Porcine parvovirus VP2 double-antibody sandwich quantitative detection kit and application thereof
By using specific monoclonal antibodies PPV-11F3 and PPV-12C4 in the detection of porcine parvovirus VP2 antigen, a double-antibody sandwich ELISA method was established, which solved the problem of insufficient detection sensitivity and specificity in the prior art, and achieved the effect of rapid and accurate quantitative detection.
Patent Information
- Application Number
- CN202510058367.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-15
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2045-01-15
AI Technical Summary
The prior art has low sensitivity and poor specificity when detecting porcine parvovirus VP2 antigen, and the traditional method has a long operating time, making it difficult to meet the needs of fast and accurate quantitative detection.
The monoclonal antibody PPV-11F3 of the porcine parvovirus VP2 protein was used as the capture antibody and the enzyme-labeled antibody made of PPV-12C4 was used as the detection antibody to establish a double-antibody sandwich ELISA method, which combined with different antigenic determinants of antigen molecules to improve the specificity and sensitivity of the detection.
It realizes rapid and accurate detection of VP2 antigen of pig parvovirus, with high sensitivity and good specificity, simple operation steps and short time, suitable for large-scale sample detection.
Smart Images

Figure BDA0005242097660000131 
Figure BDA0005242097660000181 
Figure BDA0005242097660000201
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biological detection, and more specifically, relates to a double-antibody sandwich ELISA kit for porcine parvovirus VP2 protein, which is suitable for specific, rapid, and accurate quantitative detection of porcine parvovirus VP2 antigen. Background Art
[0002] Porcine parvovirus (PPV) was first discovered by Mary and Mahnel in 1966. Since then, it has been detected in many countries and regions in Europe, America, Asia, etc., and is now widely present all over the world. PPV is susceptible to pig herds of all ages. After infecting pregnant sows, it can cause obvious clinical symptoms such as abortion, fetal malformation, and mummified fetuses. While boars, fattening pigs, and piglets can be infected and carry the virus, the clinical symptoms are mostly not obvious, which brings certain difficulties to the prevention and control of this disease. The VP2 protein of PPV is the main protein constituting the virus capsid, which contains the main B-cell epitopes and T-cell epitopes of PPV and is the main immunogenic protein of PPV. Therefore, the VP2 protein has become an important focus in the research of clinical diagnosis, immunology, and vaccines of porcine parvovirus disease.
[0003] The quality of the vaccine is closely related to the content of the effective antigen. In the current regulations, the semi-finished product quantitative method for porcine parvovirus inactivated vaccine adopts two methods: TCID 50 and hemagglutination, and the method for evaluating the finished product adopts the method of measuring the hemagglutination inhibition titer by immunizing guinea pigs or pigs and collecting blood. TCID 50The assay is a classic method for evaluating virus content by observing cytopathic effects caused by virus-infected cells. However, this method has a long operation time and is only applicable to the quantification of semi-finished whole-virus vaccines. For vaccines such as subunit vaccines that do not contain live porcine parvovirus, this method is not applicable. Hemagglutination and hemagglutination inhibition tests are based on the fact that intact PPV virus particles carry hemagglutinins, which can cause the agglutination of red blood cells of some animals in vitro. When antibodies against porcine parvovirus bind to the antigen, it will lose its agglutination effect on red blood cells. This method has the advantages of easy operation, short time consumption, low cost, and convenient batch detection. However, its sensitivity is relatively low and its specificity is poor. Clinically, for the evaluation of the quality of vaccine products, some group customers use a simple fluorescence quantitative method. This method is a detection method based on the specificity of primers and probes, and has the advantages of rapidity, sensitivity, and specificity. However, the nucleic acid extraction step is often involved in the operation process. Since nucleic acid is extremely prone to aerosol contamination, the false positive rate of the detection results is relatively high. At the same time, the degree of damage of inactivators to nucleic acid in antigen production is different, and this method cannot effectively reflect the quality of vaccines. Therefore, it is imperative to establish a simple and convenient detection method that can reflect the content of effective antigens in vaccines. Enzyme-linked immunosorbent assay (ELISA) is a solid-phase enzyme immunoassay method that combines the specificity of antigen-antibody reactions and the high efficiency of enzyme-substrate reactions. Due to its strong specificity, high sensitivity, good repeatability, ease of operation, and convenient batch detection, it has been widely used in the detection of various viruses.
[0004] The present invention uses the monoclonal antibody PPV-11F3 against porcine parvovirus VP2 protein as the capture antibody, and the enzyme-labeled antibody prepared from the monoclonal antibody PPV-12C4 against porcine parvovirus VP2 protein as the detection antibody to establish a double-antibody sandwich ELISA method for rapid quantitative detection of porcine parvovirus. In the reaction, the two antibodies bind to different antigenic determinants of the antigen molecule, greatly improving the specificity of the detection and making the detection results more credible. The operation steps of the double-antibody sandwich ELISA method are simple and time-consuming, and the professional requirements for experimental personnel are relatively low. In addition, the reagents used in the double-antibody sandwich ELISA method are very common and the reagent prices are cheap, making the double-antibody sandwich ELISA method universal and applicable to the detection of a large number of samples, and more suitable for popularization in practical applications. The establishment of this method can not only be used for vaccine quality control in factory internal production, but also be used in combination with vaccines, which has far-reaching significance for providing high-quality services to customers. Summary of the Invention
[0005] The object of the present invention is to provide a double-antibody sandwich ELISA kit for specifically and quantitatively detecting the effective antigen protein VP2 of porcine parvovirus. The kit uses a monoclonal antibody PPV-11F3 that specifically binds to the VP2 protein of porcine parvovirus as the capture antibody, and an enzyme-labeled antibody prepared from a monoclonal antibody PPV-12C4 that specifically binds to the VP2 protein of porcine parvovirus as the detection antibody, and establishes a method for quantitatively detecting the effective antigen of porcine parvovirus with good specificity, sensitivity and repeatability, which is used to detect the content of the effective antigen protein VP2 of porcine parvovirus in culture solution, inactivated solution, concentrated solution and finished vaccine after demulsification during the production of porcine parvovirus inactivated vaccine or subunit vaccine.
[0006] Based on the above object, the double-antibody sandwich ELISA kit for specifically and quantitatively detecting the content of the effective antigen of porcine parvovirus of the present invention includes an enzyme-linked immunosorbent assay plate coated with a capture antibody and a detection antibody; the capture antibody is a monoclonal antibody PPV-11F3 that specifically binds to the VP2 protein of porcine parvovirus; the detection antibody is an enzyme-labeled antibody prepared from a monoclonal antibody PPV-12C4 that specifically binds to the VP2 protein of porcine parvovirus. The enzyme-labeled antibody is preferably an antibody labeled with horseradish peroxidase, and the horseradish peroxidase can be cross-linked to the antibody by the glutaraldehyde method.
[0007] Preferably, the capture antibody (monoclonal antibody PPV-11F3) contains a heavy chain variable region PPV-11F3-V H and a light chain variable region PPV-11F3-V L ; the complementarity-determining regions of the PPV-11F3-V H and the PPV-11F3-V L are all composed of CDR1, CDR2 and CDR3; the CDR1 amino acid sequence of the PPV-11F3-V H is shown as the amino acids at positions 31-35 of SEQ ID No.1; the CDR2 amino acid sequence of the PPV-11F3-V H is shown as the amino acids at positions 50-65 of SEQ ID No.1; the CDR3 amino acid sequence of the PPV-11F3-V H is shown as the amino acids at positions 99-111 of SEQ ID No.1; the CDR1 amino acid sequence of the PPV-11F3-V L is shown as the amino acids at positions 23-37 of SEQ ID No.2; the CDR2 amino acid sequence of the PPV-11F3-V L is shown as the amino acids at positions 52-59 of SEQ ID No.2; the CDR2 amino acid sequence of the PPV-11F3-V LThe CDR3 amino acid sequence is shown as the amino acids at positions 94 - 104 of SEQ ID No.2.
[0008] Preferably, the detection antibody (monoclonal antibody PPV - 12C4) contains a heavy chain variable region PPV - 12C4 - V H and a light chain variable region PPV - 12C4 - V L ; the complementarity - determining regions of the PPV - 12C4 - V H and the PPV - 12C4 - V L are all composed of CDR1, CDR2, and CDR3; the CDR1 amino acid sequence of the PPV - 12C4 - V H is shown as the amino acids at positions 31 - 35 of SEQ ID No.3; the CDR2 amino acid sequence of the PPV - 12C4 - V H is shown as the amino acids at positions 50 - 64 of SEQ ID No.3; the CDR3 amino acid sequence of the PPV - 12C4 - V H is shown as the amino acids at positions 99 - 105 of SEQ ID No.3; the CDR1 amino acid sequence of the PPV - 12C4 - V L is shown as the amino acids at positions 24 - 39 of SEQ ID No.4; the CDR2 amino acid sequence of the PPV - 12C4 - V L is shown as the amino acids at positions 55 - 61 of SEQ ID No.4; the CDR3 amino acid sequence of the PPV - 12C4 - V L is shown as the amino acids at positions 94 - 102 of SEQ ID No.4.
[0009] Preferably, the amino acid sequence of the PPV - 11F3 - V H is shown as SEQ ID No.1; the amino acid sequence of the PPV - 11F3 - V L is shown as SEQ ID No.2.
[0010] Preferably, the amino acid sequence of the PPV - 12C4 - V H is shown as SEQ ID No.3; the amino acid sequence of the PPV - 12C4 - V L is shown as SEQ ID No.4.
[0011] The optimal coating preparation method and conditions for the enzyme-linked reaction plate are as follows: Dilute the capture antibody (monoclonal antibody PPV-11F3) with a carbonate solution at pH 9.6 to a coating working solution of 1 μg / ml, then add it to a 96-well polystyrene enzyme-linked reaction plate, 100 μl per well, and place it at 2-8 °C for 8-12 hours to allow the capture antibody (monoclonal antibody PPV-11F3) to fully bind to the enzyme-linked reaction plate. Then add a PBS buffer solution containing 10 mg / ml bovine serum albumin at pH 7.4, 300 μl per well, and perform a blocking treatment at 37 °C for 2-3 hours. After centrifuging to dryness, seal and store it at 2-8 °C after the enzyme-linked reaction plate is dried.
[0012] Preferably, the kit further includes a porcine parvovirus VP2 protein standard. The porcine parvovirus VP2 protein standard is obtained by inoculating recombinant porcine parvovirus VP2 baculovirus (preserved in the China General Microbiological Culture Collection Center, preservation number CGMCC NO. 45384) into insect sf9 cells, and then culturing it in a constant temperature shaking incubator at 27 °C and 120 rpm. When the cell viability is lower than 20%, it can be harvested. Centrifuge the harvested culture solution at 8,000 rpm for 10 minutes, take the supernatant and load it onto an anion exchange chromatography column for purification to obtain purified porcine parvovirus VP2 protein with a purity of not less than 85%, a protein content of 50 μg / ml, aliquoted into 100 μl per tube, labeled, and stored at -70 °C or below for later use. When used, it is serially diluted (1:500 - 1:32000) with the sample diluent, and the measured OD 450 value is used to draw a standard curve.
[0013] The kit of the present invention is a double-antibody sandwich enzyme-linked immunosorbent assay quantitative detection kit made of a porcine parvovirus VP2 protein-specific monoclonal antibody, and quantitatively detects the content of the effective antigen protein VP2 of porcine parvovirus in a sample by detecting the signal change generated by the enzyme catalyzing the substrate.
[0014] Furthermore, the kit further includes a sample diluent, 20-fold concentrated washing solution, substrate solution A, substrate solution B, and termination solution. The enzyme-linked reaction plate is a detachable 96-well microtiter plate. The sample diluent is a 0.01 mol / L phosphate buffer solution containing 5 mg / ml casein, pH 7.4. The 20-fold concentrated washing solution is a 0.01 mol / L phosphate buffer solution containing 0.8%-1.2% (ml / ml) Tween-20, pH 7.4. Substrate solution A is a citrate phosphate buffer solution containing 0.6 mg / ml urea hydrogen peroxide, and substrate solution B is a 0.2 mg / ml tetramethylbenzidine solution. When used, the two are mixed at a volume ratio of 1:1. The termination solution is a 2 mol / L sulfuric acid solution.
[0015] The present invention also claims a monoclonal antibody that can specifically bind to the effective antigen protein VP2 of porcine parvovirus, and is the monoclonal antibody described in any one of the following:
[0016] (1) Comprising a heavy chain variable region PPV-11F3-V H and a light chain variable region PPV-11F3-V L ; the heavy chain variable region PPV-11F3-V H and the light chain variable region PPV-11F3-V L are both composed of a complementarity-determining region and a framework region; the complementarity-determining regions of the PPV-11F3-V H and the PPV-11F3-V L are both composed of CDR1, CDR2, and CDR3; the amino acid sequence of CDR1 of the PPV-11F3-V H is shown as the amino acids at positions 31-35 of SEQ ID No.1; the amino acid sequence of CDR2 of the PPV-11F3-V H is shown as the amino acids at positions 50-65 of SEQ ID No.1; the amino acid sequence of CDR3 of the PPV-11F3-V H is shown as the amino acids at positions 99-111 of SEQ ID No.1; the amino acid sequence of CDR1 of the PPV-11F3-V L is shown as the amino acids at positions 23-37 of SEQ ID No.2; the amino acid sequence of CDR2 of the PPV-11F3-V L is shown as the amino acids at positions 52-59 of SEQ ID No.2; the amino acid sequence of CDR3 of the PPV-11F3-V L is shown as the amino acids at positions 94-104 of SEQ ID No.2.
[0017] (2) Comprising a heavy chain variable region PPV-12C4-V H and a light chain variable region PPV-12C4-V L ; the heavy chain variable region PPV-12C4-V H and the light chain variable region PPV-12C4-V L are both composed of a complementarity-determining region and a framework region; the complementarity-determining regions of the PPV-12C4-V H and the PPV-12C4-V L are both composed of CDR1, CDR2, and CDR3; the amino acid sequence of CDR1 of the PPV-12C4-V H is shown as the amino acids at positions 31-35 of SEQ ID No.3; the amino acid sequence of CDR1 of the PPV-12C4-V HThe amino acid sequence of CDR2 is shown as the amino acids at positions 50 - 64 of SEQ ID No.3; the PPV-12C4-V H The amino acid sequence of CDR3 is shown as the amino acids at positions 99 - 105 of SEQ ID No.3; the PPV-12C4-V L The amino acid sequence of CDR1 is shown as the amino acids at positions 24 - 39 of SEQ ID No.4; the PPV-12C4-V L The amino acid sequence of CDR2 is shown as the amino acids at positions 55 - 61 of SEQ ID No.4; the PPV-12C4-V L The amino acid sequence of CDR3 is shown as the amino acids at positions 94 - 102 of SEQ ID No.4.
[0018] (3) Containing the heavy chain variable region PPV-11F3-V H and the light chain variable region PPV-11F3-V L ; the amino acid sequence of the PPV-11F3-V H is shown as SEQ ID No.1; the amino acid sequence of the PPV-11F3-V L is shown as SEQ ID No.2.
[0019] (4) Containing the heavy chain variable region PPV-12C4-V H and the light chain variable region PPV-12C4-V L ; the amino acid sequence of the PPV-12C4-V H is shown as SEQ ID No.3; the amino acid sequence of the PPV-12C4-V L is shown as SEQ ID No.4.
[0020] Through the above heavy chain variable region and light chain variable region sequences, it can be linked with animal-derived constant regions (such as mouse antibody heavy chain and light chain constant regions) to prepare a monoclonal antibody that can specifically bind to the effective antigen protein VP2 of porcine parvovirus.
[0021] The application of the above double antibody sandwich ELISA kit in specifically detecting the content of the effective antigen protein VP2 of porcine parvovirus also belongs to the protection scope of the present invention.
[0022] The application of the above monoclonal antibody that can specifically bind to the effective antigen protein VP2 of porcine parvovirus in preparing a kit for detecting porcine parvovirus also belongs to the protection scope of the present invention.
[0023] The method for obtaining the monoclonal antibody that can specifically bind to the effective antigen protein VP2 of porcine parvovirus is as follows: Immunize BALB / c mice with the porcine parvovirus VP2 protein expressed by recombinant baculovirus. Take the spleen cells of the immunized mice and fuse them with SP2 / 0 cells. The supernatant of the fused cells is screened by indirect immunofluorescence. The monoclonal cell line secreting PPV-11F3 and the monoclonal cell line secreting PPV-12C4 are used as the monoclonal cell lines for specifically detecting the porcine parvovirus VP2 protein. Use gene sequencing to determine the gene sequences of the above two specific monoclonal cell lines, and use gene synthesis to prepare the stably expressed monoclonal antibodies PPV-11F3 and monoclonal antibody PPV-12C4 by constructing a recombinant expression vector. After pairing, the monoclonal antibody PPV-11F3 is used as the capture antibody of the present invention, and the enzyme-labeled antibody prepared from the monoclonal antibody PPV-12C4 is used as the detection antibody of the present invention.
[0024] The detection procedure of the kit of the present invention is as follows:
[0025] (1) Equilibration: Take out the kit from the storage environment at 2 - 8°C, place it at room temperature for 30 minutes for equilibration and standby; mix the liquid reagents well before use.
[0026] (2) Preparation of working solution: Dilute the 20-fold concentrated washing solution 20-fold with distilled water or deionized water to obtain the working solution of the washing buffer.
[0027] (3) Sample dilution: Dilute the porcine parvovirus VP2 protein standard with the sample diluent at a dilution ratio of 1:500 - 1:32000, and the corresponding concentrations are 100 ng / ml, 50 ng / ml, 25 ng / ml, 12.5 ng / ml, 6.2 ng / ml, 3.1 ng / ml, 1.6 ng / ml. The sample to be tested is also diluted with the sample diluent in 3 - 6 gradients.
[0028] (4) Sample addition: Take out the required strips, put the remaining strips into an aluminum foil bag and seal it, and store it at 2 - 8°C for standby. Add the diluted sample to be tested, the diluted porcine parvovirus VP2 protein standard, and the negative control sample (only add the sample diluent) to the coated plate, 100 μl / well, and repeat 3 wells. The time span during the sample addition process should be as short as possible.
[0029] (5) Incubation: Mix well by shaking, place it in an incubator at 37°C, and react for 30 minutes.
[0030] (6) Plate washing: Discard the reaction solution, add the working solution of the washing buffer, 300 μl / well, soak for 15 seconds, discard the washing solution, and pat dry after washing the plate continuously 4 times.
[0031] (7) Addition of HRP-labeled detection antibody: Dilute the HRP-labeled detection antibody at a ratio of 1:4000, 100 μl / well.
[0032] (8) Incubation: Mix well by shaking and place in an incubator at 37°C for 30 minutes for reaction.
[0033] (9) Plate washing: Discard the reaction solution, add the working solution of washing buffer, 300 μl / well, soak for 15 seconds, discard the washing solution by centrifugation, and pat dry after washing the plate 4 times continuously.
[0034] (10) Color development: Add the working solution of substrate (mix equal volumes of substrate solution A and substrate solution B to obtain the working solution of substrate, prepare it freshly before use), 100 μl / well, mix well by shaking, place in an incubator at 37°C, and react for 15 minutes in the dark.
[0035] (11) Termination: Add the termination solution, 50 μl / well, mix well by shaking to terminate the reaction.
[0036] (12) Detection by microplate reader: Use a microplate reader to measure the OD 450nm value, and the detection should be carried out within 15 minutes after adding the termination solution to terminate the reaction.
[0037] (13) Result analysis: The OD 450nm value of the porcine parvovirus VP2 protein standard product (100 ng / ml) well should be ≥ 2.9, otherwise it is invalid; the OD 450nm value of the negative control well should be ≤ 0.25, otherwise it is invalid; Concentration calculation: Use the value obtained by subtracting the average OD 450nm value of the negative control well from the average OD 450nm value of each well of the protein standard product as the Y-axis, and the protein concentration of each well of the protein standard product as the X-axis to plot a standard curve, and calculate the content of the porcine parvovirus effective antigen protein VP2 in each test sample.
[0038] In the above detection method, the selection of test samples can be diverse, such as culture solution, inactivation solution, concentrated solution, and finished vaccine after demulsification during the production of porcine parvovirus inactivated vaccine or subunit vaccine.
[0039] The result analysis method in step (13) can be: Use the EXCEL program → "Insert" → "Scatter plot" → Use the value obtained by subtracting the average OD 450nm value of the negative control well from the average OD 450nm value of each well of the protein standard product as the Y-axis, and the protein concentration of each well of the protein standard product as the X-axis → "Add trendline" → Select "Linear" → Select "Display equation" and "Display R-squared value". Usually, R 2 ≥ 0.98 indicates that the standard curve is reliable. Each 96-well plate should be set with a porcine parvovirus VP2 protein standard product well and the corresponding standard curve should be plotted. According to the formula, subtract the average OD 450nm value of the negative control well from the average OD 450nmThe obtained average value is substituted to calculate the concentration of VP2 protein in the sample.
[0040] The positive effects of the present invention are as follows: The present invention provides a double-antibody sandwich ELISA detection kit for accurately quantifying the effective antigen protein VP2 of porcine parvovirus. This kit is a double-antibody method enzyme-linked immunosorbent quantitative detection kit made of two specific monoclonal antibodies against porcine parvovirus VP2 protein. It can quantitatively detect the content of the effective antigen protein VP2 of porcine parvovirus in the sample by detecting the signal change generated by the enzyme catalyzing the substrate, with high sensitivity, good specificity, good repeatability, and convenient operation, and no cross-reaction with PRV, PCV2, CSFV, and PRRSV. The development of this kit provides a more convenient and effective method for quality control in the production of porcine parvovirus vaccines, and has broad market prospects and good economic and social benefits. Brief Description of the Drawings
[0041] Figure 1 It is the SDS-PAGE result of the expression and purification of porcine parvovirus VP2 protein.
[0042] M: Protein Marker; 1: Supernatant of the recombinant baculovirus expressing porcine parvovirus VP2 protein; 2: Purified porcine parvovirus VP2 protein.
[0043] Figure 2 It is the indirect immunofluorescence result of two monoclonal antibodies and the recombinant baculovirus expressing porcine parvovirus VP2 protein.
[0044] Figure 3 It is the SDS-PAGE result after purification of the specific monoclonal antibodies PPV-11F3 and PPV-12C4 of porcine parvovirus VP2 protein.
[0045] A: SDS-PAGE after purification of the specific monoclonal antibody PPV-11F3 of porcine parvovirus VP2 protein; M: Protein Marker.
[0046] B: SDS-PAGE after purification of the specific monoclonal antibody PPV-12C4 of porcine parvovirus VP2 protein; M: Protein Marker.
[0047] Figure 4 It is the standard curve graph of the double-antibody sandwich quantitative detection kit for porcine parvovirus VP2.
[0048] Biological Material Deposit
[0049] Deposit Number: CGMCC No. 45384
[0050] Name: Re-VP
[0051] Classification and Nomenclature: Insect baculovirus
[0052] Date of deposit: January 6, 2023
[0053] Depositary institution: China General Microbiological Culture Collection Center (CGMCC)
[0054] Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing
[0055] Viability: Yes Detailed implementation manners
[0056] Unless otherwise specified, the methods in the following examples are all conventional methods
[0057] The acquisition routes of various biological materials described in the examples only provide an experimental acquisition route for the purpose of specific disclosure, and should not limit the source of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological materials that can be obtained without violating laws and ethical morals can be replaced and used according to the prompts in the examples
[0058] The examples are implemented on the premise of the technical solution of the present invention, and give detailed implementation manners and specific operation processes. The examples will help to understand the present invention, but the protection scope of the present invention is not limited to the following examples
[0059] Example 1: Screening of monoclonal hybridoma cell lines specific to porcine parvovirus VP2 protein
[0060] 1. Antigen preparation
[0061] The recombinant porcine parvovirus VP2 baculovirus (deposited in China General Microbiological Culture Collection Center, deposit number CGMCC NO. 45384) constructed according to the VP2 protein sequence of porcine parvovirus LX strain isolated in the laboratory (SEQ ID No. 5) was inoculated into sf9 cells at 5%, and then placed in a constant temperature shaking incubator at 27°C and 120 rpm for culture. When the cell viability was lower than 20%, it could be harvested. The harvested culture solution was centrifuged at 8,000 rpm for 10 minutes, and the supernatant was filtered through a 0.22 μm filter membrane for standby
[0062] The supernatant was purified using an anion exchange chromatography column. The chromatography column was loaded with the equilibration buffer (50 mM Tris, pH 8.0) until baseline equilibrium. The processed supernatant was loaded onto the chromatography column, and the flow-through was collected. After the sample loading was completed, the unbound protein was eluted with the equilibration buffer (50 mM Tris, pH 8.0) until baseline, the miscellaneous proteins were eluted with the washing buffer (50 mM Tris, 200 mM NaCl, pH 8.0), and the target protein was eluted with the elution buffer (50 mM Tris, 500 mM NaCl, pH 8.0), thus obtaining the purified porcine parvovirus VP2 proteinFigure 1 ), with a purity of not less than 85%, adjust the protein concentration to 50 μg / ml and use it as an immunogen.
[0063] 2. Immunize BALB / c mice
[0064] Immunize BALB / c mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd.) with the recombinant porcine parvovirus VP2 protein as an immunogen. Immunize continuously 4 times, with a 14-day interval between each immunization. For the first 3 immunizations, use the multi-point subcutaneous injection method, and for the 4th immunization, use the intraperitoneal injection method, 50 μg per animal each time.
[0065] 3. Cell fusion
[0066] Seven days after the last immunization, collect mouse tail blood to separate serum and detect it by indirect ELISA. The indirect ELISA method is operated according to the antigen coating concentration (0.5 μg / ml) and enzyme-labeled secondary antibody dilution (1:5000 dilution) determined by the checkerboard titration method. The steps are as follows:
[0067] (1) Coating: Dilute the purified porcine parvovirus VP2 protein to 0.5 μg / ml with carbonate solution at pH 9.6, then add it to a 96-well polystyrene ELISA plate, 100 μl per well, and place it at 2 - 8 °C for 8 - 12 hours to allow the coated antigen to fully bind to the ELISA plate.
[0068] (2) Blocking: Discard the coating solution, add PBS buffer containing 10 mg / ml bovine serum albumin at pH 7.4, 300 μl per well, block at 37 °C for 2 - 3 hours, drain, and after the ELISA plate is dry, store it sealed at 2 - 8 °C.
[0069] (3) Add the sample to be tested: Use the sample diluent (0.01 mol / L phosphate buffer containing 5 mg / ml casein, pH 7.4) for gradient dilution, 100 μl per well. Add 100 μl of SP2 / 0 culture supernatant to the negative control well, mix well by shaking, place it in a 37 °C incubator, and react for 30 minutes.
[0070] (4) Wash the plate: Discard the reaction solution, add the working solution of the washing buffer (0.01 mol / L phosphate buffer containing 0.8% - 1.2% (ml / ml) Tween-20, pH 7.4, diluted 20 times with distilled water or deionized water before use), 300 μl per well, soak for 15 seconds, discard the washing solution, and pat dry after washing the plate continuously 4 times.
[0071] (5) Add the enzyme-labeled secondary antibody: Dilute the rabbit anti-mouse IgG-HRP enzyme-labeled secondary antibody (purchased from Sigma, USA) at 1:5000, 100 μl per well, mix well by shaking, place it in a 37 °C incubator, and react for 30 minutes.
[0072] (6) Plate washing: Discard the reaction solution, add the working solution of washing buffer, 300 μl / well, soak for 15 seconds, discard the washing solution, and pat dry after washing the plate 4 times continuously.
[0073] (7) Color development: Add the working solution of substrate, that is, equal volume mixing of substrate solution A (citrate phosphate buffer containing 0.6 mg / ml urea hydrogen peroxide) and substrate solution B (0.2 mg / ml tetramethylbenzidine solution), 100 μl / well, mix well by oscillation, place in an incubator at 37 °C, and react for 15 minutes in the dark.
[0074] (8) Termination: Add the termination solution (2 mol / L sulfuric acid solution), 50 μl / well, mix well by oscillation to terminate the reaction.
[0075] (9) Detection by microplate reader: Use a microplate reader to measure the OD 450nm value, and the detection should be carried out within 15 minutes after adding the termination solution to terminate the reaction.
[0076] (10) Result determination: Take P (OD 450nm value of the positive well of the sample) / N (OD 450nm value of the negative well of the sample) ≥ 2.1, and it is determined as positive; P / N < 2.1, and it is determined as negative.
[0077] When the titer exceeds 1:25600, the spleen cells of the immunized animal can be separated and prepared into a single cell suspension, and fused with myeloma cells (preferably mouse myeloma cell SP2 / 0) under the induction of an appropriate fusogen (such as polyethylene glycol), and then cultured in HAT medium to screen for the fused hybridoma cells.
[0078] 4. Indirect immunofluorescence screening of hybridoma cell supernatant
[0079] Take the supernatant of hybridoma cell culture as the primary antibody to incubate sf9 cells inoculated with recombinant porcine parvovirus VP2 baculovirus, and use FITC-labeled goat anti-mouse IgG (purchased from ThermoFisher) as the secondary antibody for indirect immunofluorescence screening. The specific steps are as follows:
[0080] (1) Plating: Dilute insect sf9 cells to 2×10 6 cells / ml, add 100 μl to each well until the adherent cell density reaches more than 85%.
[0081] (2) Baculovirus infection: Discard the culture medium, add recombinant porcine parvovirus VP2 baculovirus, 100 μl / well, and culture in an incubator at 27 °C for 3 days.
[0082] (3) Plate washing: Discard the virus solution, add PBS buffer, 200 μl per well, wash the plate continuously 3 times, 2 - 3 minutes each time, and gently pat dry after plate washing is completed.
[0083] (4) Fixation: Add cell fixation solution (such as 4% paraformaldehyde), 100 μl per well, fix at -20 °C for 1 hour.
[0084] (5) Plate washing: Discard the fixation solution, add PBS buffer, 200 μl per well, wash the plate continuously 3 times, 2 - 3 minutes each time.
[0085] (6) Primary antibody: Add the supernatant of hybridoma cell culture, 80 μl per well, incubate at 37 °C for 1 hour.
[0086] (7) Plate washing: Discard the primary antibody, add PBS buffer, 200 μl per well, wash the plate continuously 3 times, 2 - 3 minutes each time.
[0087] (8) Secondary antibody: Add FITC-labeled goat anti-mouse IgG (diluted 1:400), 100 μl per well, incubate at 37 °C in the dark for 1 hour.
[0088] (9) Plate washing: Under light-proof conditions, discard the secondary antibody, add PBS buffer, 200 μl per well, wash the plate continuously 3 times, 2 - 3 minutes each time.
[0089] (10) Observation: Observe the fluorescence results with an inverted fluorescence microscope.
[0090] After observation with a fluorescence microscope, wells with obvious green fluorescent cell morphology were screened out ( Figure 2 ), and the positive hybridoma cell lines PPV-VP2-11F3 and PPV-VP2-12C4 in the 96-well cell culture were correspondingly selected.
[0091] 5. Specific identification of positive hybridoma cell supernatant
[0092] According to the indirect ELISA method established in step 3 of Example 1, the cross-reactions of the screened positive hybridoma cell culture supernatant with porcine pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), recombinant porcine circovirus Cap protein (expressed by baculovirus), and sf9 cell culture medium were identified, and the results are shown in Table 1.
[0093] Table 1 Specific detection results of positive hybridoma cell supernatant
[0094]
[0095] Note: "+" represents positive; "-" represents negative.
[0096] Example 2: Gene Sequencing of Specific Hybridoma Cell Lines of Porcine Parvovirus VP2 Protein Monoclonal Antibodies and Establishment of Recombinant Expression Systems for Monoclonal Antibodies
[0097] 1. Sequence Determination of Specific Hybridoma Cell Lines
[0098] (1) Total RNA Extraction from Hybridoma Cells
[0099] Take 250 μl of the hybridoma cell suspension of PPV-VP2-11F3 and PPV-VP2-12C4, add 750 μl of Trizol reagent and mix well. Then add 200 μl of chloroform, mix well, centrifuge at 12,000 rpm at 4°C for 15 minutes. Aspirate the upper aqueous phase into a new 1.5 ml EP tube, add 600 μl of isopropanol, mix well, centrifuge at 12,000 rpm at 4°C for 15 minutes. Discard the isopropanol, wash the RNA precipitate with 75% DEPC ethanol solution, centrifuge at 8,000 rpm at 4°C for 10 minutes, discard the ethanol, dry at room temperature, and dissolve with 20 μl of RNase-free water.
[0100] (2) Reverse Transcription
[0101] Perform reverse transcription according to the instructions of the Invitrogen reverse transcription kit to obtain the cDNA of the hybridoma cells of PPV-VP2-11F3 and PPV-VP2-12C4.
[0102] (3) PCR Reaction and Sequencing of Its Products
[0103] Design universal primers for the variable regions of the heavy and light chains. The sequence information is shown in Table 2. Using cDNA as a template, perform PCR amplification. The amplification products are subjected to 2% agarose gel electrophoresis. The target bands are recovered using a gel recovery kit, then ligated to the vector for sequence determination to obtain the sequence information of the variable regions of the heavy and light chains of the monoclonal antibodies PPV-11F3 and PPV-12C4.
[0104] Table 2 Primers for the Variable Regions of Heavy and Light Chains
[0105] Primer Name Sequence (5’-3’) <![CDATA[V H -F]]> GTGAATTCATGCAGGTGCAGCTGTTGGAGTCTGG <![CDATA[V H -R]]> ATGTCGACTGAGGAGACGGTGACCAGGGTGCC <![CDATA[V L -F]]> GTGAATTCATGGACATTGTGATGACCCAGTCTCC <![CDATA[V L -R]]> CAGTCGACTTACGTTTGATCTCCAGCTTGGTCCC
[0106] The monoclonal antibody PPV-11F3 contains a heavy chain variable region (PPV-11F3-V H ), a light chain variable region (PPV-11F3-V L ). The amino acid sequence of its PPV-11F3-V H is shown in SEQ ID No.1; the amino acid sequence of its PPV-11F3-V L is shown in SEQ ID No.2.
[0107] The said PPV-11F3-V Hand PPV-11F3-V L Both are composed of a complementarity-determining region and a framework region; the PPV-11F3-V H and the PPV-11F3-V L both have complementarity-determining regions composed of CDR1, CDR2, and CDR3; the CDR1 amino acid sequence of the PPV-11F3-V H is shown as the amino acids at positions 31-35 of SEQ ID No.1; the CDR2 amino acid sequence of the PPV-11F3-V H is shown as the amino acids at positions 50-65 of SEQ ID No.1; the CDR3 amino acid sequence of the PPV-11F3-V H is shown as the amino acids at positions 99-111 of SEQ ID No.1; the CDR1 amino acid sequence of the PPV-11F3-V L is shown as the amino acids at positions 23-37 of SEQ ID No.2; the CDR2 amino acid sequence of the PPV-11F3-V L is shown as the amino acids at positions 52-59 of SEQ ID No.2; the CDR3 amino acid sequence of the PPV-11F3-V L is shown as the amino acids at positions 94-104 of SEQ ID No.2.
[0108] The monoclonal antibody PPV-12C4 contains a heavy chain variable region (PPV-12C4-V H ), a light chain variable region (PPV-12C4-V L ), the amino acid sequence of its PPV-12C4-V H is shown as SEQ ID No.3; the amino acid sequence of its PPV-12C4-V L is shown as SEQ ID No.4.
[0109] The PPV-12C4-V H and the PPV-12C4-V L both are composed of a complementarity-determining region and a framework region; the complementarity-determining regions of the PPV-12C4-V H and the PPV-12C4-V L both are composed of CDR1, CDR2, and CDR3; the CDR1 amino acid sequence of the PPV-12C4-V H is shown as the amino acids at positions 31-35 of SEQ ID No.3; the CDR2 amino acid sequence of the PPV-12C4-V H is shown as the amino acids at positions 50-64 of SEQ ID No.3; the PPV-12C4-V HThe CDR3 amino acid sequence is shown as the amino acids at positions 99 - 105 of SEQ ID No. 3; the PPV-12C4-V L The CDR1 amino acid sequence is shown as the amino acids at positions 24 - 39 of SEQ ID No. 4; the PPV-12C4-V L The CDR2 amino acid sequence is shown as the amino acids at positions 55 - 61 of SEQ ID No. 4; the PPV-12C4-V L The CDR3 amino acid sequence is shown as the amino acids at positions 94 - 102 of SEQ ID No. 4.
[0110] 2. Gene sequence synthesis of specific monoclonal antibodies and establishment of recombinant expression system
[0111] (1) Gene sequence synthesis
[0112] According to the sequences of the heavy and light chain variable regions of monoclonal antibodies PPV-11F3 and PPV-12C4 that have been measured, the sequences of the heavy and light chain constant regions of murine antibodies were supplemented to the variable region part. After optimization with insect codons, the nucleotide sequence of the heavy chain of PPV-11F3 is shown as SEQ ID No. 6, and the nucleotide sequence of the light chain of PPV-11F3 is shown as SEQ ID No. 7; the nucleotide sequence of the heavy chain of PPV-12C4 is shown as SEQ ID No. 8, and the nucleotide sequence of the light chain of PPV-12C4 is shown as SEQ ID No. 9. The sequences of the heavy and light chains of the monoclonal antibody after insect codon optimization were constructed onto the pFastBac TM Dual vector, and the gene sequence synthesis was carried out by GenScript Biotech Corporation.
[0113] (2) Screening and extraction of recombinant Bacmid
[0114] The shuttle vector containing the target gene with correct sequencing was transformed into DH10Bac competent cells, and plated on a triple-antibody plate (kanamycin, gentamicin, tetracycline). After culturing at 37 °C for 48 hours, white colonies were picked and identified using the corresponding primers (primer sequences are shown in Table 3). The positive clone band is around 4600 bp, and the negative clone band is around 300 bp. Clones without the 300 bp band were selected for shaking culture and amplification. The bacterial cells were collected and the recombinant Bacmid was extracted using the NucleoBond Xtra Midi kit (MACHEREY-NAGEl), and the concentration was measured by NanoDrop.
[0115] Table 3 Primers for recombinant Bacmid identification
[0116] Primer Name Sequence (5’-3’) M13F CCCAGTCACGACGTTGTAAAACG M13R AGCGGATAACAATTTCACACAGG
[0117] (3) Recombinant baculovirus rescue
[0118] Prepare the cells before transfection with a suspension culture of sf9 cells at a cell density of 2.0 - 3.0×10 6 cells / ml. Transfect according to the dosage of recombinant Bacmid at 1.25 μg / 10 6 cells, and the dosage of the transfection reagent is 2.5 μg / 10 6 cells. Place the transfected cells in a constant temperature shaking incubator at 27°C and culture at 120 rpm for 96 hours for harvesting, which is the P1 generation of the recombinant baculovirus. Take the P1 generation of the recombinant baculovirus and inoculate sf9 cells at 1%. Then place it in a constant temperature shaking incubator at 27°C and culture at 120 rpm for 96 hours to harvest the P2 generation of the recombinant baculovirus. The P3 and P4 generations of the virus are amplified using the same method.
[0119] (4) Expression of specific monoclonal antibodies
[0120] Take the P4 generation of the recombinant baculovirus and inoculate insect sf9 cells at a ratio of 5%. Place it in a constant temperature shaking incubator at 27°C and culture at 120 rpm. When the cell viability is lower than 20%, harvest. Centrifuge the harvested culture solution at 8,000 rpm for 1 hour, and filter the supernatant with a 0.22 μm filter membrane for standby.
[0121] (5) Purification of specific monoclonal antibodies
[0122] Purify the processed cell expression supernatant using the Protein A affinity chromatography method. Equilibrate the Protein A affinity chromatography column with a 20 mM sodium phosphate solution at pH 7.0. After equilibrating for 3 - 5 column volumes, load the sample onto the chromatography column, collect the flow-through, and then elute with a 0.1 mol / L glycine solution at pH 2.7. To neutralize the acid in the eluate, add 200 μl of a 1 mol / L Tris-HCl solution at pH 9.0 to each collection tube in advance, and collect according to a volume of 800 μl per tube. Mix all the eluates, centrifuge at 8,000 rpm for 30 minutes, and take the supernatant for aliquoting and standby ( Figure 3 ). The concentration and titer of the purified monoclonal antibody are shown in Table 4.
[0123] Table 4 Results of the determination of the concentration and titer of the purified monoclonal antibody
[0124] Detection Content PPV-11F3 PPV-12C4 ELISA Titer 1:64000 1:32000 Concentration (mg / ml) 3.9 3.1
[0125] 3. Antibody pairing
[0126] Pair the two purified monoclonal antibodies (PPV-11F3, PPV-12C4) using the double antibody sandwich ELISA method.
[0127] (1) HRP-labeled monoclonal antibody
[0128] Two screened and purified porcine parvovirus VP2-specific monoclonal antibodies were conjugated with horseradish peroxidase (HRP) by the glutaraldehyde oxidation method, dialyzed thoroughly with PBS buffer at pH 7.4, added with an equal volume of glycerol, and stored at -20°C or below. The specific steps are as follows:
[0129] ① Dissolve 5 mg of HRP in 0.2 ml of 0.1 mol / L PBS buffer at pH 6.8 containing 1.25% glutaraldehyde, couple at room temperature for 18 hours, and dialyze thoroughly to remove excess glutaraldehyde.
[0130] ② Add normal saline to 1 ml, then add 2.5 mg of purified porcine parvovirus VP2-specific monoclonal antibody and 0.1 ml of 1 mol / L carbonate buffer at pH 9.6, and place at 2 - 8°C for 24 hours.
[0131] ③ Add 0.1 ml of 0.3 mol / L lysine solution and place at room temperature for 2 hours.
[0132] ④ Dialyze thoroughly with PBS buffer at pH 7.4, remove the precipitate by centrifugation, and the supernatant is the HRP-labeled monoclonal antibody.
[0133] (2) Antibody pairing experiment
[0134] Use unlabeled PPV-11F3 and PPV-12C4 as capture antibodies and HRP-labeled antibodies as detection antibodies for paired detection. The specific steps are as follows:
[0135] ① Capture antibody coating: Dilute the capture antibodies to 1 μg / ml respectively with coating buffer (carbonate solution at pH 9.6), then add to a 96-well polystyrene enzyme-linked reaction plate, 100 μl / well, and place at 2 - 8°C for 8 - 12 hours.
[0136] ② Blocking: Discard the coating buffer, add PBS buffer at pH 7.4 containing 10 mg / ml bovine serum albumin, 300 μl / well, block at 37°C for 2 - 3 hours, drain, and store sealed at 2 - 8°C after the enzyme-linked reaction plate is dried.
[0137] ③ Add purified porcine parvovirus VP2 protein: Dilute the purified porcine parvovirus VP2 protein to 0.1 μg / ml with sample diluent (0.01 mol / L phosphate buffer containing 5 mg / ml casein, pH 7.4), add 100 μl to each well, add 100 μl of sample diluent to the negative control well, mix well by shaking, place in a 37°C incubator, and react for 30 minutes.
[0138] ④Washing the plate: Discard the reaction solution, add the working solution of washing buffer (0.01 mol / L phosphate buffer containing 0.8%-1.2% (ml / ml) Tween-20, pH 7.4, diluted 20-fold with distilled water or deionized water before use), 300 μl per well, soak for 15 seconds, discard the washing solution, wash the plate 4 times continuously and then pat dry.
[0139] ⑤Adding the detection antibody: Dilute the HRP-labeled detection antibody at 1:2000, add 100 μl to each well, mix well by oscillation, place in an incubator at 37 °C, and react for 30 minutes.
[0140] ⑥Washing the plate: Discard the reaction solution, add the working solution of washing buffer, 300 μl per well, soak for 15 seconds, discard the washing solution, wash the plate 4 times continuously and then pat dry.
[0141] ⑦Color development: Add the working solution of the substrate, that is, mix equal volumes of substrate solution A (citrate phosphate buffer containing 0.6 mg / ml hydrogen peroxide urea) and substrate solution B (0.2 mg / ml tetramethylbenzidine solution), 100 μl per well, mix well by oscillation, place in an incubator at 37 °C, and react for 15 minutes in the dark.
[0142] ⑧Termination: Add the termination solution (2 mol / L sulfuric acid solution), 50 μl per well, mix well by oscillation to terminate the reaction.
[0143] ⑨Detection with an ELISA reader: Use an ELISA reader to measure the OD450nm value of each well, and the detection should be carried out within 15 minutes after adding the termination solution to terminate the reaction.
[0144] ⑩Result determination: Calculate the P (OD450nm value of the positive sample well) / N (OD450nm value of the negative control well) value for each pair of capture antibody and detection antibody, and select the pair with the largest P / N value as the best paired antibody.
[0145] After the pairing experiment, the P / N results are shown in Table 5. When PPV-11F3 is used as the capture antibody and PPV-12C4 labeled with HRP is used as the detection antibody, the P / N value is the largest.
[0146] Table 5 Results of antibody pairing
[0147]
[0148] Example 3. Establishment of a double-antibody sandwich ELISA method for porcine parvovirus VP2 protein
[0149] 1. Determination of the optimal coating concentration of the capture antibody and the optimal dilution of the detection antibody
[0150] According to the results of the 3-antibody pairing screening in Example 2, a double-antibody sandwich ELISA method was established using PPV-11F3 as the capture antibody and HRP-labeled PPV-12C4 as the detection antibody. The checkerboard method was used to determine the coating concentration of the capture antibody and the dilution of the detection antibody. The specific steps are as follows:
[0151] (1) Coating with capture antibodies at different concentrations: Dilute the capture antibody PPV-11F3 to 4 μg / ml, 2 μg / ml, 1 μg / ml, and 0.5 μg / ml respectively using the coating solution (carbonate solution with pH 9.6), and then add it to a 96-well polystyrene ELISA plate, 100 μl / well, and place it at 2-8 °C for 8-12 hours.
[0152] (2) Blocking: Discard the coating solution, add PBS buffer containing 10 mg / ml bovine serum albumin at pH 7.4, 300 μl / well, and perform blocking treatment at 37 °C for 2-3 hours. After centrifuging to dryness, seal and store at 2-8 °C after the ELISA plate is dry.
[0153] (3) Adding purified porcine parvovirus VP2 protein: Dilute the purified porcine parvovirus VP2 protein to 0.1 μg / ml using the sample diluent (0.01 mol / L phosphate buffer containing 5 mg / ml casein, pH 7.4), add 100 μl to each well, and add 100 μl of the sample diluent to the negative control well. Mix well by shaking, place it in an incubator at 37 °C, and react for 30 minutes.
[0154] (4) Washing the plate: Discard the reaction solution, add the working solution of the washing buffer (0.01 mol / L phosphate buffer containing 0.8%-1.2% (ml / ml) Tween-20, pH 7.4, diluted 20 times with distilled water or deionized water before use), 300 μl / well, soak for 15 seconds, discard the washing solution, and pat dry after washing the plate continuously 4 times.
[0155] (5) Adding the detection antibody: Dilute the HRP-labeled detection antibody PPV-12C4 at 1:2000, 1:4000, 1:8000, and 1:16000, add 100 μl to each well, mix well by shaking, place it in an incubator at 37 °C, and react for 30 minutes.
[0156] (6) Washing the plate: Discard the reaction solution, add the working solution of the washing buffer, 300 μl / well, soak for 15 seconds, discard the washing solution, and pat dry after washing the plate continuously 4 times.
[0157] (7) Color development: Add the working solution of the substrate, that is, equal volume mixing of substrate solution A (citrate phosphate buffer containing 0.6 mg / ml urea hydrogen peroxide) and substrate solution B (0.2 mg / ml tetramethylbenzidine solution), 100 μl / well, mix well by shaking, place it in an incubator at 37 °C, and react for 10 minutes in the dark.
[0158] (8) Termination: Add the termination solution (2 mol / L sulfuric acid solution), 50 μl / well, and mix well by shaking to terminate the reaction.
[0159] (9) Detection with an ELISA reader: Use an ELISA reader to measure the OD 450nm value, and the detection should be carried out within 15 minutes after adding the termination solution to terminate the reaction.
[0160] (10) Result determination: Calculate the P (OD value of the positive sample well) / N (OD value of the negative control well) value of the capture antibody and the detection antibody. Take the capture antibody concentration of the group with the largest P / N value as the optimal coating concentration of the capture antibody, and the dilution factor of the detection antibody as the optimal dilution of the detection antibody. 450nm value) / N (OD value of the negative control well 450nm value), and take the capture antibody concentration of the group with the largest P / N value as the optimal coating concentration of the capture antibody, and the dilution factor of the detection antibody as the optimal dilution of the detection antibody.
[0161] According to the P / N results (Table 6), the optimal coating concentration of the capture antibody PPV-11F3 was determined to be 1 μg / ml, 100 μl / well, and the optimal dilution of the detection antibody HRP-labeled PPV-12C4 was determined to be 1:4000, 100 μl / well.
[0162] Table 6 Results of exploring the optimal coating concentration of the capture antibody and the optimal dilution of the detection antibody by the checkerboard method
[0163]
[0164] 2. Determination of the sample reaction time
[0165] Set the sample reaction time to 0.5 hours, 1 hour, and 2 hours respectively, and keep all other conditions unchanged. The results show (Table 7) that the P / N values at each time point do not differ much. Therefore, the sample reaction time was determined to be 0.5 hours.
[0166] Table 7 Results of exploring the optimal sample reaction time
[0167] 0.5 hour 1 hour 2 hours P / N 16.98 16.74 17.10
[0168] 3. Determination of the incubation time of the detection antibody
[0169] Set the incubation time of the detection antibody to 15 minutes, 30 minutes, 60 minutes, and 90 minutes respectively, and keep all other conditions unchanged. The results show (Table 8) that when the incubation time of the detection antibody is 30 minutes, the P / N is the largest. Therefore, the incubation time of the detection antibody was determined to be 30 minutes.
[0170] Table 8 Results of exploring the optimal incubation time of the detection antibody
[0171] 15 minutes 30 minutes 60 minutes 90 minutes P / N 14.72 18.07 16.59 16.11
[0172] 4. Determination of the color development time
[0173] The display times were set to 10 minutes, 15 minutes, and 20 minutes respectively, with all other conditions remaining unchanged. The results showed (Table 9) that when the color development time was 15 minutes, the P / N was the largest. Therefore, the display time was determined to be 15 minutes.
[0174] Table 9 Results of exploring the optimal color development time
[0175] 10 minutes 15 minutes 20 minutes P / N 15.93 17.18 14.16
[0176] Example 4. Preparation of a double antibody sandwich quantitative detection kit for porcine parvovirus VP2
[0177] 1. Preparation of a capture antibody pre-coated plate
[0178] The purified porcine parvovirus VP2-specific monoclonal antibody PPV-11F3 was diluted with a carbonate solution at pH 9.6 to a coating working solution of 1 μg / ml, and then added to a 96-well polystyrene enzyme-linked reaction plate, 100 μl / well, and placed at 2 - 8°C for 8 - 12 hours to allow the specific monoclonal antibody to fully bind to the enzyme-linked reaction plate. Then, a PBS buffer solution containing 10 mg / ml bovine serum albumin at pH 7.4 was added, 300 μl / well, and subjected to a blocking treatment at 37°C for 2 - 3 hours. After centrifuging to remove the liquid, after the enzyme-linked reaction plate was dried, it was stored sealed at 2 - 8°C.
[0179] 2. Preparation of a horseradish peroxidase-labeled detection antibody
[0180] The purified porcine parvovirus VP2-specific monoclonal antibody PPV-12C4 was conjugated with horseradish peroxidase (HRP) by the glutaraldehyde oxidation method, dialyzed thoroughly with a PBS buffer solution at pH 7.4, and an equal volume of glycerol was added, and stored at -20°C or below. The specific steps are as follows:
[0181] (1) 5 mg of HRP was dissolved in 0.2 ml of a 0.1 mol / L PBS buffer solution containing 1.25% glutaraldehyde, and coupled at room temperature for 18 hours, and dialyzed thoroughly to remove excess glutaraldehyde.
[0182] (2) Add physiological saline to 1 ml, then add 2.5 mg of the purified monoclonal antibody PPV-12C4 and 0.1 ml of a 1 mol / L carbonate buffer solution at pH 9.6, and place at 2 - 8°C for 24 hours.
[0183] (3) Add 0.1 ml of a 0.3 mol / L lysine solution and place at room temperature for 2 hours.
[0184] (4) Dialyze thoroughly with PBS buffer at pH 7.4, remove the precipitate by centrifugation, and the supernatant is the HRP-labeled monoclonal antibody. When in use, dilute it at a ratio of 1:4000 to prepare the detection antibody working solution.
[0185] 3. Preparation of porcine parvovirus VP2 protein standard
[0186] Inoculate the recombinant porcine parvovirus VP2 baculovirus (preserved in the China General Microbiological Culture Collection Center, preservation number CGMCC NO.45384) into insect sf9 cells, then place it in a constant temperature shaking incubator at 27°C and 120 rpm for cultivation. Harvest when the cell viability is lower than 20%. Centrifuge the harvested culture solution at 8,000 rpm for 10 minutes, take the supernatant and load it onto an anion exchange chromatography column for purification to obtain the purified porcine parvovirus VP2 protein with a purity of not less than 85%, a protein content of 50 μg / ml, aliquot it into 100 μl / tube, label it, and store it at -70°C or below for standby. When in use, dilute it in a serial dilution (1:500 - 1:32000) with the sample diluent.
[0187] 4. Preparation of sample diluent
[0188] The sample diluent is 0.01 mol / L phosphate buffer containing 5 mg / ml casein, pH 7.4 (1 bottle, 24 ml / bottle).
[0189] 5. Preparation of substrate solution A
[0190] Substrate solution A is citric acid phosphate buffer containing 0.6 mg / ml urea hydrogen peroxide (1 bottle, 12 ml / bottle).
[0191] 6. Preparation of substrate solution B
[0192] Substrate solution B is 0.2 mg / ml tetramethylbenzidine solution (1 bottle, 12 ml / bottle).
[0193] 7. Preparation of 20-fold concentrated washing solution
[0194] The 20-fold concentrated washing solution is 0.01 mol / L phosphate buffer containing 0.8% - 1.2% (ml / ml) Tween-20, pH 7.4 (2 bottles, 50 ml / bottle).
[0195] 8. Preparation of stop solution
[0196] The stop solution is 2 mol / L sulfuric acid solution (1 bottle, 12 ml / bottle).
[0197] Example 5. Usage method of the porcine parvovirus VP2 double antibody sandwich quantitative detection kit
[0198] 1. Balance: Take out the kit from the storage environment at 2 - 8°C, place it at room temperature for 30 minutes to balance, and set aside for use. Mix the liquid reagent well before use.
[0199] 2. Solution preparation: Dilute the 20-fold concentrated washing solution 20-fold with distilled water or deionized water to obtain the working solution of the washing buffer.
[0200] 3. Sample dilution: Dilute the porcine parvovirus VP2 protein standard with the sample diluent at a ratio of 1:500 - 1:32000. The corresponding concentrations are 100 ng / ml, 50 ng / ml, 25 ng / ml, 12.5 ng / ml, 6.2 ng / ml, 3.1 ng / ml, and 1.6 ng / ml respectively. Dilute the test samples with the sample diluent in 3 - 6 gradients as well.
[0201] 4. Sample addition: Take out the required strip, put the remaining strips into an aluminum foil bag, seal it, and store it at 2 - 8°C for future use. Add the diluted test samples, the diluted porcine parvovirus VP2 protein standard, and the negative control samples (only add the sample diluent) to the coated plate, 100 μl / well, and repeat 3 wells. The time span during the sample addition process should be as short as possible.
[0202] 5. Incubation: Mix well by shaking, place it in an incubator at 37°C, and react for 30 minutes.
[0203] 6. Plate washing: Discard the reaction solution, add the working solution of the washing buffer, 300 μl / well, soak for 15 seconds, discard the washing solution, wash the plate continuously 4 times, and then pat dry.
[0204] 7. Add the HRP-labeled detection antibody: Dilute the HRP-labeled detection antibody at a ratio of 1:4000, 100 μl / well.
[0205] 8. Incubation: Mix well by shaking, place it in an incubator at 37°C, and react for 30 minutes.
[0206] 9. Plate washing: Discard the reaction solution, add the working solution of the washing buffer, 300 μl / well, soak for 15 seconds, discard the washing solution, wash the plate continuously 4 times, and then pat dry.
[0207] 10. Color development: Add the substrate working solution (mix equal volumes of substrate solution A and substrate solution B to obtain the substrate working solution, prepare it immediately before use), 100 μl / well, mix well by shaking, place it in an incubator at 37°C, and react for 15 minutes in the dark.
[0208] 11. Termination: Add the termination solution, 50 μl / well, mix well by shaking to terminate the reaction.
[0209] 12. Detection with an ELISA reader: Use an ELISA reader to measure the OD 450nm value, and the detection should be carried out within 15 minutes after adding the termination solution to terminate the reaction.
[0210] 13. Result analysis: The OD value of the well with the porcine parvovirus VP2 protein standard (100 ng / ml) should be ≥ 2.9, otherwise it is invalid; the OD value of the negative control well should be ≤ 0.25, otherwise it is invalid; Concentration calculation: Use the value obtained by subtracting the average OD value of the negative control well from the average OD value of each well of the protein standard as the Y-axis, and use the protein concentration of each well of the protein standard as the X-axis to plot the standard curve, and calculate the content of the effective antigen protein VP2 of porcine parvovirus in each test sample. 450nm value should be ≥ 2.9, otherwise it is invalid; the OD 450nm value should be ≤ 0.25, otherwise it is invalid; Concentration calculation: Use the average OD 450nm value of each well of the protein standard minus the average OD 450nm value of the negative control well. The obtained value is used as the Y-axis, and the protein concentration of each well of the protein standard is used as the X-axis to plot the standard curve, and calculate the content of the effective antigen protein VP2 of porcine parvovirus in each test sample.
[0211] In the above detection method, the selection of test samples can be diverse, such as culture solutions, inactivated solutions, concentrated solutions, and finished vaccines after demulsification during the production of inactivated porcine parvovirus vaccines or subunit vaccines.
[0212] The result analysis method in step (13) can be: Using the EXCEL program → "Insert" → "Scatter Chart" → Use the value obtained by subtracting the average OD 450nm value of the negative control well from the average OD 450nm value of each well of the protein standard as the Y-axis, and use the protein concentration of each well of the protein standard as the X-axis → "Add Trendline" → Select "Linear" → Select "Display Equation" and "Display R-squared value". Usually, R 2 ≥ 0.98 indicates that the standard curve is reliable. Each 96-well plate should be set with a well for the porcine parvovirus VP2 protein standard and the corresponding standard curve should be plotted. According to the formula, substitute the value obtained by subtracting the average OD 450nm value of the negative control well from the average OD 450nm value of each well of the sample, and calculate the concentration of VP2 protein in the sample.
[0213] Example 6. Sensitivity test of the double-antibody sandwich quantitative detection kit for porcine parvovirus VP2
[0214] Detect the negative sample (sample diluent) according to the kit in Example 4 and the detection method in Example 5, 100 μl / well, repeat 8 wells, and calculate the average value (X) and standard deviation (SD) of the OD 450nm value of the negative sample. According to the formula cut-off value = X + 3SD, the positive determination criterion can be determined.
[0215] Dilute the porcine parvovirus VP2 protein standard in a serial dilution to 100 ng / ml, 50 ng / ml, 25 ng / ml, 12.5 ng / ml, 6.2 ng / ml, 3.1 ng / ml, 1.6 ng / ml, 0.8 ng / ml, 100 μl / well, repeat 8 wells, and perform the detection, and calculate the OD 450nmThe average value (X), and the lowest concentration greater than the positive judgment criterion is used as the sensitivity of this kit.
[0216] The test results showed (Table 10) that the cut-off value of the negative samples (i.e., X + 3SD) = 0.222 + 3×0.023 = 0.291. That is, when OD 450nm ≥0.291, the sample is determined to be positive; when OD 450nm <0.291, the sample is determined to be negative. Comparing with the standard dilution concentration of porcine parvovirus VP2 protein, when the diluted sample concentration is not lower than 1.6 ng / ml, OD 450nm is higher than 0.291, and it can be determined to be positive. When the diluted sample concentration is lower than 1.6 ng / ml, OD 450nm is lower than 0.291, and it is determined to be negative. Therefore, the detection sensitivity of this kit is 1.6 ng / ml, indicating that the sensitivity of this method is relatively high.
[0217] Table 10 Detection results of the sensitivity of the double antibody sandwich quantitative detection kit for porcine parvovirus VP2
[0218]
[0219]
[0220] Example 7. Specificity test of the double antibody sandwich quantitative detection kit for porcine parvovirus VP2
[0221] Porcine pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), recombinant porcine circovirus Cap protein (expressed by baculovirus), and supernatant of suspension-cultured sf9 cells were selected and detected according to the kit in Example 4 and the detection method in Example 5. At the same time, a negative control hole (only adding sample diluent) was set. The test results showed (Table 11) that this kit had no cross-reaction with porcine pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), the protein expressed by baculovirus (such as porcine circovirus Cap protein), and sf9 cell culture medium, indicating that the specificity of this method is relatively high.
[0222] Table 11 Specificity detection results of the double antibody sandwich quantitative detection kit for porcine parvovirus VP2
[0223]
[0224] Note: “+” represents positive; “-” represents negative.
[0225] Example 8: Repeatability Test of Porcine Parvovirus VP2 Double Antibody Sandwich Quantitative Detection Kit
[0226] According to the kit of Example 4 and the detection method of Example 5, using the porcine parvovirus VP2 protein standard product diluted in a serial dilution as the detection sample, select the double antibody sandwich ELISA kits prepared in the same batch for detection, set 3 replicates for each protein dilution, and calculate the coefficient of variation of the within-batch repeatability test of this method; select the double antibody sandwich ELISA kits prepared in three different batches for detection, and calculate the coefficient of variation of the between-batch repeatability test of this method. The detection results show (Table 12) that the within-batch coefficient of variation of this kit is 0.93%-5.73%, and the between-batch coefficient of variation is 1.18%-5.56%. Both the within-batch and between-batch coefficients of variation are less than 10%, indicating that this method has good repeatability and high stability.
[0227] Table 12 Repeatability Test Results of Porcine Parvovirus VP2 Double Antibody Sandwich Quantitative Detection Kit
[0228]
[0229] Example 9: Application of Porcine Parvovirus VP2 Double Antibody Sandwich Quantitative Detection Kit
[0230] According to the kit of Example 4 and the detection method of Example 5, detect the content of porcine parvovirus VP2 protein in the samples (including cell culture fluid, virus inactivated solution, concentrated solution) at different production stages of the inactivated porcine parvovirus vaccine and the inactivated finished vaccine after demulsification. According to the kit of Example 4 and the detection method of Example 5, detect the cell supernatant of baculovirus-expressed PPV VP2 harvested in different batches in the laboratory and the antigen after demulsification of different batches of PPV VP2 subunit vaccines prepared in the laboratory. The detection results show (Table 13) that this kit can detect the content of the effective antigen protein VP2 in the cell culture fluid, virus inactivated solution, virus concentrated solution and the inactivated finished vaccine after demulsification at different production stages of the inactivated porcine parvovirus vaccine or subunit vaccine.
[0231] Table 13 Detection Results of Porcine Parvovirus VP2 Double Antibody Sandwich Quantitative Detection Kit for Samples at Different Production Stages of Inactivated Porcine Parvovirus Vaccine or Subunit Vaccine
[0232]
Claims
1. A double antibody sandwich ELISA kit for specific quantitative detection of porcine parvovirus effective antigen protein VP2, characterized in that: The kit comprises: an enzyme-linked immunosorbent plate coated with a capture antibody and an enzyme-labeled detection antibody; The capture antibody is a monoclonal antibody that can specifically bind to the effective antigen protein VP2 of porcine parvovirus; the enzyme-labeled detection antibody is an enzyme-labeled antibody made of a monoclonal antibody that can specifically bind to the effective antigen protein VP2 of porcine parvovirus; The capture antibody contains the heavy chain variable region PPV-11F3-V H and light chain variable region PPV-11F3-V L ; The heavy chain variable region PPV-11F3-V H and light chain variable region PPV-11F3-V L They are all composed of cluster-determining complementarity regions and framework regions; The PPV-11F3-V H and the PPV-11F3-V L The complementary regions of the cluster-determining regions are composed of CDR1, CDR2 and CDR3; The PPV-11F3-V H The CDR1 amino acid sequence is shown as amino acids 31 to 35 of SEQ ID No. 1; The PPV-11F3-V H The CDR2 amino acid sequence is shown in amino acids 50 to 65 of SEQ ID No. 1; The PPV-11F3-V H The CDR3 amino acid sequence is shown as amino acids 99 to 111 of SEQ ID No. 1; The PPV-11F3-V L The CDR1 amino acid sequence is shown as amino acids 23-37 of SEQ ID No. 2; The PPV-11F3-V L The CDR2 amino acid sequence is shown in amino acids 52-59 of SEQ ID No. 2; The PPV-11F3-V L The CDR3 amino acid sequence is shown in amino acids 94-104 of SEQ ID No. 2; The detection antibody contains the heavy chain variable region PPV-12C4-V H and light chain variable region PPV-12C4-V L ; The heavy chain variable region PPV-12C4-V H and light chain variable region PPV-12C4-V L They are all composed of cluster-determining complementarity regions and framework regions; The PPV-12C4-V H and the PPV-12C4-V L The complementary regions of the cluster-determining regions are composed of CDR1, CDR2 and CDR3; The PPV-12C4-V H The CDR1 amino acid sequence is shown in amino acids 31 to 35 of SEQ ID No. 3; The PPV-12C4-V H The CDR2 amino acid sequence is shown in amino acids 50 to 64 of SEQ ID No. 3; The PPV-12C4-V H The CDR3 amino acid sequence is shown in amino acids 99 to 105 of SEQ ID No. 3; The PPV-12C4-V L The CDR1 amino acid sequence is shown in amino acids 24-39 of SEQ ID No. 4; The PPV-12C4-V L The CDR2 amino acid sequence is shown in amino acids 55 to 61 of SEQ ID No. 4; The PPV-12C4-V L The CDR3 amino acid sequence is shown in amino acids 94-102 of SEQ ID No.
4.
2. The double antibody sandwich ELISA kit according to claim 1, characterized in that: The PPV-11F3-V H The amino acid sequence of PPV-11F3-V L The amino acid sequence is shown in SEQ ID No. 2; and; the PPV-12C4-V H The amino acid sequence of PPV-12C4-V L The amino acid sequence is shown in SEQ ID No.
4.
3. The double antibody sandwich ELISA kit according to claim 1 or 2, characterized in that: The method for obtaining the enzyme-linked reaction plate is to dilute the capture antibody with a carbonate solution of pH 9.6 to a coating working solution of 1 μg / ml, then add it to a 96-well polystyrene enzyme-linked reaction plate, 100 μl / well, and place it at 2-8° C. for 8-12 hours to allow the capture antibody to fully bind to the enzyme-linked reaction plate, then discard the coating solution, add PBS buffer containing 10 mg / ml bovine serum albumin, pH 7.4, 300 μl / well, and perform a blocking treatment at 37° C. for 2-3 hours, spin dry, and seal and store the enzyme-linked reaction plate at 2-8° C. after it is dried.
4. The double antibody sandwich ELISA kit according to claim 1, characterized in that: The kit also includes substrate solution A, substrate solution B and stop solution; the substrate solution A is a citric acid phosphate buffer solution containing 0.6 mg / ml hydrogen peroxide urea, and the substrate solution B is a 0.2 mg / ml tetramethylbenzidine solution, and the two are mixed in a volume ratio of 1:1 when used; the stop solution is a 2 mol / L sulfuric acid solution.
5. The double antibody sandwich ELISA kit according to claim 1, characterized in that: The kit also includes a sample diluent and a 20-fold concentrated washing solution; the sample diluent is a 0.01 mol / L phosphate buffer containing 5 mg / ml casein, pH 7.4; the 20-fold concentrated washing solution is a 0.01 mol / L phosphate buffer containing 0.8%-1.2% (ml / ml) Tween-20, pH 7.
4.
6. The double antibody sandwich ELISA kit according to claim 1, characterized in that: The kit also includes a porcine parvovirus VP2 protein standard; the porcine parvovirus VP2 protein standard is obtained by inoculating insect sf9 cells with a recombinant porcine parvovirus VP2 baculovirus, and then placing the cells in a constant temperature shaking incubator at 27°C and 120rpm for culture, harvesting the cells when the cell viability is lower than 20%, centrifuging the harvested culture fluid at 8,000rpm for 10 minutes, taking the supernatant and loading it on an anion exchange chromatography column for purification to obtain a purified porcine parvovirus VP2 protein with a purity of not less than 85% and a protein content of 50μg / ml; The recombinant porcine parvovirus VP2 is deposited in the China General Microbiological Culture Collection Center with the deposit number of CGMCC NO.45384.
7. Use of the double antibody sandwich ELISA kit described in any one of claims 1 to 6 in the specific quantitative detection of porcine parvovirus effective antigen protein VP2, wherein the sample to be tested is the culture medium, inactivated solution, concentrated solution or finished vaccine after demulsification in the production process of porcine parvovirus inactivated vaccine or porcine parvovirus subunit vaccine.
8. A monoclonal antibody that can specifically bind to the effective antigen protein VP2 of porcine parvovirus, and is any one of the following monoclonal antibodies: (1) Contains the heavy chain variable region PPV-11F3-V H and light chain variable region PPV-11F3-V L ; The heavy chain variable region PPV-11F3-V H and light chain variable region PPV-11F3-V L They are all composed of cluster-determining complementarity regions and framework regions; The PPV-11F3-V H and the PPV-11F3-V L The complementary regions of the cluster-determining regions are composed of CDR1, CDR2 and CDR3; The PPV-11F3-V H The CDR1 amino acid sequence is shown as amino acids 31 to 35 of SEQ ID No. 1; The PPV-11F3-V H The CDR2 amino acid sequence is shown in amino acids 50 to 65 of SEQ ID No. 1; The PPV-11F3-V H The CDR3 amino acid sequence is shown as amino acids 99 to 111 of SEQ ID No. 1; The PPV-11F3-V L The CDR1 amino acid sequence is shown as amino acids 23-37 of SEQ ID No. 2; The PPV-11F3-V L The CDR2 amino acid sequence is shown in amino acids 52-59 of SEQ ID No. 2; The PPV-11F3-V L The CDR3 amino acid sequence is shown in amino acids 94-104 of SEQ ID No. 2; (2) Containing the heavy chain variable region PPV-12C4-V H and light chain variable region PPV-12C4-V L ; The heavy chain variable region PPV-12C4-V H and light chain variable region PPV-12C4-V L They are all composed of cluster-determining complementarity regions and framework regions; The PPV-12C4-V H and the PPV-12C4-V L The complementary regions of the cluster-determining regions are composed of CDR1, CDR2 and CDR3; The PPV-12C4-V H The CDR1 amino acid sequence is shown in amino acids 31 to 35 of SEQ ID No. 3; The PPV-12C4-V H The CDR2 amino acid sequence is shown in amino acids 50 to 64 of SEQ ID No. 3; The PPV-12C4-V H The CDR3 amino acid sequence is shown in amino acids 99 to 105 of SEQ ID No. 3; The PPV-12C4-V L The CDR1 amino acid sequence is shown in amino acids 24-39 of SEQ ID No. 4; The PPV-12C4-V L The CDR2 amino acid sequence is shown in amino acids 55 to 61 of SEQ ID No. 4; The PPV-12C4-V L The CDR3 amino acid sequence is shown in amino acids 94-102 of SEQ ID No. 4; (3) containing the heavy chain variable region PPV-11F3-V H and light chain variable region PPV-11F3-V L ; The PPV-11F3-V H The amino acid sequence of PPV-11F3-V L The amino acid sequence is shown in SEQ ID No. 2; (4) containing the heavy chain variable region PPV-12C4-V H and light chain variable region PPV-12C4-V L ; The PPV-12C4-V H The amino acid sequence of PPV-12C4-V L The amino acid sequence is shown in SEQ ID No.
4.
9. Use of the monoclonal antibody according to claim 8 in preparing a kit for detecting the content of the effective antigen protein VP2 of porcine parvovirus.
Citation Information
Patent Citations
Porcine parvovirus structural protein antibody enzyme-linked immunosorbent assay kit
CN107991499A
Enzyme linked immunosorbent assay kit for detecting porcine pseudorabies virus antigen and application of enzyme linked immunosorbent assay kit
CN113009139A
Anti-TCR antibody molecules and uses thereof
CN113543807A
Porcine parvovirus neutralizing monoclonal antibody as well as preparation method and application thereof
CN114149497A
System and Method for Blood Glucose Control
KR102325887B1