Splice conversion oligonucleotides targeting IL-4RA
By using splice-converting oligonucleotide (SSO) to bind to IL-4Rα precursor mRNA and inducing exon exclusion, the side effects and scope limitations of existing drugs for treating atopic dermatitis are solved, and the effect of effectively reducing IL-4Rα expression and reducing inflammation is achieved.
Patent Information
- Application Number
- CN202380061422.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-08-25
- Filing Date
- 2023-08-22
- Publication Date
- 2025-05-30
AI Technical Summary
Existing drugs for the treatment of atopic dermatitis, such as duprimuluzumab, require systemic injection, and have side effects and are not suitable for patients with mild to moderate conditions, especially children.
Splice-converting oligonucleotides (SSOs) are developed to induce exon exclusion by binding to IL-4Rα precursor mRNA, thereby reducing the levels of IL-4Rα mature mRNA and proteins, and are used to treat Th2-mediated inflammatory diseases such as atopic dermatitis.
SSO can effectively reduce IL-4Rα expression and reduce Th2-mediated inflammation, providing a safe local anti-inflammatory treatment regimen suitable for a variety of inflammatory diseases, including atopic dermatitis.
Smart Images

Figure CN120077133A_ABST
Abstract
Description
Technical Field
[0001] The present invention generally relates to the field of RNA splicing. Specifically, the present invention relates to splice-switching oligonucleotides (SSOs) that are configured to alter the splicing of IL-4Rα pre-mRNA. The present invention also relates to the use of SSOs as therapeutic candidates for atopic dermatitis. Background Art
[0002] Atopic dermatitis (AD) is a chronic debilitating disease that has many negative impacts on the lives of patients and their families. This disease affects 10-20% of the population in Singapore. It is characterized by dry skin, itching, and inflammation. Skin moisturization is the first line of management for AD. Although simple moisturization helps to relieve the above symptoms, it has no anti-inflammatory effect, and patients have to resort to immunosuppressants that cause significant side effects.
[0003] Recently, the biologic drug Dupilumab has been approved in Singapore for the treatment of AD and has shown good clinical efficacy in patients with severe AD. Dupilumab is a human monoclonal antibody that is designed to target IL-4Rα and disrupt the IL-4 and IL-13 signaling that drives persistent inflammation in AD. Dupilumab has tolerable side effects (such as conjunctivitis and herpes virus recurrence), and it has brought significant relief to many patients who have suffered from this debilitating disease for many years. However, Dupilumab needs to be administered systemically by injection, which is not suitable for the vast majority of AD patients (75%) with mild to moderate disease and is currently not suitable for children under 6 years of age. Given that AD is a chronic disease, long-term systemic administration of anti-IL-4Rα may lead to long-term memory loss and dementia as well as Kawasaki disease.
[0004] Therefore, there is a need to develop safe topical anti-inflammatory agents to prevent the progression of the disease to severe. In addition, other desirable features and characteristics will become apparent from the following detailed description and the appended claims, taken in conjunction with the accompanying drawings and the background of the present disclosure. Summary of the Invention
[0005] In one aspect, there is provided a splice-switching oligonucleotide (SSO) that binds to IL-4Rα pre-mRNA, wherein the SSO comprises a sequence selected from the group consisting of SEQ ID NOs 1 to 8, and wherein during the splicing of IL-4Rα pre-mRNA into IL-4Rα mature mRNA, the binding of the SSO induces exon exclusion.
[0006] In one embodiment, at least one of the nucleotides of the SSO described herein is chemically modified, and wherein the chemical modification is a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, or a phosphorothioate linkage.
[0007] In one embodiment, each nucleotide of the SSO described herein comprises a 2'-O-methyl RNA modification or a 2'-O-methoxyethyl RNA modification.
[0008] In one embodiment, the SSO described herein comprises phosphorothioate linkages between all of the nucleotides of the SSO.
[0009] In another aspect, there is provided the use of an SSO as described herein as a medicament or for treatment.
[0010] In one embodiment, there is provided the use of an SSO as described herein for the treatment of Th2-mediated inflammatory diseases.
[0011] In one embodiment, the Th2-mediated inflammatory diseases are selected from the group consisting of atopic dermatitis, asthma, allergic rhinitis, allergic conjunctivitis, and ulcerative colitis.
[0012] In another aspect, there is provided the use of an SSO as described herein in the preparation of a medicament for the treatment of Th2-mediated inflammatory diseases.
[0013] In one embodiment, the Th2-mediated inflammatory diseases are selected from the group consisting of atopic dermatitis, asthma, allergic rhinitis, allergic conjunctivitis, and ulcerative colitis.
[0014] In one aspect, there is provided a method for treating Th2-mediated inflammatory diseases, which comprises administering to a subject a composition comprising an SSO as described herein.
[0015] In one embodiment, the Th2-mediated inflammatory diseases are selected from the group consisting of atopic dermatitis, asthma, allergic rhinitis, allergic conjunctivitis, and ulcerative colitis.
[0016] In another aspect, there is provided a pharmaceutical composition comprising (a) a therapeutically effective amount of an SSO as described herein and (b) one or more pharmaceutically acceptable carriers and / or diluents.
[0017] In one aspect, there is provided a method of exon skipping, which comprises providing an SSO having a sequence selected from the group consisting of SEQ ID NOs: 1 to 8, wherein binding of the SSO to the IL-4Rα pre-mRNA induces exon exclusion during splicing of the IL-4Rα pre-mRNA into the IL-4Rα mature mRNA.
[0018] In one embodiment, exon exclusion results in a decrease in the level of mature IL-4Rα mRNA or functional protein.
[0019] In one embodiment, the methods described herein include providing an SSO, wherein at least one of the nucleotides of the SSO is chemically modified, and wherein the chemical modification is a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, or a phosphorothioate linkage.
[0020] In one embodiment, the methods described herein include providing an SSO, wherein each nucleotide of the SSO comprises a 2'-O-methyl RNA modification or a 2'-O-methoxyethyl RNA modification.
[0021] In one embodiment, the methods described herein include providing an SSO, which comprises phosphorothioate linkages between all of the nucleotides of the SSO. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] The present invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the drawings, wherein:
[0023] Figure 1 And Table 1 shows the annotated isoforms of the IL-4Rα gene according to Ensembl and NCBI. The sizes of the exons (in bp) are shown at the bottom.
[0024] Figure 2 Shows the expression of IL-4Rα isoforms detected by Genescan in HaCaT cells. Genescan PCR was performed using the primer sets IL4R-3F (forward primer located on exon 3) and IL4R-8R (reverse primer located on exon 8) to analyze untreated HaCat cells and HaCat cells treated with scrambled SSO in the absence of CHX ( Figure 2 A) and HaCat cells treated with CHX ( Figure 2 B) for the relative abundances of exons 4, 5, 6, and 7. Figure 2 C shows Genescan PCR using the primer sets IL4R-6F (forward primer located on exon 6) and IL4R-10 / 11R (reverse primer located at the junction of exons 10 and 11) to analyze the relative abundances of exons 7, 8, and 9 in untreated HaCat cells and HaCat cells treated with scrambled SSO in the absence of CHX.
[0025] Figure 3Shows the efficacy of SSO-induced off-target exon skipping detected by gel electrophoresis after PCR. The SSOs and target exons are listed in Table 3 below. Each SSO was transfected at 50 nM into HaCaT cells in the presence of CHX. The image is of a gel electrophoresis of reverse transcriptase PCR products of a specific IL-4Rα transcript region amplified from total RNA isolated from cells treated with the indicated SSOs. PCR was performed using primers that included the exon targeted by the SSO and 50 ng of cDNA. The dark and light arrows indicate amplicons of the native transcript without exon skipping / alteration of IL-4Rα and GAPDH, respectively. PCR of the IL-4Ra transcript of cells treated with SSO 1872 and SSO 1871 targeting exon 2 and SSO 1789 targeting exon 3 used primers IL4R-1F and IL4R-5R. Those treated with SSO 1571 and SSO 1790 targeting exon 4 and SSO1572 targeting exon 5 used primers IL4R-3F and IL4R-7R. Those treated with SSO 1791 targeting exon 6 and SSO 1792, SSO 1793, SSO 1794 targeting exon 7 used primers IL4R-5F and IL4R-8R. Those treated with SSO 1961 and SSO 1962 targeting exon 8 used primers IL4R-7F and IL4R-10 / 11R. PCR of the GAPDH transcript was performed as a control using primers GAPDH-F and GAPDH-R. The lanes marked x are four SSOs that did not show effective induction of skipping of their target exons. The primer sets used are indicated on each gel electrophoresis plate and listed in Table 2.
[0026] Figure 4Shows the efficiency of SSO-induced off-target exon skipping measured by genescan analysis. Genescan data are presented as percent spliced in (PSI), which is the percentage of transcripts that still retain the target exon. Thus, the lower the PSI, the more effective the SSO. Each SSO was validated at a concentration of 50 nM, except for SSO 1793 and SSO 1961, which were at a concentration of 100 nM. Genescan analysis was performed using primer sets IL4R-3F (in exon 3) and IL4R-8R (in exon 8) to measure the efficiency of SSO 1571, SSO1790, SSO 1572, SSO 1791, and SSO 1792, and primer sets IL4R-6F (in exon 6) and IL4R-10 / 11R (at the junction of exons 10 and 11) to measure the efficiency of SSO 1793, SSO 1961, and SSO 1962. The PSI for each target exon of each SSO is presented as a bar graph. A) Exon 4 PSI before and after treatment with SSO 1571 or SSO 1790. B) Exon 5 PSI before and after treatment with SSO 1572, and exon 6 PSI before and after treatment with SSO 1791. C) Exon 7 PSI before and after treatment with SSO 1792 or SSO 1793. D) Exon 8 PSI before and after treatment with SSO 1961 or SSO1962.
[0027] Figure 5 Shows the efficiency of SSO downregulation of total IL-4Rα transcript abundance measured by qPCR. Unless otherwise stated, HaCaT cells were treated with 50 nM SSO in the absence of CHX. qPCR was performed using primer sets IL4R-8F (qPCR) and IL4R-9R (qPCR) to analyze the efficiency of SSO 1571, SSO 1572, SSO 1789, SSO 1790, SSO 1791, SSO 1792, SSO 1793, and SSO 1794 (upper panel). Separate qPCR was performed using primer sets IL4R-11F (qPCR) and IL4R-11R (qPCR) to analyze SSO 1571, SSO 1572, SSO 1790, SSO 1792, SSO 1794, SSO 1961, and SSO1962 (lower panel).
[0028] Figure 6Shows the dose response of SSO 1962-induced exon 8 skipping analyzed by Genescan and plotted as exon 8 PSI, using primer sets IL4R-7F and IL4R-11R. To obtain these data, transfection was performed in the presence of CHX. Cells were treated with SSO at concentrations of 12.5 nM, 25 nM, 50 nM, and 100 nM. NC2 (scrambled SSO) at a concentration of 100 nM was used as a negative control.
[0029] Figure 7 Shows the efficiency of exon 8 skipping (exon 8 PSI) induced by SSO 1962 fully modified with 2'-MOE or 2'-OMe (left and right panels, respectively). Cells were transfected with SSO 1962 at concentrations of 12.5 nM, 25 nM, 50 nM, and 100 nM in the presence of cycloheximide (CHX). Genescan PCR was performed using primer sets IL4R-7F and IL4R-11R.
[0030] Figure 8 Shows the dose response of 2'-OMe-modified SSO 1961 and SSO 1962 in downregulating the total IL-4Rα transcript abundance measured by qPCR. HaCaT cells were treated with SSO at concentrations of 25 nM, 50 nM, 100 nM, and 200 nM for 24 hours in the absence of CHX. qPCR was performed using primer sets IL4R-11F (qPCR) and IL4R-11R (qPCR). The HPRT1 gene was used as an internal control.
[0031] Figure 9 Shows the efficacy of SSO 1961 and SSO 1962 in downregulating IL-4Rα analyzed by Western Blot. Cells were treated for 48 hours in the absence of CHX with 2'-OMe-modified SSO 1961 (lane 3), 2'-MOE-modified SSO1961 (lane 4), 2'-OMe-modified SSO 1962 (lane 5), and 2'-MOE-modified SSO 1962 (lane 6) at a concentration of 50 nM. NC2 (SSO with a scrambled sequence) was used as a control.
[0032] Figure 10 Shows the start and end positions of the binding sites of each SSO (listed in Tables 4 and 5) relative to the start and end of its target exon splicing site. The start position upstream of the acceptor splicing site is given as the number of "negative" bases from the acceptor splicing site. Conversely, the end position downstream of the donor splicing site is given as the number of bases from the donor splicing site plus the prefix "+".
[0033] The present invention is described in more detail below. Detailed implementation mode
[0034] In one aspect of the present invention, there is provided a splicing conversion oligonucleotide (SSO) that binds to the IL-4Rα precursor mRNA, wherein the SSO comprises a sequence selected from the group consisting of SEQ ID NOs 1 to 8.
[0035] Table 1 shows the isoforms of the IL-4Rα gene according to Ensembl. This gene has 19 transcripts (splicing variants).
[0036]
[0037]
[0038] Table 1.
[0039] In one embodiment, the SSOs described herein are 18 to 32 nucleotides in length.
[0040] "Oligonucleotide" means any polynucleotide. "Polynucleotide" is an oligomer composed of nucleotides. Polynucleotides can be composed of DNA, its RNA modified forms, or combinations thereof. As used herein, the term "nucleotide" or its plural may be interchanged with the modified forms discussed herein and otherwise known in the art. In some cases, the term "nucleobase" is used in the art, which encompasses naturally occurring nucleotides as well as nucleotide modifications that can be polymerized. Thus, a nucleotide or nucleobase means the naturally occurring nucleobases adenine (A), guanine (G), cytosine (C), thymine (T), and uracil (U), as well as non-naturally occurring nucleobases such as xanthine, diaminopurine, 8-oxo-N6-methyladenine, 7-deazaxanthine, 7-deazaguanine, N4,N4-ethanocytosine, N’,N’-ethano-2,6-diaminopurine, 5-methylcytosine (mC), 5-(C[3]-C6)-alkynyl-cytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridine, isocytosine, isoguanine, inosine, and the "non-naturally occurring" nucleobases described in Benner et al., U.S. Patent No. 5,432,272 and Susan M. Freier and Karl-Heinz Altmann, 1997, Nucleic Acids Research, vol. 25: pp 4429-4443. The term "nucleobase" includes not only the known purine and pyrimidine heterocycles, but also heterocyclic analogs and tautomers thereof. Additional naturally occurring and non-naturally occurring nucleobases include those disclosed in U.S. Patent No. 3,687,808 (Merigan et al.), Chapter 15 by Sanghvi, in Antisense Research and Application, Ed. S.T. Crooke and B. Lebleu, CRC Press, 1993, Englisch et al, 1991, Angewandte Chemie, International Edition, 30:613-722 (see especially pages 622 and 623, and Concise Encyclopedia of Polymer Science and Engineering, J.I. Kroschwitz Ed., John Wiley & Sons, 1990, pages 858-859, Cook, Anti-Cancer Drug Design 1991, 6, 585-607, each of which is hereby incorporated by reference in its entirety).In various embodiments, the polynucleotide further includes one or more "nucleobases" or "base units", which include compounds that can act as nucleobases (e.g., heterocyclic compounds), including certain "universal bases" that are not nucleobases in the most traditional sense but act as nucleobases. Universal bases include 3-nitropyrrole, optionally substituted indoles (e.g., 5-nitroindole), and optionally substituted hypoxanthine. Other desired universal bases include pyrrole and diazole or triazole derivatives, including those universal bases known in the art.
[0041] The polynucleotide may also include modified nucleobases. As used in the art, a "modified base" is understood to be a base that can pair with a natural base (e.g., adenine, guanine, cytosine, uracil, and / or thymine) and / or can pair with a non-natural base. Exemplary modified bases are described in EP 1 072 679 and WO 97 / 12896, the disclosures of which are incorporated herein by reference. Modified nucleobases include, but are not limited to, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azauracil, cytosine, and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy, and other 8-substituted adenines and guanines, 5-halo (especially 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 2-F-adenine, 2-amino-adenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3-deazaguanine and 3-deazaadenine. Further modified bases include tricyclic pyrimidines such as phenoxazine cytidine (1H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1H-pyrimido[5,4-b][1,4]benzothiazin-2(3H)-one), G-clamp, such as substituted phenoxazine cytidine (e.g., 9-(2-aminoethoxy)-H-pyrimido[5,4-b][1,4]benzoxazin-2(3H)-one), carbazole cytidine (2H-pyrimido[4,5-b]indol-2-one), pyridoindole cytidine (H-pyrido[3’,2’:4,5]pyrrolo[2,3-d]pyrimidin-2-one). Modified bases may also include bases in which the purine or pyrimidine base is replaced by another heterocycle, such as 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Additional nucleobases include those disclosed in U.S. Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J.I., ed. John Wiley & Sons, 1990, those disclosed in Englisch et al, 1991, Angewandte Chemie, International Edition, 30:613, and those disclosed in Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S.T. and Lebleu, B., ed., CRC Press, 1993. Some of these bases can be used to increase the binding affinity of polynucleotides and include 5-substituted pyrimidines, 6-aza pyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitution has been shown to increase nucleic acid duplex stability by 0.6-1.2 degrees Celsius, in certain embodiments, in combination with 2'-O-methoxyethyl sugar modification. See, U.S. Patent Nos. 3,687,808, 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121; 5,596,091; 5,614,617; 5,645,985; 5,830,653; 5,763,588; 6,005,096; 5,750,692, and 5,681,941, the disclosures of which are incorporated herein by reference.
[0042] It is contemplated to use modified polynucleotides in which one or more sugars and / or one or more internucleotide linkages of the nucleotide units in the polynucleotide are replaced with "non-naturally occurring" sugars (i.e., sugars other than ribose or deoxyribose) or internucleotide linkages, respectively. In one embodiment, the present disclosure contemplates peptide nucleic acids (PNAs). In a PNA compound, the sugar backbone of the polynucleotide is replaced with an amide-containing (e.g., peptide bond between N-(2-aminoethyl)-glycine units) backbone. See, e.g., U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, as well as Nielsen et al, Science, 1991, 254, 1497-1500, the disclosures of which are incorporated herein by reference. Modified polynucleotides can also contain one or more substituted sugar moieties. In one embodiment, the modification of the sugar includes locked nucleic acid (LNA), in which the 2'-hydroxy group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. In certain embodiments, the linkage is a methylene (-CH [2]- ) [n] group, where n is 1 or 2. LNA and its preparation are described in WO 98 / 39352 and WO99 / 14226, the disclosures of which are incorporated herein by reference. In the present invention, preferably, the antisense oligonucleotide comprises a modified polynucleotide backbone. The modified polynucleotide backbone can include a modified moiety that replaces at least one sugar of the polynucleotide. The modified moiety can be selected from the group consisting of phosphorodiamidate morpholino oligomers (PMOs), peptide-conjugated phosphorodiamidate morpholino oligomers (PPMOs), and morpholino oligomers bearing non-peptide dendritic octa-guanidine moiety tags.
[0043] In various embodiments, the modified polynucleotide backbone includes at least one modified internucleotide linkage. The modified internucleotide linkage includes a modified phosphoester. The modified phosphoester can be any one selected from the group consisting of non-bridging oxygen atoms substituted with sulfur atoms, phosphonates, phosphorothioates, phosphodiesters, morpholino phosphates, azide phosphates, and amino phosphates.
[0044] In various embodiments of the present invention, the SSO includes a backbone selected from the group consisting of ribonucleic acid, deoxyribonucleic acid, DNA phosphorothioate, RNA phosphorothioate, 2'-O-methyl-oligoribonucleotide and 2'-O-methyl-oligodeoxyribonucleotide, 2'-O-alkyl ribonucleic acid, 2'-O-alkyl DNA, 2'-O-alkyl RNA phosphorothioate, 2'-O-alkyl DNA phosphorothioate, 2'-F-thiophosphate, 2'-F-phosphodiester, 2'-methoxyethyl phosphorothioate, 2-methoxyethyl phosphodiester, deoxymethylene(methylimino)(deoxy MMI), 2'-O-alkyl MMI, deoxymethyl-phosphonate, 2'-O-alkyl methylphosphonate, morpholino, 4'-thio DNA, 4'-thio RNA, peptide nucleic acid, 3'-amide, deoxy 3'-amide, 2'-O-alkyl 3'-amide, locked nucleic acid, cyclohexane nucleic acid, tricyclo-DNA, 2'-fluoro-arabinonucleic acid, N3'-P5' phosphoramidate, carbamate linkage, phosphotriester linkage, nylon backbone modification, and mixtures of the above backbones.
[0045] Preferably, the oligonucleotide is chemically linked to one or more conjugates that enhance the activity, tissue / organ distribution, or cellular uptake of the SSO.
[0046] As used herein, the term "splice-switching oligonucleotide" (SSO) or "splice-switching oligomer" is intended to include synthetic antisense nucleic acids that base pair with precursor mRNA and disrupt the splicing process by sterically blocking the RNA-RNA base pairing or protein-RNA binding interactions that occur between splicing machinery components and precursor mRNA. SSOs are also referred to as "antisense nucleotides" and can regulate splicing. SSOs can regulate splicing by steric block. In some embodiments, the SSO can be a mixmer. The term "mixmer" includes oligomers that apply different types of chemical modifications on their sugar moiety or their backbone linkages or both. Examples of chemical modifications include phosphorothioate linkages, 2'-O-methyl RNA modifications, 2'-O-methoxyethyl RNA modifications, and locked nucleic acid substitutions. The terms "phosphorothioate bond" and "phosphorothioate linkage" are used interchangeably. Chemical modifications can improve efficacy, selectivity, and stability while exhibiting favorable SSO toxicity profiles.
[0047] The term "splicing" refers to the RNA processing mechanism by which precursor mRNA is made into mature mRNA. During splicing, introns are removed and exons are joined. Splicing is catalyzed by the spliceosome complex. As used herein, the term "alternative splicing" is intended to include the process by which a gene encodes multiple mRNA and protein products by differentially selecting which exons are included in the mature mRNA transcript. For example, alternative splicing can take the form of one or more skipped exons, variable positions of intron splicing, or intron retention.
[0048] As used herein, the term "intron" refers to a segment of non-coding nucleic acid sequence that is transcribed and present in precursor mRNA, but is excised by the splicing mechanism and thus not present in the mature mRNA transcript.
[0049] As used herein, the term "exon" refers to a segment of nucleic acid sequence that is transcribed into mRNA and present in mature mRNA after splicing. The term "exon skipping" is intended to include the process of removing an entire exon or a portion thereof from a given precursor mRNA and thereby excluding it from being present in the mature mRNA. For example, the portion of the protein encoded by the skipped exon is not present in the expressed form of the protein.
[0050] As used herein, the term "splice site" is intended to include specific nucleic acid sequences that can be recognized by the splicing mechanism as suitable for excision and / or ligation to a corresponding splice site. Splice sites define the precise exon-intron boundaries, thereby allowing the excision of introns from precursor mRNA transcripts. As used herein, the term "5' splice site" (also referred to as the donor splice site) refers to the nucleic acid sequence surrounding the exon-intron boundary at the 5' end of the intron, which marks the start of the intron and its boundary with the previous exon sequence. As used herein, the term "3' splice site" (also referred to as the acceptor splice site) refers to the nucleic acid sequence surrounding the intron-exon boundary at the 3' end of the intron, which marks the end of the intron and its boundary with the subsequent exon sequence.
[0051] As used herein, the term "precursor mRNA (pre-mRNA)" or "precursor mRNA (precursor mRNA)" refers to the messenger ribonucleic acid (mRNA) chain synthesized from a DNA template by transcription. Precursor mRNA consists of exons, introns, and untranslated sequences (located before the first exon and after the last exon, respectively). Generally, precursor mRNA in eukaryotes only exists transiently before being fully processed into mature mRNA.
[0052] As used in the context of SSO, the term "binding" is intended to include the hybridization of SSO to a site on a precursor mRNA or mature mRNA transcript. The terms "hybridize" or "hybridization" can include the binding of a single-stranded nucleic acid or a local single-stranded region of a double-stranded nucleic acid to another single-stranded nucleic acid or a local single-stranded region of a double-stranded nucleic acid with a complementary sequence through the pairing of complementary nucleic acids. Those skilled in the art generally know that the binding or hybridization of one sequence to another does not require complete sequence complementarity. For example, the sequence of SSO can be completely complementary or partially complementary to the site to which it binds.
[0053] Advantageously, due to the favorable binding thermodynamics and the range of locally single-stranded binding sites recognized, the SSOs of the present embodiment are capable of competitively binding to the corresponding binding sites on the IL-4Rα pre-mRNA. The selection of the binding sites involves consideration of the presence of RNA binding protein motifs on the binding sites. The SSOs of the present embodiment are capable of inducing the desired splicing regulation by blocking the appropriate RNA binding proteins.
[0054] In another embodiment, at least one of the nucleotides of the SSOs described herein is chemically modified. The chemical modification can be a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, or a phosphorothioate linkage.
[0055] In one embodiment, each nucleotide of the SSOs described herein comprises a 2'-O-methyl RNA modification or a 2'-O-methoxyethyl RNA modification.
[0056] In another embodiment, the SSOs described herein comprise phosphorothioate linkages between all of the nucleotides of the SSOs.
[0057] In another aspect of the present invention, there is provided the SSO of the present invention for use as a medicament or for treatment. In various embodiments, there is provided the SSO as described herein for the treatment of Th2-mediated inflammatory diseases. Given the role of IL-4Rα in IL-4 and IL-13 signaling, which is a key mediator of the Th2 response, it is generally understood by those skilled in the art that a reduction in IL-4Rα expression will result in a reduction in the Th2 immune response, thereby alleviating Th2-mediated inflammatory diseases. Examples of Th2-mediated inflammatory diseases are atopic diseases, which include but are not limited to atopic dermatitis (also known as eczema), asthma, allergic rhinitis (also known as hay fever), and allergic conjunctivitis, as well as ulcerative colitis (an inflammatory bowel disease caused by a Th2 immune response). Atopic dermatitis, asthma, and allergic rhinitis are collectively referred to as the atopic triad because individuals with atopy typically present with all three conditions. It usually begins with atopic dermatitis in infancy, followed by asthma and allergic rhinitis in late childhood. Allergic conjunctivitis consists of chronic allergic conjunctivitis (CAC) as well as seasonal acute allergic conjunctivitis (SAC), and CAC includes atopic keratoconjunctivitis (AKC), perennial allergic conjunctivitis (PAC), and vernal keratoconjunctivitis (VKC). Allergic conjunctivitis can present as SAC or CAC. AKC is the main form of CAC and usually occurs between the ages of 20 and 30. In cases of AKC, 95% have a history of AD, while asthma and allergic rhinitis are associated with 65%-87% of AKC, respectively. Atopy is a genetic predisposition that, through CD4+ Th2 differentiation and overproduction of immunoglobulin E (IgE), tends to produce an excessive immune response to otherwise harmless substances. Dermatitis. In another aspect, there is provided the use of the SSO as described herein in the manufacture of a medicament for the treatment of Th2-mediated inflammatory diseases. In one embodiment, the Th2-mediated inflammatory disease is selected from the group consisting of atopic dermatitis, asthma, allergic rhinitis, allergic conjunctivitis, and ulcerative colitis. In yet another aspect, there is provided a method for treating a Th2-mediated inflammatory disease, which comprises administering to a subject a composition comprising the SSO as described herein. In one embodiment, the Th2-mediated inflammatory disease is selected from the group consisting of atopic dermatitis, asthma, allergic rhinitis, allergic conjunctivitis, and ulcerative colitis.
[0058] As used herein, in the context of treating a disease (such as atopic dermatitis), the term "treat" or "treating" is intended to include improving the clinical condition of a patient suffering from the disease. This includes reducing the severity of the disease and preventing or slowing the progression of the disease.
[0059] These SSOs can be used in therapeutic compositions, for example, as pharmaceutical compositions comprising the SSOs of the present invention and a pharmaceutically acceptable carrier. The composition is suitable for parenteral administration to a patient in the form of a naked drug or in a form complexed with a delivery agent. The carrier is selected from the group consisting of: nanoparticles, such as polymeric nanoparticles; liposomes, such as pH-sensitive liposomes, antibody-conjugated liposomes; viral vectors, cationic lipids, polymers, UsnRNAs, such as U7 snRNA, and cell-penetrating peptides. The SSOs are administered topically, or orally, or rectally, or transmucosally, or enterally, or intramuscularly, or subcutaneously, or intramedullary, or intrathecally, or directly into the cerebral ventricle, or intravenously, or intravitreally, or intraperitoneally, or intranasally, or intravitreally.
[0060] In another aspect of the present invention, there is provided a pharmaceutical composition comprising (a) a therapeutically effective amount of the SSOs described herein and (b) one or more pharmaceutically acceptable carriers and / or diluents. In one embodiment, the pharmaceutical composition may further comprise one or more moisturizing ingredients or antipruritic ingredients. In one embodiment, the pharmaceutical composition is applied to the affected skin once or twice a day.
[0061] The term "therapeutically effective amount" refers to the amount of the SSOs described herein required to confer the desired therapeutic effect in a subject, which will vary depending on the route of administration, the disease condition, the body weight, and other therapeutic agents or excipients that may be included. A "therapeutically effective amount" is an amount that, when administered in the necessary dose and for the necessary period of time, achieves the desired therapeutic outcome. The therapeutically effective amount may vary depending on factors such as the disease state, the width of the organ (e.g., the affected skin area), the age, sex, and body weight of the individual, and the ability of the therapeutic agent to elicit the desired response in the individual.
[0062] The "therapeutically effective amount" of the treatment can also be measured by its ability to stabilize the progression of the disease. A therapeutically effective amount of the therapeutic agent can relieve or improve the symptoms of the subject. Those of ordinary skill in the art can determine such amounts based on factors such as the body size of the subject, the severity of the subject's symptoms, and the specific composition or route of administration selected.
[0063] In the methods of the present invention, the therapy is used to provide a positive therapeutic response to a disease or condition. The term "positive therapeutic response" is intended to include an improvement in the disease or condition, and / or an improvement in the symptoms associated with the disease or condition, and / or a prevention of the worsening of the symptoms associated with the disease or condition. A positive therapeutic response to any given disease or condition can be determined by standardized response criteria for that disease or condition. In addition to these positive therapeutic responses, a subject receiving the therapy may also experience beneficial effects of improved symptoms associated with the disease.
[0064] A pharmaceutically acceptable carrier generally refers to a material suitable for administration to a subject, where the carrier is biologically inert or does not cause undesired effects. Such carriers are typically inert components of a drug. Generally, the carrier is administered to the subject together with the active ingredient without causing any undesired biological effects or interacting in a harmful manner with any other components of the pharmaceutical composition that includes it. Suitable pharmaceutical carriers are described in Martin, Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, Pa., (1990), which is incorporated herein by reference in its entirety.
[0065] In a more specific form of the present invention, there are provided pharmaceutical compositions that include a therapeutically effective amount of an SSO and a pharmaceutically acceptable diluent, preservative, solubilizer, emulsifier, adjuvant, and / or carrier. Such compositions include diluents with various buffer contents (e.g., phosphate, Tris-HCl, acetate), pH, and ionic strength, as well as additives such as detergents and solubilizers (e.g., Tween 80, polysorbate 80), antioxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol), and bulking agents (e.g., lactose, mannitol). The material can be incorporated into particulate formulations of polymers such as, but not limited to, polylactic acid or polyglycolic acid, or into liposomes. Hyaluronic acid (HA) can also be used. Such compositions can affect the physical state, stability, in vivo release rate, and in vivo clearance rate of the disclosed compositions. The composition can be prepared in liquid form or can be prepared in dry powder form (e.g., lyophilized form).
[0066] It should be understood that the pharmaceutical compositions provided according to the present disclosure can be administered by any means known in the art. Preferably, the pharmaceutical compositions for administration are administered by injection, topically, orally, or by the pulmonary or nasal route. In various embodiments, the antisense polynucleotide is delivered by intravenous, intraarterial, intraperitoneal, intramuscular, transdermal, or subcutaneous administration routes.
[0067] In one embodiment, a pharmaceutical composition comprising the SSO described herein can be delivered by microneedles, which include a self-dissolving microneedle patch and microneedles. The self-dissolving microneedle patch is made of HA, and HA is cast into crystals in the form of microneedles. The SSO can be embedded by mixing it with an HA solution before casting the microneedle patch. Once the microneedles pierce the skin barrier, they will naturally melt, releasing the SSO for maximum absorption by cells in the epidermis and dermis, while the HA is absorbed by the skin tissue. Microneedle devices made of plastic, metal, or other polymers can also be used to deliver substances through the skin to the body. Microneedle devices can be used to deliver drugs directly to the epidermis and dermis. The microneedles pierce the epidermal barrier and deliver the drug directly to the epidermis, dermis, and even further diffuse into the blood and are absorbed by the active tissues of the body. The microneedle patch will be attached to a reservoir containing the composition to be delivered, and the reservoir itself will be attached to the device to facilitate the composition contained in the reservoir to pass through the microneedles and flow into the skin. The above delivery method has advantages over oral delivery because it allows the composition to be absorbed by the body without contacting the strong digestive enzymes of the stomach; advantages over injection delivery because it is relatively painless; and advantages over topical delivery because it allows for greater absorption of the delivered composition.
[0068] As described herein, a pharmaceutical composition comprising SSO can also be delivered by lipid nanoparticles. As used herein, lipid nanoparticles can refer to a nanosized carrier system that includes a continuous aqueous phase and at least one dispersed oil phase, wherein the oil phase includes at least one amphiphilic lipid (e.g., phospholipid) and at least one solubilizing lipid having a monolayer surrounding an amorphous core. Lipid nanoparticles are known for their high biocompatibility, controlled release, efficient targeting, stability, natural biodegradability, and high payload therapeutic index. Lipid nanoparticles can be assembled as solid lipid nanoparticles (SLN), nanostructured lipid carriers (NLC), and nanospheres (NS). The lipids used in the process of synthesizing lipid nanoparticle compositions can include fatty acids, triglycerides, triacylglycerols, acylglycerols, fats, waxes, cholesterol, sphingolipids, glycerides, sterols, wax esters, glycolipids, sulfolipids, lipoproteins, chylomicrons, and derivatives of these lipids. The surfactants used to assemble lipid nanoparticles can include biocompatible and biodegradable surfactants, such as lecithin, polysorbates, monoglycerides, diglycerides, triglycerides, glyceryl oleate, poloxamers, and other non-toxic, non-ionic surfactants known in the art.
[0069] The oligonucleotides of the present invention encompass any pharmaceutically acceptable salt, ester or salt of such ester, or any other compound which, upon administration to an animal (including a human), is capable of providing (directly or indirectly) its bioactive metabolite or residue. Thus, for example, the present disclosure also relates to prodrugs and pharmaceutically acceptable salts of the compounds of the present invention, pharmaceutically acceptable salts of such prodrugs and other bioequivalents.
[0070] The term "pharmaceutically acceptable salt" refers to physiologically and pharmaceutically acceptable salts of the compounds of the present invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects to the parent compound.
[0071] Examples of preferred pharmaceutically acceptable salts for polynucleotides include, but are not limited to: (a) salts formed with cations (e.g., sodium, potassium, ammonium, magnesium, calcium), polyamines (e.g., spermine and spermidine); (b) acid addition salts formed with inorganic acids (e.g., hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid); (c) salts formed with organic acids (e.g., acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p-toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid); and (d) salts formed from elemental anions (e.g., chlorine, bromine and iodine). The pharmaceutical compositions of the present disclosure can be administered in a variety of ways, depending on whether local or systemic treatment is desired and on the area to be treated. Administration can be topical (e.g., based on lotions / creams / microneedles, ophthalmic or mucosal, including rectal delivery), pulmonary, e.g., by inhalation of powder or aerosol (including by nebulizer, intratracheal, intranasal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, transdermal, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular administration.
[0072] The pharmaceutical formulations of the present disclosure can be conveniently presented in unit dosage form and can be prepared by conventional techniques well known in the pharmaceutical industry. These techniques include the step of bringing the active ingredient into association with a pharmaceutical carrier or excipient. In general, the formulations are prepared by uniformly and intimately bringing the active ingredient into association with a liquid carrier or a finely divided solid carrier or both, and then shaping the product as required.
[0073] The present disclosure also contemplates combination therapies with additional therapeutic agents.
[0074] In some embodiments, the present invention can be used in gene therapy, for example, using a vector (e.g., an expression vector) comprising a polynucleotide of the present invention to direct the expression of the polynucleotide in a suitable host cell. Such vectors can be used, for example, to amplify the polynucleotide in the host cell to produce a useful amount of the polynucleotide. In some embodiments, the vector is an expression vector, wherein the polynucleotide of the present invention is operably linked to a polynucleotide comprising an expression control sequence.
[0075] In one aspect of the present invention, a method of exon skipping is provided, which comprises providing an SSO having a sequence selected from the group consisting of SEQ ID NOs: 1 to 8, wherein during the splicing of IL-4Rα pre-mRNA into IL-4Rα mature mRNA, the binding of the SSO to the IL-4Rα pre-mRNA induces exon exclusion.
[0076] As used herein, "IL-4Rα" refers to the subunit of the interleukin-4 and interleukin-13 receptors.
[0077] The exon to be excluded is also referred to as the "target exon".
[0078] In one embodiment, the SSO has a binding site located within the target exon. In another embodiment, the SSO has a binding site that overlaps with the acceptor splicing site of the target exon, and a binding site that overlaps with the target exon or a portion thereof. In yet another embodiment, the SSO has a binding site that overlaps with the target exon or a portion thereof, and a binding site that overlaps with the donor splicing site of the target exon.
[0079] In one embodiment, exon exclusion in the method described herein results in a decrease in the level of IL-4Rα mature mRNA or functional protein. A decrease in the level of IL-4Rα mature mRNA can result in a lack of IL-4Rα protein expression.
[0080] In the methods described herein, the exon to be excluded includes a number of nucleotides that is not divisible by 3. Excluding this exon can result in a shift in the codon reading frame. Whether a decrease in the level of IL-4Rα mRNA transcripts is observed depends on the efficiency with which these mRNA transcripts are degraded via the nonsense-mediated decay (NMD) pathway. It is generally known in the art that the propensity and efficiency of NMD can vary between different genes and between transcripts expressed from a gene and between cell types and tissues. Nevertheless, since the exon skipping method of the present invention results in a shift in the codon reading frame, the resulting mRNA transcripts will likely exhibit multiple premature termination codons downstream of the skipped exon. If these transcripts are translated, they will produce non-functional truncated proteins. Even if no premature termination codons appear downstream of the skipped exon, the resulting peptide sequence will be significantly different from the wild type, and thus the resulting protein structure will misfold and be non-functional.
[0081] In the methods described herein, the exon to be excluded is selected from the group consisting of exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, and exon 8 of the IL-4Rα pre-mRNA (Genbank GeneID: 3566; Ensembl: ENSG00000077238) (SEQ ID NO: 38).
[0082] For example, excluding exon 8, which includes 100 nucleotides and encodes the transmembrane domain of the IL-4Rα protein, can result in one or more of the following consequences. First, excluding exon 8 can lead to disruption of the IL-4Rα mRNA reading frame, followed by the appearance of premature termination codons, which can result in nonsense-mediated mRNA decay, thus leading to a decrease in IL-4Rα protein expression. Second, excluding exon 8 results in the deletion of the transmembrane domain in the IL-4Rα protein. For example, exon 8 skipping can be accompanied by other alternative splicing events, such as the skipping of other exons or partial intron retention, which will allow the transcript without exon 8 to still maintain the correct reading frame. This transcript can encode a protein, but the protein lacks the transmembrane domain, rendering the protein unable to localize itself as a transmembrane protein. Such a protein cannot function in the signaling pathways that are crucial for the development and progression of AD.
[0083] In another embodiment, the methods described herein include providing an SSO, at least one of the nucleotides of which is chemically modified, and wherein the chemical modification is a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, or a phosphorothioate linkage.
[0084] In another embodiment, the methods described herein include providing an SSO, wherein each nucleotide of the SSO comprises a 2'-O-methyl RNA modification or a 2'-O-methoxyethyl RNA modification.
[0085] In another embodiment, the methods described herein include providing an SSO that comprises phosphorothioate linkages between all nucleotides of the SSO.
[0086] A document listed or discussed as being apparently previously published in this specification is not necessarily to be taken as an admission that the document is part of the prior art or forms part of common general knowledge.
[0087] Any document mentioned herein is incorporated herein by reference in its entirety.
[0088] In order that the present invention may be fully understood and readily put into practice, the present invention will now be described by way of non-limiting examples, which are only preferred embodiments of the present invention, with reference to the accompanying illustrative drawings.
[0089] Materials and Methods
[0090] Cell
[0091] HaCaT cells (RRID:CVCL_0038) were used in the experiments.
[0092] SSO transfection of HaCaT cells
[0093] The efficacy and efficiency of each SSO were tested and verified in HaCaT cells. Transfection was performed on a 12-well cell culture plate with a cell confluence of 50% to 75%. In separate tubes, the SSO at the indicated concentration and the indicated amount of Lipofectamine RNAiMAX (hereinafter referred to as lipofectamine) were diluted in serum-free and antibiotic-free Opti MEM medium such that the volume of each tube was 25 ul. After 5 minutes, the two diluted compounds were mixed in one tube and left at room temperature for 15 minutes to form an SSO-lipofectamine complex. After 15 minutes, 950 ul of growth medium without antibiotics was added to 50 ul of the SSO-Lipofectamine complex, and the transfection mixture was ready for use. The growth medium on the cells was removed and replaced with the transfection mixture, and the cells were placed in a CO 2 incubator for 24 hours for analysis. According to the experiment, 10 ug / ml of cycloheximide (CHX) could be added 5 hours after the application of the transfection mixture. A scrambled sequence SSO-lipofectamine complex and a mixture containing only diluted lipofectamine were used as controls.
[0094] Analysis of the efficacy and efficiency of SSO
[0095] Four analyses were performed to analyze the efficacy and efficiency of SSOs. First, to select effective SSOs, after transfection, RNA isolation, reverse transcription PCR (RT-PCR), agarose gel electrophoresis, and Sanger sequencing were performed on the cells to specifically verify exon skipping of the target. Second, for SSOs showing effectiveness, further analysis was performed by RT-PCR Genescan after transfection to semi-quantify the efficiency of their induction of specific exon skipping. Third, RT-qPCR was also performed to measure the effect of each SSO on reducing the abundance of IL-4Ra in the treated cells. Fourth, SSOs showing effective induction of specific exon skipping and IL-4Ra transcript abundance were resynthesized in 2-Ome and 2-Moe, and their dose-response efficiency was further analyzed by RT-PCR genescan and qPCR. Finally, the ability of these SSOs to downregulate IL-4Ra protein expression was also analyzed by Western blotting.
[0096] RNA isolation and first-strand cDNA synthesis (reverse transcription)
[0097] Total RNA was isolated from HaCaT cells using Trizol (Invitrogen, Carlsbad, CA). At the indicated time, the medium containing the transfection reagent was removed, and the cells were gently washed with pre-warmed phosphate-buffered saline (PBS). Cells were harvested by directly pouring Trizol buffer (500 μl per well of a 12-well plate) onto the cells and lysing them for 10 minutes at room temperature, followed by homogenization using a micropipette. Then, the cell lysates were collected in 1.5 ml Eppendorf tubes and further total RNA isolation was carried out according to the protocol provided by the Trizol manufacturer. First-strand cDNA was synthesized using oligo(dT) primers and the Maxima First Strand cDNA Synthesis Kit (Thermo Scientific). Then, the cDNA (RT product) was used for further analysis (i.e., PCR), followed by agarose gel electrophoresis and Sanger sequencing, PCR genescan, and qPCR.
[0098] PCR
[0099] PCR was performed using DreamTaq Green PCR Master Mix (2X) (Thermo Fisher Scientific), with cDNA (equivalent to 100 ng of total RNA) in a 25-μl reaction volume, and 10 pM of different primer sets according to SSO (the primers included regions carrying exons and at least one upstream exon and one downstream exon targeted by the SSO being analyzed). PCR was carried out in a Thermal Cycler C1000 Touch (Biorad) for a total of 35 cycles, consisting of: denaturation at 95 °C for 20 seconds, annealing at 58 °C to 60 °C for 20 seconds, and extension at 72 °C for 1 minute. Then, the PCR products were electrophoresed in a 1% agarose gel, and the amplicons were visualized on a UV table.
[0100] Sequencing
[0101] The bands observed in the agarose gel electrophoresis were excised, purified individually using the QIAquick Gel Extraction Kit (Qiagen), and subjected to Sanger sequencing. Sanger sequencing was performed by BioBasic Asia Pacific in Singapore.
[0102] Genescan
[0103] PCR was performed using DreamTaq Green PCR Master Mix (2X) (Thermo Fisher Scientific), with cDNA (equivalent to 125 ng of total RNA) in a 25-μl reaction volume, and 10 pM of the indicated primer set, with the forward primer being FAM-labeled (IDT). PCR was carried out in a Thermal Cycler C1000 Touch (Biorad) for a total of 35 cycles, consisting of: denaturation at 95 °C for 20 seconds, annealing at 58 °C for 20 seconds, and extension at 72 °C for 1 minute. 1.5 μl of the PCR product was added to a mixture containing 1 μl of size marker (GeneScan TM 500 LIZ TM Size Standard or GeneScan TM 1200 LIZ TMin 10 ul of HiDi formamide (Thermo Fisher Scientific, depending on the expected size of the PCR product) and analyzed on a 3730xl DNA Analyzer (Thermo Fisher Scientific). The data generated was analyzed using GeneMapper TM software (Thermo Fisher Scientific). The data was presented as percent spliced in (PSI), which is the percentage of transcripts that still retain the target exon. Thus, the lower the PSI, the more effective the SSO.
[0104] Quantitative PCR (qPCR)
[0105] qPCR was performed using the DNAMaster SYBR green I kit (Roche Diagnostics, Basel, Switzerland). cDNA equivalent to 35 ng of total RNA was used in a 25 ul reaction volume with the indicated primer sets. To control for RNA integrity and differences across tissues or due to experimental handling errors between tubes, hypoxanthine-guanine phosphoribosyltransferase 1 (HPRT1) was used as an endogenous control with primers HPRT1-F and HPRT1-R. The reactions were carried out on a Light Cycler CFX96 Real-Time System (Biorad) and the data was evaluated using the appropriate software (Biorad) and presented as the relative ratio of IL-4Rα / HPRT.
[0106] Western blot
[0107] HaCaT cells were grown in 6-well plates in DMEM supplemented with 10% fetal bovine serum. In the absence of CHX, cells in each well were transfected with the indicated SSO at a concentration of 50 nM and Lipofectamine RNAiMAX at a concentration of 2.5 ul / ml of medium. Cells were harvested after 48 hours and protein extraction and Western blot analysis were performed using antibodies anti-IL-4Rα (Santa Cruz Biotechnology, Inc., Dallas, TX, USA) and anti-β-actin (Santa Cruz Biotechnology, Inc., Dallas, TX, USA) according to standard protocols. 10 ug of protein was loaded in each well.
[0108] SEQ ID NO Primer name Sequence 13 IL4R-1F GGCGCGCAGATAATTAAAGA 14 IL4R-5R AGCCCACAGGTCCAGTGTAT 15 IL4R-3F ATGGGGTGGCTTTGCTCT 16 IL4R-7R CGCGGGCCAGGGAAGGGCCA 17 IL4R-8R CTCCACTCACTCCAGGTGGT 18 IL4R-5F CTCATGGATGACGTGGTCAG 19 IL4R-6F GACACTCTGCTGCTGACCTG 20 IL4R-10 / 11R TTCTTCCAGTGTGGGCACTT 21 IL4R-7F ACCACCTGGAGTGAGTGGAG 22 IL4R-11R CTGGAAAGGCATCTCTTTGG 23 IL4R-8F (qPCR) TTCCTGCATTGTCATCCTG 24 IL4R-9R (qPCR) CTGGGTTGGGAATCTGATC 25 IL4R-11F (qPCR) CAAGCTCTTGCCCTGTTTTC 26 IL4R-11R (qPCR) TGCACAGAAGCTCCCTTTTT 27 HPRT1-F TGCTGAGGATTTGGAAAGGG 28 HPRT1-R ACAGAGGGCTACAATGTGATG 29 GAPDH-F GCAAATTCCATGGCACCGT 30 GAPDH-R GCCCCACTTGATTTTGGAGG
[0109] Table 2. List of primers used
[0110] Example
[0111] Example 1
[0112] The strategy adopted in the present invention is to develop SSOs to mediate the inhibition of interleukin-4 receptor alpha (IL-4Rα), which is a component of both type 1 IL-4R (IL-4Ra / gc; IL-4 specific) and type 2 IL-4R (IL-4Ra-IL-13Ra1; IL-4 and IL-13 specific). IL-4Rα has been shown to be affected by dupilumab, which is a clinically validated therapeutic target for severe AD. One of the goals is to develop a topical therapy for local diseases by formulating with a suitable emulsion.
[0113] As Figure 1 shown, the IL-4Rα gene expresses multiple isoforms due to the use of alternative start codons, alternative splicing of exons 6 and / or 10, or alternative polyadenylation usage. As a strategy to inhibit gene expression, SSOs were rationally designed to induce specific exon skipping during pre-mRNA splicing, with the aim of disrupting the mRNA reading frame. Since the resulting frameshift transcripts carry multiple premature termination codons, they will be degraded via the nonsense-mediated decay (NMD) pathway or result in the inability to encode a functional IL-4Rα protein. Exons with lengths not divisible by three are potential targets because their individual exclusion will cause a shift in the codon reading frame.
[0114] Example 2
[0115] In the in vitro model of HaCaT cells, the relative abundance of possible isoforms was characterized with or without treatment with cycloheximide (CHX) and scrambled SSO (negative control); CHX is a protein translation inhibitor that is crucial for the activation of NMD. As Figure 2 shown by the Genescan data presented in
[0116] Example 3
[0117] Twelve SSOs were rationally designed, each of which was induced to exclude one of the seven possible off-target exons, as shown in Table 3. The efficacy of each SSO in inducing skipping of its target exon was verified. Verification was performed by transfecting each SSO into HaCat cells and analyzing by reverse transcription PCR, followed by agarose gel electrophoresis, as described in the above method. After verification by agarose gel electrophoresis and sequencing, all SSOs except SSO 1871, SSO 1872, SSO 1789, and SSO 1794 showed bands / amplicons with smaller molecular weights, or the intensity of the bands corresponding to the unskipped transcripts decreased compared to the lanes treated with untreated or scrambled SSOs. Therefore, they were considered to effectively induce skipping of specific target exons. Conversely, SSO 1871, SSO 1872, SSO 1789, and SSO 1794 showed bands / amplicons of the same size and density as the lanes treated with untreated or scrambled SSOs and were ineffective and labeled as X. The results of the efficacy analysis are as Figure 3 shown. The eight SSOs showing efficacy were 1571, 1790, 1572, 1791, 1792, 1793, 1961, and 1962.
[0118] SSO ID Off-target exon Off-target exon size (bp) 1871 / 1872 Exon 2 133 1789 Exon 3 88 1571 / 1790 Exon 4 139 1572 Exon 5 152 1791 Exon 6 152 1792 / 1793 / 1794 Exon 7 157 1961 / 1962 Exon 8 100
[0119] Table 3. Designed SSOs and Their Target Exons
[0120] Example 4
[0121] One way to quantify the efficiency of the eight effective SSOs is to measure the PSI of the corresponding target exon using Genescan. The PSI of each target exon of untreated cells, cells treated with scrambled-sequence SSOs (as negative controls), and cells treated with specific SSOs is shown in the bar graph ( Figure 4 ). The PSI score inversely reflects the treatment efficiency. Four of the eight SSOs, namely SSO 1791, SSO 1792, SSO 1961, and SSO 1962, were able to achieve PSI < 0.5 at 50 nM, except that SSO 1961 was able to achieve PSI < 0.5 at 100 nM ( Figure 4 ).
[0122] Example 5
[0123] The downregulation of the total IL-4Rα transcript by each of the eight SSOs was studied, with scrambled SSO as the negative control. Among the eight SSOs, only SSO 1961 and SSO 1962 were observed to reduce the abundance of the total IL-4Rα transcript ( Figure 5)。Although effective in inducing targeted exon skipping, all SSOs except SSO 1691 and SSO 1692 failed to reduce the abundance of total IL-4Rα transcripts, indicating that in the absence of exon 8, NMD is most active on the transcripts produced. Notably, exon 8 is the target encoded by SSO 1961 and SSO 1962, which encodes the transmembrane domain, while exons 4, 5, 6, and 7 are the targets of SSO 1571, SSO 1790, SSO 1572, SSO 1791, SSO 1792, and SSO 1793, which encode the extracellular domain of the IL-4Ra protein. From the dose-response of SSO 1961 and SSO 1962 on the downregulation of total IL-4Rα transcripts ( Figure 8 ), SSO 1962 was observed to be more effective in downregulating total IL-4Rα transcripts. Subsequently, the dose-response of SSO 1962 in inducing exon 8 skipping and downregulating total IL-4Rα transcripts was determined ( Figure 6 ).
[0124] Example 6
[0125] The efficiency of SSO 1962 in inducing targeted exon skipping when fully modified with 2'-O-methyl (2'-OMe) was compared with SSO 1962 when fully modified with 2'-O-methoxyethyl (2'-MOE). As Figure 7 shown, at concentrations of 50 nM and above, 2'-OMe-modified SSO 1962 was more effective than 2'-MOE-modified SSO 1962.
[0126] Example 7
[0127] Western blotting was performed to measure the efficacy of SSO 1961 and SSO 1962 in downregulating IL-4Rα at the protein level. Notably, at an SSO concentration of 50 nM, the degree of downregulation of IL-4Rα protein abundance ( Figure 9 ) was significantly higher than that of the corresponding mRNA transcript abundance ( Figure 8 ). The degree of IL-4Rα protein knockdown was similar in 2'-OMe- and 2'-MOE-modified SSOs. In fact, the protein knockdown efficiency was consistent with the efficiency of inducing exon 8 skipping ( Figure 4 D, Figure 6 and Figure 7 ) being higher than the mRNA knockdown efficiency ( Figure 8 ), indicating that NM cannot effectively degrade all the mRNA transcripts produced.
[0128] Example 8
[0129] Current state-of-the-art techniques for identifying effective SSOs employ semi-empirical methods, in which hundreds to thousands of SSOs (each of which travels around and along the target exon) are synthesized and screened, which requires substantial resources and trial-and-error. Not all antisense oligonucleotides can function to induce exon skipping. For example, Table 4 lists SSO sequences that effectively induce exon skipping. Table 5 lists examples of SSOs that cannot effectively induce exon skipping. Only specific positions or segments within the pre-mRNA sequence can mediate exon skipping when targeted by an SSO( Figure 10 ).
[0130] In various embodiments, each sugar moiety in the SSO is modified with 2'-O-methyl (2'-OMe) or 2'-O-methoxyethyl (2'-MOE).
[0131] SEQ ID NO SSO Sequence (5' to 3') 1 1571 GGG CUC CUG CAA GAC CUU CAU G 2 1572 UUG UUC UCA GGG AUA CAC GUG UGG 3 1790 GGC UCC UGC AAG ACC UUC AUG U 4 1791 GUA AUU GUC AGG GGG AUA CGG GUU 5 1792 GUU CUA GGU AGG UCA CGU UAU AGA UUC UGA 6 1793 GCU GCG AUG CGG AGG GAG 7 1961 CGA AGG GCU CCC UGU AGG CUG 8 1962 CCA GGA CUC ACU UGG UGA UGC UG
[0132] Table 4. Sequences of effective SSOs
[0133] SEQ ID NO SSO Sequence (5' to 3') 9 1789 AUU GGG AGA UGC CAA GGC ACC UG 10 1794 CAG GGU GCU GGC UGC GAU G 11 1871 UAUGAUUUCUUCCAGCUGUGUGUAAAUCUUUA 12 1872 AAAGUGCUGGGAUUAUAGGCAUGAGCC
[0134] Table 5. Sequences of ineffective SSOs
[0135] Example 9
[0136] Table 6 lists the sequences of exons 2 to 8 of IL-4Rα, including a portion of the introns flanking each exon (50 nucleotides of the intron sequences at the start and end of each exon).
[0137]
[0138] Table 6: Exon sequences of IL-4Rα
[0139] The DNA sequence of IL-4Rα (Genbank Gene ID: 3566; Ensembl: ENSG00000077238) is shown below (SEQ ID NO: 38):
[0140]
[0141] The DNA sequences in this specification are provided in the 5' to 3' direction (i.e., the "sense strand" or "coding strand"). Since the antisense strand of DNA serves as the transcription template, the mRNA sequence will have the same sequence as the coding strand, except that thymine (T) is replaced by uracil (U).
[0142] Although embodiments of the present invention have been particularly shown and described with reference to specific embodiments, those skilled in the art should understand that various changes in form and detail may be made therein without departing from the scope of the present invention as defined by the appended claims. Accordingly, the scope of the present invention is indicated by the appended claims and is therefore intended to cover all variations falling within the equivalent meaning and scope of the claims.
Claims
1. A splice-switching oligonucleotide (SSO) that binds to the IL-4Rα pre-mRNA, wherein the SSO comprises a sequence selected from the group consisting of SEQ ID NOs 1 to 8, and wherein binding of the SSO induces exon exclusion during splicing of the IL-4Rα pre-mRNA into the IL-4Rα mature mRNA.
2. The SSO according to claim 1, wherein at least one of the nucleotides of the SSO is chemically modified, and wherein the chemical modification is a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, or a phosphorothioate linkage.
3. The SSO according to claim 1 or 2, wherein each nucleotide of the SSO comprises a 2'-O-methyl RNA modification or a 2'-O-methoxyethyl RNA modification.
4. The SSO according to any one of the preceding claims, which comprises phosphorothioate linkages between all of the nucleotides of the SSO.
5. The SSO of any one of the preceding claims, for use as a medicament or for treatment.
6. The SSO for use according to claim 5, for the treatment of Th2-mediated inflammatory diseases.
7. The SSO for use according to claim 6, wherein the Th2-mediated inflammatory disease is selected from the group consisting of atopic dermatitis, asthma, allergic rhinitis, allergic conjunctivitis, and ulcerative colitis.
8. Use of the SSO according to any one of claims 1 to 4 in the manufacture of a medicament for the treatment of Th2-mediated inflammatory diseases.
9. The use according to claim 8, wherein the Th2-mediated inflammatory disease is selected from the group consisting of atopic dermatitis, asthma, allergic rhinitis, allergic conjunctivitis, and ulcerative colitis.
10. A method for treating Th2-mediated inflammatory diseases, which comprises administering to a subject a composition comprising an SSO according to any one of claims 1 to 4.
11. The method according to claim 10, wherein the Th2-mediated inflammatory disease is selected from the group consisting of atopic dermatitis, asthma, allergic rhinitis, allergic conjunctivitis, and ulcerative colitis.
12. A pharmaceutical composition, which comprises (a) a therapeutically effective amount of an SSO according to any one of claims 1 to 4 and (b) one or more pharmaceutically acceptable carriers and / or diluents.
13. A method of exon skipping, which comprises providing an SSO having a sequence selected from the group consisting of SEQ ID NOs 1 to 8, wherein binding of the SSO to the IL-4Rα pre-mRNA induces exon exclusion during splicing of the IL-4Rα pre-mRNA into the IL-4Rα mature mRNA.
14. The method according to claim 13, wherein the exon exclusion results in a decrease in the level of the IL-4Rα mature mRNA or the functional protein.
15. The method according to claim 13 or 14, comprising providing an SSO, at least one of the nucleotides of the SSO being chemically modified, and wherein the chemical modification is a 2'-O-methyl RNA modification, a 2'-O-methoxyethyl RNA modification, or a phosphorothioate linkage.
16. The method according to any one of claims 13 to 15, comprising providing an SSO, wherein each nucleotide of the SSO comprises a 2'-O-methyl RNA modification or a 2'-O-methoxyethyl RNA modification.
17. The method according to any one of claims 13 to 16, comprising providing an SSO, the SSO comprising phosphorothioate linkages between all of the nucleotides of the SSO.
Citation Information
Patent Citations
Method of producing nucleic acid molecules with reduced secondary structure
EP1072679A2
Synthetic polynucleotides
US3687808A
2,N6-disubstituted and 2,N6-trisubstituted adenosine-3'-phosphoramidites
US4845205A
Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same
US5130302A
Improved probes using nucleosides containing 3-dezauracil analogs
US5134066A