Mutant I-type herpes simplex virus subunit vaccine as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of vaccine preparation, and discloses a mutant I-type herpes simplex virus subunit vaccine and a preparation method and application thereof, herpes simplex virus gB protein is gB protein or gB H516P mutant protein, the amino acid sequence of the gB protein is shown as SEQ ID NO.1, and the amino acid sequence of the gB H516P mutant protein is shown as SEQ ID NO.2; and the composite adjuvant is composed of CpG oligodeoxynucleotide and QS-21. Comparison experiments prove that humoral immune response and cellular immune response levels induced by the subunit vaccine combined by the CpG oligodeoxynucleotide and QS-21 composite adjuvant are equivalent to immune response levels induced by mRNA vaccines, and the neutralizing effect of serum of mice inoculated with the subunit vaccine is also equivalent to that of serum of mRNA group mice. And a foundation is laid for popularization of subunit vaccines.

Description

Technical Field

[0001] The present invention belongs to the technical field of vaccine preparation, and particularly relates to a mutant type I herpes simplex virus subunit vaccine and a preparation method and application thereof. Background Art

[0002] According to statistics from the World Health Organization in 2024, 3.8 billion people under the age of 50 (64%) are infected with herpes simplex virus I (HSV-1) worldwide. HSV-1 is mainly transmitted through the mouth and causes infections in or around the mouth, and it can also cause genital herpes. HSV-1 is a neurotropic virus that has the ability to invade nerve cells and damage the nervous system, leading to herpes simplex encephalitis. Recent studies have found that HSV-1 infection may also be associated with the development of Alzheimer's disease. HSV-1 exists mainly in the form of latent infection in the human body, and the main latent site is the human trigeminal ganglion. Once latent infection is established, the viral genome will downregulate gene expression and be in a dormant state, thereby escaping recognition and clearance by the human immune system. When the human immune function is low, HSV-1 may be reactivated, causing herpes-related diseases. At present, due to insufficient safety and effectiveness, no HSV-1-related preventive or therapeutic vaccines have been approved for marketing.

[0003] HSV-1 is an enveloped double-stranded DNA virus with at least 12 membrane glycoproteins on its membrane, of which gB, gH, gL and gD are the core proteins for HSV-1 to carry out complex membrane fusion behavior. Among them, gD is responsible for binding to receptors on host cells, and gH and gL transmit this signal to gB. The gB protein is a class III membrane fusion protein that exists on the membrane surface in the form of a trimer and has five extracellular domains. The post-fusion structure of HSVgB has a similar structure to the glycoprotein G of vesicular stomatitis virus (VSV) and the glycoprotein 64 of baculovirus. These structural similarities indicate that there is a conserved membrane fusion mechanism between these viruses. When gB receives the fusion signal, a series of conformational changes will occur, from the pre-fusion structure to the post-fusion structure. In this process, gB inserts into the host cell membrane and pushes the viral capsid into the target cell, which is an event necessary for infection. The post-fusion structure of gB shows that its external domain can interact with other glycoproteins at different sites, for example, gH-gL can bind to the domain II of gB to cause conformational changes in gB. However, there is currently a lack of research on vaccines related to mutant herpes simplex virus type 1. Summary of the invention

[0004] To overcome the problems of the prior art, the present invention provides a mutant herpes simplex virus type I subunit vaccine and its preparation method and application, aiming to improve the immunogenicity, specificity and immune functions such as virus clearance of the herpes simplex virus subunit vaccine.

[0005] Existing studies have shown that conformational changes in gB may affect the immunogenicity of herpes simplex vaccines. Designing to use proline to replace histidine at position 516 of gB to lock gB in the pre-fusion structure may become an effective vaccine design strategy. In view of this, the present application provides the following technical solutions:

[0006] In a first aspect of the present invention, there is provided a mutant herpes simplex virus type I subunit vaccine, wherein the vaccine comprises a herpes simplex virus gB protein and a composite adjuvant;

[0007] The herpes simplex virus gB protein is a gB protein or a gB H516P mutant protein. The amino acid sequence of the gB protein is as shown in SEQ ID NO.1, and the amino acid sequence of the gB H516P mutant protein is as shown in SEQ ID NO.2; the composite adjuvant consists of CpG oligodeoxynucleotide and QS-21.

[0008] The amino acid sequence of the gB protein is as shown in SEQ ID NO.1:

[0009] ATGAGACAAGGCGCTCCTGCTAGAGGATGTCGTTGGTTCGTTGTGTGGGCC

[0010] CTGCTGGGACTGACACTGGGAGTTCTGGTTGCCTCTGCCGCTCCTTCTTCTC

[0011] CTGGAACACCTGGTGTCGCTGCTGCTACCCAAGCTGCTAATGGCGGACCTG

[0012] CTACTCCTGCTCCACCAGCTCCAGGACCTGCTCCTACTGGCGATACCAAGC

[0013] CTAAGAAGAACAAGAAGCCAAAGAACCCTCCTCCTCCACGGCCTGCCGGC

[0014] GATAATGCTACAGTTGCTGCTGGCCACGCTACCCTGAGAGAGCACCTGAGA

[0015] GATATCAAGGCCGAGAACACCGACGCCAACTTCTACGTGTGTCCTCCTCCT

[0016] ACCGGCGCTACCGTGGTGCAGTTTGAGCAGCCTAGACGGTGCCCTACCAGA

[0017] CCTGAGGGCCAGAATTACACCGAGGGAATCGCCGTGGTGTTCAAAGAGAA

[0018] TATCGCCCCTTACAAGTTCAAGGCCACCATGTACTACAAGGACGTGACCGT

[0019] GTCTCAAGTTTGGTTCGGCCACCGGTACTCCCAGTTCATGGGCATCTTCGA

[0020] GGACAGAGCCCCTGTGCCTTTCGAGGAAGTGATCGACAAGATCAACGCCA

[0021] AGGGCGTGTGCCGGTCCACCGCTAAATACGTGCGGAACAACCTGGAAACC

[0022] ACCGCCTTCCACAGGGACGACCACGAGACAGACATGGAACTGAAGCCCGC

[0023] CAATGCCGCCACCAGAACATCTAGAGGCTGGCACACCACCGACCTGAAGT

[0024] ACAACCCCTCCAGAGTGGAAGCCTTTCACAGATACGGCACCACCGTGAACT

[0025] GCATCGTGGAAGAGGTGGACGCCAGAAGCGTGTACCCCTACGATGAGTTC

[0026] GTGCTGGCTACCGGCGACTTCGTGTACATGTCCCCTTTCTACGGCTACCGCG

[0027] AGGGCTCTCATACCGAGCACACCTCTTACGCCGCCGACCGGTTTAAACAGG

[0028] TGGACGGCTTCTACGCCCGGGACCTGACAACAAAGGCCAGAGCTACCGCT

[0029] CCTACCACCAGAAACCTGCTGACCACACCTAAGTTCACCGTGGCCTGGGAT

[0030] TGGGTGCCCAAGAGGCCTTCTGTGTGCACCATGACCAAGTGGCAAGAGGTC

[0031] GACGAGATGCTGAGATCCGAGTACGGCGGCTCCTTCCGGTTCTCTTCTGAC

[0032] GCCATCTCCACCACCTTCACCACCAATCTGACCGAGTATCCTCTGAGCAGA

[0033] GTGGACCTGGGCGACTGCATCGGAAAGGATGCCAGAGATGCCATGGACCG

[0034] GATCTTCGCCAGACGGTACAACGCTACCCACATCAAAGTGGGCCAGCCTCA

[0035] GTACTACCTGGCCAACGGCGGATTCCTGATCGCCTATCAGCCCCTGCTGTC

[0036] TAACACCCTGGCTGAGCTGTATGTGCGCGAGCATCTGCGGGAACAGTCTCG

[0037] GAAGCCTCCTAATCCTACTCCTCCACCTCCTGGCGCCTCTGCCAATGCCTCT

[0038] GTGGAAAGAATCAAGACCACCTCCTCCATCGAGTTCGCCCGGCTGCAGTTT

[0039] ACCTACAACCACATCCAGCGGCACGTGAACGACATGCTGGGCAGAGTGGC

[0040] TATCGCTTGGTGCGAGCTGCAGAACCATGAGCTGACACTGTGGAACGAGG

[0041] CCCGGAAGCTGAACCCTAACGCTATCGCCTCTGCTACAGTGGGGAGAAGA

[0042] GTGTCTGCCAGAATGCTGGGCGACGTGATGGCCGTGTCTACCTGTGTTCCT

[0043] GTGGCCGCCGATAACGTGATCGTGCAGAACTCCATGCGGATCTCTTCCAGA

[0044] CCTGGCGCTTGCTACTCCCGGCCTCTGGTGTCTTTCAGATACGAGGATCAG

[0045] GGCCCTCTGGTGGAAGGACAGCTGGGCGAGAACAACGAGCTGAGACTGAC

[0046] CAGGGATGCCATCGAGCCTTGTACCGTGGGCCACAGAAGATACTTCACCTT

[0047] CGGCGGAGGCTACGTGTACTTCGAGGAATACGCCTACTCTCACCAGCTGTC

[0048] TCGGGCCGACATCACAACCGTGTCCACCTTCATCGACCTGAACATCACCAT

[0049] GCTGGAAGATCACGAGTTTGTGCCCCTGGAAGTGTACACCCGGCACGAGAT

[0050] CAAGGACTCTGGCCTGCTGGACTATACCGAGGTGCAGCGGAGAAACCAGC

[0051] TGCACGACCTGAGATTCGCCGACATCGATACCGTGATCCACGCCGATGCCA

[0052] ACGCCGCTATGTTTGCTGGACTGGGCGCCTTCTTTGAAGGCATGGGAGATC

[0053] TGGGTAGAGCCGTGGGCAAAGTCGTGATGGGAATCGTTGGCGGCGTGGTG

[0054] TCTGCTGTGTCTGGCGTGTCCTCTTTCATGTCTAACCCCTTTGGCGCCCTGG

[0055] CCGTGGGACTGTTGGTTTTGGCTGGATTGGCTGCCGCCTTCTTCGCCTTTAG

[0056] ATACGTGATGCGGCTGCAGAGCAACCCCATGAAGGCTCTGTACCCTCTGAC

[0057] CACCAAAGAGCTGAAGAACCCTACCAATCCTGACGCCAGCGGCGAAGGCG

[0058] AGGAAGGTGGCGATTTTGACGAGGCCAAGCTGGCCGAGGCCAGAGAAATG

[0059] ATCCGGTATATGGCCCTGGTGTCCGCCATGGAACGGACCGAGCATAAGGCC

[0060] AAGAAGAAGGGCACCTCCGCTCTGCTGTCTGCCAAAGTGACCGACATGGTC

[0061] ATGCGGAAGCGGCGGAACACCAACTACACCCAGGTGCCAAACAAGGACGGCGACGCCGATGAGGATGATCTGTGA。

[0062]

[0063] Furthermore, the mass ratio of CpG oligodeoxynucleotide to QS-21 in the composite adjuvant is 1:1.

[0064] Furthermore, the concentration of gB protein or gB H516P mutant protein in the vaccine is 5 μg per injection, and the addition amount of the composite adjuvant is 10 μg per injection.

[0065] The second aspect of the present invention provides a preparation method of the mutant herpes simplex virus type I subunit vaccine described in the first aspect, comprising the following steps:

[0066] 1) Clone the coding gene sequence corresponding to gB protein or gB H516P mutant protein between the XhoI and EcoRI restriction enzyme cleavage sites of the pBlueScript II SK(+) vector to construct a recombinant pBlueScript II SK(+) vector;

[0067] 2) Then, obtain the target fragment of the gB protein or gB H516P mutant protein coding gene from the above recombinant pBlueScript II SK(+) vector, and insert it into the pATX2 vector to construct a recombinant pATX2 vector;

[0068] 3) Express the protein using mammalian system CHO cells, and purify the protein by affinity chromatography to obtain the gB protein or gB H516P mutant protein;

[0069] 4) Use QS-21 and CpG oligodeoxynucleotide as the composite adjuvant of the subunit vaccine; the mass of gB protein or gB H516P mutant protein in the vaccine is 5 μg, dissolve it in phosphate buffer to prepare 5 μg per animal per injection, and add 5 μg of CpG oligodeoxynucleotide and 5 μg of QS-21 to the injection before immunization, thereby preparing the mutant herpes simplex virus type I subunit vaccine.

[0070] The third aspect of the present invention provides the application of the mutant herpes simplex virus type I subunit vaccine described in the first aspect, or the preparation method described in the second aspect, and the application includes:

[0071] 1) Prepare a pharmaceutical composition for preventing or treating diseases caused by herpes simplex virus infection;

[0072] 2) Prepare a pharmaceutical composition for preventing or treating herpes simplex virus infection.

[0073] Furthermore, the herpes simplex virus subunit vaccine is immunized by intramuscular, subcutaneous or intradermal injection; preferably, it is an intramuscular injection.

[0074] The advantages and beneficial effects of the present invention are:

[0075] 1. In the mutant type I herpes simplex virus subunit vaccine of the present invention, it does not contain any genetic components of the virus, has higher safety compared with other types of vaccines, and has a good protective effect against HSV-1 infection.

[0076] 2. mRNA vaccines have relatively strict requirements for conditions during production quality control and cold chain transportation. Therefore, subunit vaccines have certain advantages, but the immune response level of traditional subunit vaccines is poor. Through comparative experiments in this application, it is confirmed that the levels of humoral immune response and cellular immune response induced by the subunit vaccine using the CpG 1018S+QS-21 adjuvant combination are equivalent to those induced by the mRNA vaccine, and the neutralization effect of the sera of mice after inoculating the subunit vaccine is also equivalent to that of the sera of mice in the mRNA group, laying a foundation for the promotion of subunit vaccines.

[0077] 3. In the mutant type I herpes simplex virus subunit vaccine of the present invention, the histidine at position 516 of the gB protein of the mutant type I herpes simplex virus is proline, locking the gB protein structure in the pre-fusion structure. Experiments have confirmed that, using the CpG1018S+QS-21 adjuvant combination, the gB-specific antibody titer induced by the gB H516P-QS21-CpG vaccine group after gB mutation is higher than that of the gB-QS21-CpG vaccine group.

[0078] 4. The mutant type I herpes simplex virus subunit vaccine of the present invention can not only induce an effective specific IgG antibody titer of gB, cause antigen-specific cellular immune responses represented by IL-2 and IFN-γ, effectively reduce the viral load in the brain, spinal cord, and trigeminal nerve of mice after challenge with the HSV-1 Mckrae virus strain, but also improve the survival rate of mice. BRIEF DESCRIPTION OF THE DRAWINGS

[0079] The present invention will be further described below in conjunction with the drawings and embodiments.

[0080] Figure 1 Show the detection results of the gB-mRNA vaccine and gB H516P-mRNA vaccine described in Comparative Examples 1 and 2; wherein, A: particle size; B: dispersion coefficient; C: encapsulation efficiency.

[0081] Figure 2 Show the detection results of the gB-specific IgG response and neutralizing antibody of the mice described in the test examples; wherein, A: the results of the gB-specific immune response; B: the results of the geometric mean titer detection.

[0082] Figure 3 Show the ELISA detection results described in the test examples; wherein, A: the concentration of IL-2 in the supernatant of spleen cells; B: the concentration of IFN-γ in the supernatant of spleen cells.

[0083] Figure 4 Show the ELISPOT detection results described in the test example; wherein, A: the number of spots of IL-2; B: the number of spots of IFN-γ; C: a representative photograph of the ELISPOT reaction of IL-2; D: a representative photograph of the ELISPOT reaction of IFN-γ;

[0084] Figure 5 Show the flow cytometry detection results described in the test example; wherein, A: the proportion of CD4+ T cells producing IL-2 in mouse spleen cells; B: the proportion of CD4+ T cells producing IFN-γ in mouse spleen cells; C: the proportion of CD8+ T cells producing IL-2 in mouse spleen cells; D: the proportion of CD8+ T cells producing IFN-γ in mouse spleen cells;

[0085] Figure 6 Show the q-PCR detection results described in the test example;

[0086] Figure 7 Show the statistical results of the survival rate and body weight of the mice described in the test example; wherein, A: the survival rate; B: the body weight. Detailed implementation mode

[0087] The examples given are for better illustration of the present invention, but the content of the present invention is not limited to the given examples only. Therefore, those skilled in the art who make non-essential improvements and adjustments to the implementation scheme according to the above invention content still fall within the protection scope of the present invention.

[0088] In the ranges disclosed herein, the endpoints and any values are not limited to the exact ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of each range, between the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.

[0089] The present invention will be described in detail below through examples. It should be understood that the following examples are only used to further explain and illustrate the content of the present invention by way of example, and are not used to limit the present invention.

[0090] In the following examples, CpG 1018S was purchased from Shanghai Sangon Biotech, and QS-21 was purchased from AlphaDiagnoesticInternational.

[0091] Example 1: Preparation of a subunit vaccine containing the gB antigen

[0092] This example provides a subunit vaccine containing the gB antigen, and the vaccine comprises a herpes simplex virus gB protein and a complex adjuvant; the amino acid sequence of the herpes simplex virus gB protein is as shown in SEQ ID NO.1; the complex adjuvant consists of CpG 1018S and QS-21.

[0093] The preparation method of the subunit vaccine containing the gB antigen comprises the following steps:

[0094] 1) Clone the coding gene sequence corresponding to the gB protein between the XhoI and EcoRI restriction enzyme sites of the pBlueScript II SK(+) vector to construct a recombinant pBlueScript II SK(+) vector.

[0095] 2) Then, obtain the target fragment of the coding gene of the gB protein or the gB H516P mutant protein from the above recombinant pBlueScript II SK(+) vector, and insert it into the pATX2 vector to construct a recombinant pATX2 vector; a strep tag is added to the C-terminus of the target fragment.

[0096] 3) Use the mammalian system CHO cells to express the protein respectively, and use Strep- Purify the protein to obtain the gB protein.

[0097] 4) Use QS-21 and CpG 1018S as the complex adjuvant of the subunit vaccine; the mass of the gB protein in the vaccine is 5 μg, which is dissolved in phosphate buffer to be formulated into 5 μg / animal / dose. Before immunization, 5 μg of CpG 1018S and 5 μg of QS-21 are added to the dose to prepare the subunit vaccine containing the gB antigen (gB-QS21-CpG).

[0098] Example 2: Preparation of a subunit vaccine containing the gB H516P antigen

[0099] Referring to the preparation method of the subunit vaccine containing the gB antigen in Example 1, this example provides a subunit vaccine containing the gB H516P antigen (gB H516P-QS21-CpG), the difference being that the gB protein is replaced with the gB H516P mutant protein, and the amino acid sequence of the gB H516P mutant protein is as shown in SEQ ID NO.2.

[0100] Comparative Example 1: Preparation of an mRNA vaccine containing the gB antigen

[0101] This comparative example provides an mRNA vaccine containing the gB antigen, which includes an mRNA sequence encoding the gB protein, and uses LNP to encapsulate the mRNA to prepare a gB-mRNA vaccine for use as a comparative example.

[0102] The preparation method of the gB-mRNA vaccine comprises the following steps:

[0103] In vitro, the synthesized DNA sequence is transcribed into mRNA. After purification by magnetic beads, the mRNA concentration is measured, and the mRNA vaccine is encapsulated with self-made lipid nanoparticles (LNP) (volume ratio is 1:3).

[0104] The mass of the mRNA encoding the gB protein is 18 μg / dose, which is dissolved in phosphate buffer (PBS, pH 7.4) to prepare the mRNA vaccine containing the gB antigen (gB-mRNA vaccine).

[0105] Comparative Example 2: Preparation of the mRNA vaccine containing the gB H516P antigen

[0106] Referring to the preparation method of the mRNA vaccine containing the gB antigen described in Comparative Example 1, this comparative example provides an mRNA vaccine containing the gB H516P antigen. The difference is that the gB protein is replaced with the gB H516P mutant protein, and at the same time, the mass of the gB H516P-mRNA is 17.8 μg / dose, and the gB H516P-mRNA vaccine is prepared.

[0107] Detect the particle size, polydispersity index (PDI), and encapsulation efficiency of the nanoparticles formed by the gB-mRNA vaccine and the gB H516P-mRNA vaccine prepared in Comparative Examples 1 and 2. The detection results are as Figure 1 shown.

[0108] Comparative Example 3: Preparation of the subunit vaccine containing the gB antigen

[0109] Referring to the preparation method of the subunit vaccine containing the gB antigen described in Example 1, this example provides another subunit vaccine containing the gB antigen. The difference is that the composite adjuvant is replaced with alum.

[0110] Using alum as an adjuvant: The mass of the gB protein in the vaccine is 5 μg, which is dissolved in the alum adjuvant to prepare the subunit vaccine containing the gB antigen (gB-alum).

[0111] Comparative Example 4: Preparation of the subunit vaccine containing the gB H516P antigen

[0112] Referring to the preparation method of the subunit vaccine containing the gB H516P antigen described in Example 2, this example provides another subunit vaccine containing the gB H516P antigen. The difference is that the composite adjuvant is replaced with alum.

[0113] Use of alum as an adjuvant: The mass of the gB protein in the vaccine is 5 μg, which is dissolved in the alum adjuvant to prepare the subunit vaccine (gB H516P-alum) containing the gB antigen.

[0114] Test example:

[0115] To compare the immune levels of the subunit vaccines and mRNA vaccines described in Comparative Examples 1-2 and Comparative Examples 1-4, the following animal experiments were conducted in this test example.

[0116] Female BALB / c mice at 6-8 weeks of age without HSV-1 pathogens provided by the Experimental Center of the Institute of Medical Biology, Chinese Academy of Medical Sciences were used. The mice were randomly divided into 8 groups, 7 of which had 15 mice each, and the remaining positive control group had 9 mice. The mice were raised under SPF conditions with free access to food and water. The subunit vaccines of Examples 1 and 2, the mRNA vaccines of Comparative Examples 1 and 2, and the subunit vaccines containing alum adjuvant of Comparative Examples 3 and 4 were used to immunize the mice by intramuscular injection, 50 μL / mouse, and the blank group was injected with an equal volume of PBS. The mice in the positive control group were injected with an equal volume of PBS and injected twice every 4 weeks. Two weeks after the last immunization, 6 mice from the vaccine group and the blank group were randomly selected, anesthetized by intraperitoneal injection of tribromoethanol, and then blood was collected by cardiac puncture and spleens were collected. The blood was placed at 4°C overnight and then centrifuged at 3000 rpm for 20 minutes to obtain serum. A single-cell suspension of splenocytes was obtained by grinding the spleen. At the same time, the remaining mice in the vaccine group and the positive control group were inoculated with a dose of 1×10 4 PFU of the HSV-1 Mckrae virus strain by nasal drip, and the body weights of the mice were weighed continuously for 12 days. On the 4th day after virus challenge, 4 mice were randomly selected and sacrificed, and their brains, spinal cords, and trigeminal nerve tissues were taken.

[0117] By indirect enzyme-linked immunosorbent assay, the obtained serum was serially diluted from 1:2000 to 1:4096000 to detect the gB-specific antibody titer. The results are as Figure 2 shown in A. After two immunizations, the gBH516P subunit vaccine (Example 2) using CpG 1018S and QS-21 adjuvants could induce higher specific gB antibody titers than the gB H516P-mRNA vaccine (Comparative Example 2) and the gB H516P-alum vaccine (Comparative Example 4) (p≤0.001). In the QS-21 and CpG 1018S adjuvant groups, the gB-specific antibody titer induced by the gB H516P-QS21-CpG vaccine (Example 2) after gB mutation was higher than that of the gB-QS21-CpG vaccine (Example 1) (p≤0.001).

[0118] Mouse serum was inactivated at 56°C for 30 minutes, and then the sera collected in Examples 1 and 2 and Comparative Examples 1 to 4 were diluted to 1:512 fold. A negative control group without virus and serum and a positive control group containing only virus were set up. The HSV-1 virus was diluted with DMEM medium, and the serum and the virus were incubated at a ratio of 1:1 for 1 hour at 37°C. After incubation, the virus and serum mixture was added to Vero cells. After 1 hour of incubation, the virus solution was removed. After adding serum-free DMEM medium to wash the cell surface, DMEM containing 2% newborn bovine serum was added, and Vero cells were cultured at 37°C for 4 - 7 days. The cytopathic effect was observed daily. The geometric mean titer detection results of the sera showed that the GMT of the gB-QS21-CpG vaccine (Example 1) was 19.667, which was 4.9 times that of the gB-mRNA vaccine (Comparative Example 1) (p≤0.01) and 3.27 times that of the gB-alum group (Comparative Example 3) (p≤0.05). There was no significant difference in the GMT between gB and gB H516P in the three groups of gB-QS21-CpG and gB H516-QS21-CpG, gB-mRNA and gB H516P-mRNA, and gB-alum and gB H516-alum.

[0119] The double antibody sandwich ELISA method was used to detect the amounts of extracellularly secreted cytokines IL-2 and IFN-γ. A single spleen cell suspension was obtained by grinding the mouse spleen, and the spleen cell concentration was adjusted to 1×10 7 cells / mL by adding RPMI 1640 medium. 100 μL of spleen cells (1×10 6 cells per well) were added to a 96-well cell culture plate, and 50 μL of gB protein stimulant (concentration 30 μg / mL) was added. The cells were cultured at 37°C in 5% CO 2 for about 24 hours. Positive and negative control groups were set up, and 10 μL of PMA+ was added to the positive control group. After incubation, the cell culture supernatant was collected, and the cytokine levels were detected by the standard ELISA method.

[0120] An ELISPOT special culture plate was used to detect the amounts of IL-2 and IFN-γ cytokines. The culture plate was activated with 75% ethanol, and then washed twice with PBS to remove the residual ethanol. Specific anti-IL-2 and anti-IFN-γ primary antibodies at a concentration of 2 μg / mL were added, 50 μL per well, and incubated overnight at 4°C. The next day, the antibody was aspirated, and after washing with 1640 complete medium, fresh 1640 complete medium was added and incubated for 2 hours to block the unbound sites. After removing the 1640 medium, 30 μL of cells (3×10 5spleen cells), supplemented with 75 μL of serum-free medium specific for ELISOPT and 50 μL of gB protein stimulator (60 μg / mL). Set up negative and positive control groups. Add 10 μL of PMA+ to each well of the positive control group. Incubate the culture plate overnight at 37 °C and 5% CO 2 Incubate under the conditions overnight. On the third day, centrifuge at 800 g for 5 minutes, wash with pre-cooled distilled water and PBS, then add secondary antibodies against IL-2 and IFN-γ (1 μg / mL), 50 μL per well, and incubate at room temperature for 2 hours. After washing, add HRP-Streptavidin (1:1500) and incubate at room temperature for 1 hour. After washing with PBS, use an ELISPOT detection kit to visualize the spots, and stop the reaction by rinsing with running water.

[0121] The results of ELISA and ELISPOT are as Figure 3 , Figure 4 shown. The subunit vaccines (Examples 1 and 2) using CpG 1018S and QS-21 as adjuvants can induce IL-2 and IFN-γ levels comparable to or even higher than those of the mRNA vaccines (Comparative Examples 1 and 2). The CpG 1018S and QS-21 adjuvant systems have a good effect on inducing cellular immune responses.

[0122] Flow cytometry was used to detect the number of CD4+ T cells that can secrete IL-2 and IFN-γ. Add the treated spleen cells (1×10 6 cells / well) and gB protein stimulator (90 μg / mL) to a 16-well plate. After culturing at 37 °C for 2 hours, add Brefeldin A to block cytokine secretion and incubate overnight. The next day, transfer the cell suspension to a 1.5 mL centrifuge tube, add 100 μL of Zombie NIR TM dye (diluted 1:2000) containing DMSO, and incubate in the dark at room temperature for 15 minutes. Wash twice with staining buffer, then add 50 μL of staining buffer containing 5 μg / mL of CD16 / CD32 antibody and incubate at 4 °C for 10 minutes. Then add surface staining antibodies diluted with 50 μL of staining buffer, PerCP / Cyanine 5.5-labeled anti-mouse CD4 antibody, and incubate at 4 °C for 30 minutes. After washing with staining buffer, fix the cells with 4% formaldehyde and incubate in the dark at room temperature for 20 minutes to fix the cell membrane. Wash twice with permeabilization wash buffer, incubate for 5 minutes, add 100 μL of intracellular antibodies diluted with permeabilization wash buffer, including PE-conjugated anti-mouse IFN-γ and APC-conjugated anti-mouse IL-2 antibodies, for intracellular staining. Incubate the cells in the dark at room temperature for 40 - 60 minutes. Finally, add 400 μL of permeabilization wash buffer to wash, and then add 400 μL to resuspend the cells.

[0123] Figure 5 The results showed that in terms of the number of CD4+ T cells capable of expressing IL-2 induced, QS-21 and CpG1018S could induce a stronger CD4+ T cell immune response than the aluminum adjuvant group (p≤0.05), and the intensity of this immune response was not significantly different from that induced by the mRNA vaccine (p>0.05). In the results of IFN-γ, the number of positive CD4+ T cells induced by the QS-21 and CpG 1018S groups was lower than that of the mRNA group, but still better than that of the alum adjuvant group (Comparative Examples 3 and 4). QS-21 and CpG 1018S seemed to have limited effects on inducing positive CD8+ T cells.

[0124] The results of q-PCR were as Figure 6 shown. After the attack with the HSV-1 Mckrae virus strain, the brain, spinal cord, and trigeminal nerve tissues were removed from the mice. Compared with the positive control group, no HSV-1 virus was detected in the tissues of the mice inoculated with the subunit vaccine and the mRNA vaccine. After infection with the HSV-1 Mckrae virus strain, the body weights of the mice were measured continuously for 12 days. Figure 7 The results showed that the body weights of the mice in the positive control group decreased significantly on the sixth day after virus challenge. Compared with the PBS group, significant differences occurred on the 7th, 8th, and 9th days (p≤0.001, p≤0.00001, p≤0.0001). On the 8th day after virus challenge, 2 mice in the positive control group died, and 1 mouse in the gB H516P-alum group (Comparative Example 4) died due to non-viral factors. During the 12-day observation period, there was no obvious change in the body weights of the vaccinated mice. On the 6th day after infection, the body weights of the vaccinated mice decreased slightly, which might be because the protective effect of the vaccine was incomplete. The body weights of the mice challenged with PBS also decreased, which might be due to the mice being exposed to the virus-containing aerosol, thus possibly causing cross-infection in the PBS group.

[0125] Finally, it should be noted that the above is only used to illustrate the technical solution of the present invention and not to limit it. Although the present invention has been described in detail with reference to the preferred arrangement, those of ordinary skill in the art should understand that the technical solution of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solution of the present invention.

Claims

1. A mutant herpes simplex virus type I subunit vaccine, characterized in that: The vaccine comprises herpes simplex virus gB protein and a composite adjuvant; The herpes simplex virus gB protein is gB protein or gB H516P mutant protein, the amino acid sequence of gB protein is shown in SEQ ID NO.1, and the amino acid sequence of gB H516P mutant protein is shown in SEQ ID NO.2; the composite adjuvant consists of CpG oligodeoxynucleotide and QS-21.

2. The mutant herpes simplex virus type I subunit vaccine according to claim 1, characterized in that: The mass ratio of CpG oligodeoxynucleotide to QS-21 in the composite adjuvant is 1:

1.

3. The mutant herpes simplex virus type I subunit vaccine according to claim 1 or 2, characterized in that: The concentration of the gB protein or the gB H516P mutant protein in the vaccine is 5 μg / injection, and the added amount of the composite adjuvant is 10 μg / injection.

4. A method for preparing a mutant herpes simplex virus type I subunit vaccine as claimed in any one of claims 1 to 3, characterized in that: The preparation method comprises the following steps: 1) Clone the coding gene sequence corresponding to the gB protein or the gB H516P mutant protein into the XhoI and EcoRI restriction sites of the pBlueScript II SK(+) vector to construct a recombinant pBlueScript II SK(+) vector; 2) Next, the target fragment of the gene encoding the gB protein or the gB H516P mutant protein is obtained from the above-mentioned recombinant pBlueScript II SK(+) vector, and inserted into the pATX2 vector to construct a recombinant pATX2 vector; 3) using mammalian CHO cells to express the protein, and purifying the protein by affinity chromatography to obtain the gB protein or gBH516P mutant protein; 4) QS-21 and CpG oligodeoxynucleotide are used as composite adjuvants of subunit vaccine; the mass of gB protein or gB H516P mutant protein in the vaccine is 5 μg, which is dissolved in phosphate buffer and prepared into 5 μg / animal / injection. Before immunization, 5 μg of CpG oligodeoxynucleotide and 5 μg of QS-21 are added to the injection to prepare the mutant herpes simplex virus type I subunit vaccine.

5. The use of the mutant herpes simplex virus type I subunit vaccine according to any one of claims 1 to 3, or the preparation method according to claim 4, characterized in that: The applications include: 1) Preparing a pharmaceutical composition for preventing or treating diseases caused by herpes simplex virus infection; 2) Preparing a pharmaceutical composition for preventing or treating herpes simplex virus infection.

6. The use according to claim 5, characterized in that: The herpes simplex virus subunit vaccine is administered by intramuscular, subcutaneous or intradermal injection.

Images