinations for detecting MSH6 exon1, MSH6 Exon10 - F1R1 and MSH6 Exon10 - probe1 are primer - probe combinations for detecting MSH6 exon10, and RnaseP - FR and RnaseP Probe are primer - probe combinations for detecting RnaseP. The following primers and probes are synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0152] The F1R1 primer pair (shown in SEQ ID NO.10 and SEQ ID NO.28) amplifies the RnaseP DNA fragment;

[0153] The F2R2 primer pair (as shown in SEQ ID NO.29-30) amplifies a partial DNA fragment of MSH6 exon 7+intron7+exon8+intron8+

[0154] exon 9+intron 9+exon 10+intron 10;

[0155] The F3R3 primer pair (as shown in SEQ ID NO.31-32) amplifies the DNA fragment of plant papain;

[0156] The F4R4 primer pair (as shown in SEQ ID NO.33-34) amplifies a partial DNA fragment of MSH6 exon1+intron1;

[0157] The F5R5 primer pair (as shown in SEQ ID NO.35 and SEQ ID NO.19) amplifies the RnaseP DNA fragment.

[0158] MSH6 Exon1-F4: 5’-CGCGTCACCGCCCAA-3’

[0159] MSH6 Exon1-R4: 5’-CAGCAGGCGCTACCGA-3’

[0160] MSH6 Exon1-probe3: 5’-CGCAGCCCTCCGTTGAGGTTCT-3’

[0161] MSH6 Exon10-F1: 5’-CTGTAGATGCTGAAGCTGTCCATAAAT-3’

[0162] MSH6 Exon10-R1: 5’-AGTTTATTAGATCATAATGTTGTCTGAATTTACC-3’

[0163] MSH6 Exon10-probe1: 5-CCTTTGTCAGAAGTCAACTCAAAGCTTCCA-3’

[0164] RnaseP:F: 5’-CGGAGGGAAGCTCATCAG-3’

[0165] RnaseP:R: 5’-CCCTAGTCTCAGACCTTCCCA-3’

[0166] RnaseP Probe: 5’-CCACGAGCTGAGTGCGTCCTGTC-3’

[0167] S302-4: Same as S102-4 in Example 1. For the detection results of the first-generation sequencing of the strain, please refer to Figure 9 and Figure 10 .

[0168] 2. Verification of the Repeatability and Stability of the MSH6 Positive Control

[0169] (I) Fluorescent Quantitative PCR System and Conditions

[0170] Using the fluorescent quantitative PCR system and conditions described in Example 1, samples with known MSH6 gene copy numbers were detected to verify the accuracy of the system detection results. The specific reaction system for the MSH6 gene is as follows:

[0171] Table 16. GC content of the amplified fragment of MSH6 exon 1 is 68%

[0172]

[0173]

[0174] Table 17. GC content of the amplified fragment of MSH6 Exon10 is 35%, 2 mM MgCL2

[0175]

[0176] (II) PCR for Specific Reactions

[0177] Same as the specific reaction qPCR steps in Example 1. The real-time fluorescent quantitative PCR program is shown in Table 9.

[0178] (III) Obtaining Detection Results

[0179] For the specific detection results obtained from the above steps, please refer to Table 18 and Table 19:

[0180] Table 18. Detection Results Table of MSH6 Exon1

[0181] Sample Target Reference CNCalculated CNpredicted Confidence Z-score MSH6-1 Exon RNaseP 0.99 1 >0.99 0.01 MSH6-2 Exon RNaseP 0.98 1 >0.99 0.0 negativesample Exon RNaseP 1.99 2 >0.99 0.04 Sample1 Exon RNaseP 2.01 2 >0.99 0.08 Sample2 Exon RNaseP 1.95 2 >0.99 0.12 Sample3 Exon RNaseP 1.86 2 >0.99 0.79 Sample4 Exon RNaseP 1.84 2 >0.99 1.05 Sample5 Exon RNaseP 2.1 2 >0.99 0.65 Sample6 Exon RNaseP 2.02 2 >0.99 0.08 Sample7 Exon RNaseP 2.07 2 >0.99 0.18 Sample8 Exon RNaseP 1.98 2 >0.99 0.05

[0182] Table 19. Detection Results Table of MSH6 Exon10

[0183] Sample Target Reference CNCalculated CNpredicted Confidence Z-score MSH6-1 Exon RNaseP 0.71 1 >0.99 0.0 MSH6-2 Exon RNaseP 0.79 1 >0.99 0.0 negativesample Exon RNaseP 1.73 2 >0.99 1.42 Sample1 Exon RNaseP 1.93 2 >0.99 0.18 Sample2 Exon RNaseP 1.98 2 >0.99 0.06 Sample3 Exon RNaseP 2.1 2 >0.99 0.04 Sample4 Exon RNaseP 2.23 2 >0.99 0.52 Sample5 Exon RNaseP 1.98 2 >0.99 0.06 Sample6 Exon RNaseP 2.0 2 >0.99 0.03 Sample7 Exon RNaseP 2.17 2 >0.99 0.14 Sample8 Exon RNaseP 2.34 2 >0.99 1.1

[0184] Note: sample1-8 are negative cell lines with 2 copies, negative sample is a random negative 2-copy sample, and MSH6-1 and MSH6-2 are constructed and diluted MSH6 plasmids

[0185] From Figure 9 、 Figure 10As can be seen from Table 18 and Table 19, the qPCR experimental results are consistent with the expectations for the copy number detection results of the positive control product, samples, and cell lines, indicating that the MSH6 positive control product prepared by the method provided by the present invention can be used as a positive control product for the detection of large fragment deletions of the MSH6 gene in colorectal cancer.

[0186] Example 4

[0187] 1. Construction method of PMS2 positive plasmid

[0188] S401-402 is the same as S101-S102 in Example 1, except that:

[0189] S402-1: Primer design and synthesis. PMS2 Exon1-F2R3 and PMS2 Exon1-probe2 are primer-probe combinations for detecting PMS2 exon1, PMS2 Exon19-F1R1 and PMS2 Exon15-probe1 are primer-probe combinations for detecting PMS2 exon15, and RnaseP-FR and RnaseP Probe are primer-probe combinations for detecting RnaseP. The following primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0190] The F1R1 primer pair (shown in SEQ ID NO.10 and SEQ ID NO.52) amplifies the RnaseP DNA fragment;

[0191] The F2R2 primer pair (shown in SEQ ID NO.53-54) amplifies a partial DNA fragment of PMS2 intron14+exon15; the F3R3 primer pair (shown in SEQ ID NO.55-56) amplifies the DNA fragment of plant papain;

[0192] The F4R4 primer pair (shown in SEQ ID NO.57-58) amplifies a partial DNA fragment of PMS2 exon1+intron1;

[0193] The F5R5 primer pair (shown in SEQ ID NO.59 and SEQ ID NO.19) amplifies the RnaseP DNA fragment.

[0194] PMS2 Exon1 F2: 5’-CGGATCGGGTGTTGCAT-3’

[0195] PMS2 Exon1 R3: 5’-GGAGGTTGGAATGCCGT-3’

[0196] PMS2 Exon1 probe2: 5’-GGAGGTTGGAATGCCGT-3’

[0197] PMS2 Exon19 F1: 5-TGAAGAAACTGATCACCCACA-3’

[0198] PMS2 Exon19 R1: 5’-GGCGATGTGTCTCATGGT-3’

[0199] PMS2 Exon19 probe1:5’-TGGACCACCCCTGGAACTGTCCC-3’

[0200] RnaseP F: 5’-CGGAGGGAAGCTCATCAG-3’

[0201] RnaseP R: 5’-CCCTAGTCTCAGACCTTCCCA-3’

[0202] RnaseP Probe: 5’-CCACGAGCTGAGTGCGTCCTGTC-3’

[0203] S402-4: The same as S102-4 in Example 1. For the detection results of the first-generation sequencing of the strain, please refer to Figure 13 and Figure 14 .

[0204] 2. Verification of the repeatability and stability of the PMS2 positive control product

[0205] (1) Fluorescent quantitative PCR system and conditions

[0206] Using the same fluorescent quantitative PCR system and conditions as described in Example 1, samples with known PMS2 gene copy numbers were detected to verify the accuracy of the detection results of the system. The specific reaction system for PMS2 is as follows:

[0207] Table 20. GC content of the amplified fragment of PMS2 exon 1 is 64%

[0208]

[0209] Table 21. GC content of the amplified fragment of PMS exon15 is 57%

[0210]

[0211] (2) PCR for specific reactions

[0212] Using the same specific reaction qPCR steps as in Example 1, the real-time fluorescent quantitative PCR program is shown in Table 9.

[0213] (III) Obtaining the detection results

[0214] Please refer to Table 22 and Table 23 for the specific detection results obtained in the above steps:

[0215] Table 22. Detection Results Table of PMS2 Exon1

[0216] Sample Target Reference CNCalculated CNpredicted Confidence Z-score Samplel Exon RNaseP 2.06 2 >0.99 1.24 Sample10 Exon RNaseP 1.07 1 >0.99 2.54 Sample11 Exon RNaseP 1.06 1 >0.99 2.18 Sample2 Exon RNaseP 2.03 2 >0.99 0.4 Sample3 Exon RNaseP 1.95 2 >0.99 0.11 Sample4 Exon RNaseP 2.0 2 >0.99 0.1 Sample5 Exon RNaseP 1.91 2 >0.99 0.63 Sample6 Exon RNaseP 1.94 2 >0.99 0.11 Sample7 Exon RNaseP 1.93 2 >0.99 0.19 Sample8 Exon RNaseP 1.96 2 >0.99 0.07 Sample9 Exon RNaseP 1.95 2 >0.99 0.09

[0217] Table 23. Detection Results Table of PMS Exon 9

[0218] Sample Target Reference CNCalculated CNpredicted Confidence Z-score Samplel Exon RNaseP 1.98 2 >0.99 0.03 Sample10 Exon RNaseP 0.66 1 >0.99 0.03 Sample11 Exon RNaseP 0.68 1 >0.99 0.14 Sample2 Exon RNaseP 2.01 2 >0.99 0.03 Sample3 Exon RNaseP 2.1 2 >0.99 0.08 Sample4 Exon RNaseP 1.98 2 >0.99 0.03 Sample5 Exon RNaseP 2.02 2 >0.99 0.03 Sample6 Exon RNaseP 1.99 2 >0.99 0.02 Sample7 Exon RNaseP 2.07 2 >0.99 0.05 Sample8 Exon RNaseP 2.04 2 >0.99 0.02 Sample9 Exon RNaseP 1.02 1 0.99 1.31

[0219] Note: Among them, sample1-8 are negative cell lines with 2 copies, sample9 is a random negative sample with 2 copies, and sample10-11 are constructed positive quality control products

[0220] From Figure 13 、 Figure 14 and Table 22 and Table 23, it can be seen that the qPCR experimental results are consistent with the expected results for the copy number detection of positive quality control products, samples, and cell lines, indicating that the PMS2 positive quality control product prepared by the method provided by the present invention can be used as a positive quality control product for the detection of large fragments of the PMS2 gene in colorectal cancer.

[0221] It should be noted that in this article, relational terms such as first and second are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the term "comprising", "including" or any other variant thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device comprising a series of elements not only includes those elements, but also includes other elements not expressly listed, or elements inherent to such process, method, article or device.

[0222] It should be noted that the above content only illustrates the technical idea of the present invention and cannot be used to limit the protection scope of the present invention. For those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and retouches can be made, and these improvements and retouches all fall within the protection scope of the claims of the present invention.

Claims

1. A positive quality control product for detecting large fragment deletion of colorectal cancer gene, characterized in that: The positive quality control product comprises a recombinant plasmid of a gene to be detected, wherein the recombinant plasmid of the gene to be detected is a recombinant plasmid comprising four gene fragments: the first exon of the gene to be detected, a plant sequence, the last exon of the gene to be detected, and RNase P; the genes to be detected include MLH1 / MSH2 / MSH6 / PMS2 / EPCAM / MUTYH / STK11.

2. A positive quality control product for detecting large fragment deletion of colorectal cancer gene according to claim 1, characterized in that: The fragment sequences of the MLH1 / MSH2 / MSH6 / PMS2 / EPCAM / MUTYH / STK11 gene recombinant plasmids are: The fragment sequence of the MLH1 gene recombinant plasmid is shown in SEQ ID NO.

1. The fragment sequence of the MSH2 gene recombinant plasmid is shown in SEQ ID NO.

2. The fragment sequence of the MSH6 gene recombinant plasmid is shown in SEQ ID NO.

3. The fragment sequence of the PMS2 gene recombinant plasmid is shown in SEQ ID NO.

4. The fragment sequence of the EPCAM gene recombinant plasmid is shown in SEQ ID NO.

5. The fragment sequence of the MUTYH gene recombinant plasmid is shown in SEQ ID NO.

6. The fragment sequence of the STK11 gene recombinant plasmid is shown in SEQ ID NO.

7.

3. A method for preparing a positive quality control product for detecting large fragment deletion of colorectal cancer genes, characterized in that: The preparation method comprises the following steps: S1: Extract wild-type human peripheral whole blood genomic DNA; S2: Extract positive plasmid; S2-1: Design and synthesize primers for RNase P, the first exon and the last exon fragment of the gene sequence to be detected, and the plant sequence required for connection to the four recombinant plasmids of the genes to be detected. The upstream and downstream of the primers should add corresponding homology arm sequences according to the preset connection order; the genes to be detected include MLH1 / MSH2 / MSH6 / PMS2 / EPCAM / MUTYH / STK11, and the plant sequence is shown in SEQ ID NO.9; S2-2: PCR amplification and gel recovery of the target fragments contained in the primers, wherein the amplification of the genes to be detected and RNase P uses the human genomic DNA extracted in step S1 as a template, and the plant sequence is artificially synthesized and connected to the T vector as a template; S2-3: Connect and construct the recombinant plasmid of the genes to be detected and transform it into the host bacteria, and select a single colony for PCR electrophoresis verification; S2-4: Confirm the PCR products of the colonies using first-generation sequencing technology; S2-5: Extract the positive plasmid in the positive host bacteria; S3: Use the qPCR method to calculate the corresponding gene copy number in the recombinant plasmid of the gene to be detected through CopyCaller v2.1; S4: Verification of repeatability and stability of positive quality control products; The seven gene recombinant plasmids to be detected are the gene recombinant plasmids to be detected as described in any one of claim 2.

4. The method for preparing a positive quality control product for detecting large fragment deletion of colorectal cancer gene according to claim 3, characterized in that: The primer pair sequence of the last exon fragment and the primer pair sequence of the first exon fragment of the MLH1 / MSH2 / MSH6 / EPCAM / MUTYH / PMS2 / STK11 gene sequence are respectively: The primer pair sequences of the last exon fragment of the MLH1 gene sequence are shown in SEQ ID NO.12 and SEQ ID NO.13, and the primer pair sequences of the first exon fragment are shown in SEQ ID NO.16 and SEQ ID NO.17; The primer pair sequences of the last exon fragment of the MSH2 gene sequence are shown in SEQ ID NO.21 and SEQ ID NO.22, and the primer pair sequences of the first exon fragment are shown in SEQ ID NO.25 and SEQ ID NO.26; The primer pair sequences of the last exon fragment of the MSH6 gene sequence are shown in SEQ ID NO.29 and SEQ ID NO.30, and the primer pair sequences of the first exon fragment are shown in SEQ ID NO.33 and SEQ ID NO.34; The primer pair sequences of the last exon fragment of the EPCAM gene sequence are shown in SEQ ID NO.37 and SEQ ID NO.38, and the primer pair sequences of the first exon fragment are shown in SEQ ID NO.41 and SEQ ID NO.42; The primer pair sequences of the last exon fragment of the MUTYH gene sequence are shown in SEQ ID NO.45 and SEQ ID NO.46, and the primer pair sequences of the first exon fragment are shown in SEQ ID NO.49 and SEQ ID NO.50; The primer pair sequences of the last exon fragment of the PMS2 gene sequence are shown in SEQ ID NO.53 and SEQ ID NO.54, and the primer pair sequences of the first exon fragment are shown in SEQ ID NO.57 and SEQ ID NO.58; The primer pair sequences of the last exon fragment of the STK11 gene sequence are shown in SEQ ID NO.61 and SEQ ID NO.62, and the primer pair sequences of the first exon fragment are shown in SEQ ID NO.65 and SEQ ID NO.66.

Images