Use of substances for detecting SNP polymorphism in identifying or assisting in identifying panax quinquefolium

Abstract

The application discloses application of a substance for detecting SNP polymorphism in identification or auxiliary identification of Panax quinquefolium, and belongs to the field of nucleic acid determination or testing methods in biochemistry. The technical problem to be solved by the application is how to identify or assist in identifying Panax quinquefolium. In the application of the substance for detecting SNP polymorphism in identification or auxiliary identification of Panax quinquefolium, the SNP is SNP2, the SNP2 is a SNP of a chloroplast genome of Panax, and is the 164th nucleotide in SEQ ID No. 5 in the sequence table, and the nucleotide is C or T. The application can accurately distinguish Panax quinquefolium and other species of Panax, and can be used for identification and auxiliary identification of Panax quinquefolium.

Description

Technical Field

[0001] The invention belongs to the field of nucleic acid determination or testing methods in biochemistry, and particularly relates to the application of a substance for detecting SNP polymorphism in identifying or assisting in identifying American ginseng. Background Art

[0002] American ginseng, also known as American ginseng, Western ginseng and Panax quinquefolium, is a perennial herbaceous plant of the genus Panax quinquefolium in the Araliaceae family. Panax quinquefolius L.). American ginseng's benefits include nourishing yin and qi, clearing heat and promoting fluid production. It can be used to treat qi and yin deficiency, internal heat, cough, asthma, blood in sputum, and dry mouth and throat. American ginseng is rich in nutrients, such as panaxatriol, various vitamins, and amino acids, which can enhance physical fitness and improve metabolic capacity. American ginseng shares similar morphology and chemical composition with other closely related species in the genus Panax. However, commercially available products are diverse, and adulteration and mixing are common. Adulteration not only undermines the market order of traditional Chinese medicines but also compromises the efficacy and safety of traditional Chinese medicines. Therefore, developing effective methods for identifying American ginseng varieties is crucial to preventing adulteration and fraud.

[0003] The roots of closely related species of the genus Panax, including American ginseng, have similar appearances, and most commercially available products are pulverized, making them difficult to distinguish using traditional morphological and microscopic methods. Numerous analytical methods have contributed to the identification and quality control of American ginseng. For example, studies have identified the ratios of the unique components ginsenoside Rf, pseudoginsenoside F11, and notoginsenoside R1, as well as the shared components ginsenosides Rg1, Re, and Rb1, as quality markers for Panax ginseng, American ginseng, and Panax notoginseng. Methods for determining the content of these quality markers in traditional Chinese medicines containing Panax ginseng, American ginseng, and Panax notoginseng have been established using ultra-high performance liquid chromatography and ultra-high performance liquid chromatography-tandem mass spectrometry, respectively. However, because samples of closely related plants contain similar bioactive components, and the chemical composition of plants varies significantly depending on growth environment or processing conditions, methods that rely on target species-specific markers or the ratios of shared components have difficulty distinguishing closely related species in complex mixed samples. Molecular identification techniques, such as DNA barcoding, have become powerful tools for species identification.

[0004] Single nucleotide polymorphisms (SNPs), the latest generation of genetic molecular markers, have been widely used to identify closely related species. Pyrosequencing-based SNP detection has been successfully applied to the identification and quantification of Pinellia ternata, Fritillaria cirrhosa, and closely related adulterants in mixed samples. Therefore, by developing species-specific SNPs and specific primer combinations, pyrosequencing-based identification of American ginseng in mixed samples is feasible. Summary of the Invention

[0005] The technical problem to be solved by the present application is how to identify and assist in identifying American ginseng.

[0006] To solve the above technical problem, the present application first provides an application of a substance for detecting SNP polymorphism in identifying or assisting in identifying American ginseng, wherein the SNP is SNP2, the SNP2 is a SNP of a chloroplast genome of Panax genus species, and is the 164th nucleotide in SEQ ID No. 5 in the sequence listing, and the nucleotide is C or T. The letter Y in SEQ ID No. 5 represents any one of C and T.

[0007] In the above application, the detection of SNP polymorphism can be determined by detecting the nucleotide type of SNP2 in the genome of the sample to be tested by at least one of the following methods: DNA sequencing, restriction enzyme digestion fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chip. Among them, the SNP chip includes a chip based on nucleic acid hybridization reaction, a chip based on single-base extension reaction, a chip based on allele-specific primer extension reaction, a chip based on "one-step" reaction, a chip based on primer ligation reaction, a chip based on restriction enzyme reaction, a chip based on protein DNA binding reaction, and a chip based on fluorescence molecular DNA binding reaction.

[0008] In the above application, the substance is a substance for detecting SNP2 polymorphism; and the substance for detecting SNP2 polymorphism is E1), E2) or E3) as follows:

[0009] E1) contains a pair of PCR primers for amplifying a genomic DNA fragment containing the SNP2 site;

[0010] E2) contains a PCR reagent containing the PCR primer pair of E1);

[0011] E3) contains a kit containing the PCR primer pair of E1) or the PCR reagent of E2).

[0012] In the above application, the pair of PCR primers for amplifying a genomic DNA fragment containing the SNP2 site can be a primer pair composed of PGF2 and PGR2:

[0013] The PGF2 is a single-stranded DNA represented by SEQ ID No. 6 in the sequence listing;

[0014] The PGR2 is a single-stranded DNA represented by SEQ ID No. 7 in the sequence listing.

[0015] In the above application, the PCR primer can be labeled or not labeled. The label refers to any atom or molecule that can be used to provide a detectable effect and can be connected to nucleic acid. The label includes but is not limited to dyes; radioactive labels, such as32 P; a binding moiety, such as biotin (Biotin); a hapten, such as digoxin (DIG); a luminescent, phosphorescent, or fluorescent moiety; and a fluorescent dye alone or in combination with a moiety that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, mass determination, X-ray diffraction or absorption, magnetism, enzymatic activity, etc. The label can be a charged moiety (positive or negative charge) or, alternatively, can be charge neutral. The label can include or be combined with a nucleic acid or protein sequence, provided that the sequence comprising the label is detectable. In some embodiments, the nucleic acid is detected directly (e.g., the sequence is read directly) without a label.

[0016] In the above application, the 5' end of the PGR2 can be labeled with biotin Biotin.

[0017] In the above application, the substance for detecting the polymorphism of SNP2 can further comprise a primer PGS2 for pyrosequencing, which is a single-stranded DNA as shown in SEQ ID No. 8 in the sequence listing.

[0018] The present application also provides a product comprising the above-mentioned substance for detecting the polymorphism of SNP. The product is used for identifying or assisting in identifying a sample claimed to be Panax quinquefolium or a sample claimed to contain Panax quinquefolium.

[0019] The present application also provides a method for identifying or assisting in identifying Panax quinquefolium by SNP, which comprises the steps of detecting the polymorphism of SNP2 in a sample to be tested, and determining the presence of Panax quinquefolium in the sample to be tested.

[0020] The SNP2 is a SNP of the chloroplast genome of Panax genus, which is the 164th nucleotide of SEQ ID No. 5 in the sequence listing, and the nucleotide is C or T;

[0021] The determination criteria are as follows: when the nucleotide of SNP2 is only C, the sample to be tested is Panax quinquefolium; when the nucleotide of SNP2 is only T, the sample to be tested does not contain Panax quinquefolium, but contains the rest of the species of Panax genus other than Panax quinquefolium; and when the nucleotide of SNP2 is both C and T, the sample to be tested contains both Panax quinquefolium and the rest of the species of Panax genus other than Panax quinquefolium.

[0022] In the method, the polymorphism of SNP2 in the sample to be tested is detected by taking the genomic DNA of the sample to be tested as a template, performing PCR amplification by using a primer pair consisting of the single-stranded DNA represented in SEQ ID No. 6 in the sequence listing and the single-stranded DNA represented in SEQ ID No. 7 in the sequence listing, and then performing pyrosequencing by using the single-stranded DNA represented in SEQ ID No. 8 in the sequence listing as a primer; and the 5' end of the single-stranded DNA represented in SEQ ID No. 7 in the sequence listing is labeled with biotin Biotin.

[0023] In the present application, the sample to be tested can be specifically a sample claimed to be Panax quinquefolium or a sample claimed to contain Panax quinquefolium.

[0024] The specific SNP molecular marker of Panax quinquefolium obtained by screening in the chloroplast genome sequence provided in the present application has the characteristics of high specificity and strong specificity, and can accurately separate Panax quinquefolium from other species in the genus Panax, and identify Panax quinquefolium from Panax quinquefolium and its close relatives. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 Table 1 Pyrosequencing results of the specific SNP site of Panax ginseng and three samples to be tested in Example 2; wherein, Figure 1 A of Table 1 is the information of the specific SNP site SNP1 of Panax ginseng, Figure 1 B of Table 1 is the pyrosequencing result of the mixed sample at SNP1.

[0026] Figure 2 Table 2 Pyrosequencing results of the specific SNP site of Panax quinquefolium and three samples to be tested in Example 2; wherein, Figure 2 A of Table 2 is the information of the specific SNP site SNP2 of Panax quinquefolium, Figure 2 B of Table 2 is the pyrosequencing result of the mixed sample at SNP2.

[0027] Figure 3 Table 3 Pyrosequencing results of six samples to be tested in Example 3; wherein, Figure 3 A of Table 3 is the pyrosequencing result of powder sample 1, powder sample 2 and powder sample 3 at SNP2, Figure 3 B of Table 3 is the pyrosequencing result of powder sample 4, powder sample 5 and powder sample 6 at SNP2. DETAILED DESCRIPTION

[0028] The present application will be further described in detail below in conjunction with specific embodiments. The examples provided below are only intended to illustrate the present application, and are not intended to limit the scope of the present application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not constitute any limitation on the present application in any way.

[0029] In the following examples, the first position of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA, unless otherwise specified.

[0030] In the following examples, the experimental methods are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels unless otherwise specified.

[0031] Example 1. Screening of SNP sites for identifying Panax species

[0032] The chloroplast genome (CP) sequences of 106 species in the genus Panax were downloaded from the GenBank database based on NCBI (https: / / www.ncbi.nlm.nih.gov / ). Single nucleotide polymorphism sites (SNPs) were screened by multiple sequence alignment using CodonCode software, and the specificity of the candidate SNPs was determined using the BLAST tool in NCBI.

[0033] One SNP site that can distinguish P. ginseng and the rest of the species in the genus Panax was screened out, which was numbered as SNP1. One SNP site that can distinguish P. quinquefolius and the rest of the species in the genus Panax was screened out, which was numbered as SNP2. The positions of SNP1 and SNP2 and primer information are shown in Table 1:

[0034] Table 1. SNP1 and SNP2 and their specific PCR primers and sequencing primers

[0035]

[0036] Note: Biotin in the table indicates that the 5' end of the sequence is labeled with biotin Biotin.

[0037] SNP1 is a P. ginseng specific SNP site, which is a SNP in the chloroplast genome of Panax species, and is the 29964th nucleotide of the NC_006290.1 CP sequence, which is G or C, represented by the letter S, corresponding to the 71st position of SEQ ID No. 1 in the sequence listing (SEQ ID No. 1 is the nucleotide sequence of the PCR product amplified with PGF1 (SEQ ID No. 2) and PGR1 (SEQ ID No. 3) as primers). The nucleotide of P. ginseng SNP1 is G, and the nucleotide of the rest of the species in the genus Panax other than P. ginseng is C.

[0038] SEQ ID No. 1

[0039] TCGGTCAGAATCCCTTTTTGACTCTGCACCGTTGATTCCACTATTATTAATGAGCAATAATGGAATAATTSCTTCATAGAGATAGGGGACATAATTCACATGGATATAGTAAGTCTTGCTTGGGCTGCTTTAATGGTAGTCTTTACATTTTCCCTTTCACTCG

[0040] When the Panax sample to be tested is subjected to PCR amplification with PGF1 and PGR1 as primers, and pyrosequencing with PGS1 as primer, the following criteria are used for judgment: when the sequencing result shows that SNP1 is only base G, it can be determined that the sample to be tested contains only Panax ginseng; when it is only base C, it can be determined that the sample to be tested does not contain Panax ginseng, but contains other Panax species; when it contains both base G and base C, it can be determined that the sample to be tested contains both Panax ginseng and other Panax species.

[0041] SNP2 is a specific SNP site of Panax quinquefolius, which is a SNP of the chloroplast genome of Panax species, and is the 79770th nucleotide of the NC_027456.1 CP sequence, which is represented by the letter Y, corresponding to the 164th position of SEQ ID No. 5 (SEQ ID No. 5 is the nucleotide sequence of the PCR product amplified with PGF2 (SEQ ID No. 6) and PGR2 (SEQ ID No. 7) as primers) wherein the nucleotide of Panax quinquefolius SNP2 is C, and the nucleotide of other Panax species SNP2 is T.

[0042] SEQ ID No. 5

[0043] GTCTTTTTGATTGGTACCGCAGTGGCCCTTTGGTTAGGTATTGGTGCAACATTACCTATTGATAAATCCCTAACTTTAGGTCTTTTTTAATTTTAAAATTTATTGAATTGTGAAATAAAATATCACGACGTGTGTATCTAGGGAATAGTCGCTTCAACCAAAGYGAATTCTCCCTAGATACATCTATTCAATTTAATTCGGGAATCTATCCCGATTCCGAATATATGG

[0044] When the Panax sample to be tested is subjected to PCR amplification with PGF2 and PGR2 as primers and pyrosequencing with PGS2 as primer, the following criteria are used for judgment: when the sequencing result shows that SNP2 is only base C, it can be determined that the sample to be tested contains only American ginseng; when it is only base T, it can be determined that the sample to be tested does not contain American ginseng and contains only the rest of the Panax species; when it contains both base C and base T, it can be determined that the sample to be tested contains both American ginseng and the rest of the Panax species.

[0045] Example 2. Identification of Panax and American ginseng in mixed powders of medicinal materials

[0046] This example proposes a method for rapidly identifying Panax and American ginseng in mixed powders, which specifically comprises the following steps:

[0047] (1) Collect 3 kinds of authentic Panax and American ginseng medicinal materials respectively, slice and dry them, crush them, pass them through a 100-mesh sieve, and seal the powders in self-sealing bags for later use, to obtain Panax powder 1, Panax powder 2, Panax powder 3, American ginseng powder 1, American ginseng powder 2, and American ginseng powder 3.

[0048] (2) Take 100 mg of each of the Panax medicinal material powder samples and 100 mg of each of the American ginseng medicinal material powder samples, and mix them to obtain 3 kinds of mixed powder samples with a total mass of 200 mg. The specific mixed sample information is shown in Table 2:

[0049] Table 2. Information of samples to be tested mixed from different powders

[0050]

[0051] (3) Take 3 kinds of mixed and uniform sample powders in Table 2, and extract genomic DNA from them respectively using the improved CTAB method to obtain 3 kinds of sample genomic DNA.

[0052] (4) Take 3 kinds of sample genomic DNA as templates, and first perform PCR amplification on the fragment (A) containing the specific SNP site SNP1 of Panax using the amplification primers PGF1 and PGR1 to obtain amplification product 1. Figure 1

[0053] PCR system total volume (25 μL): 12.5 μL of 2×Taq Master Mix, 1 μL of each of forward and reverse primers (2.5 μmol / L), 2 μL of DNA template, and 8.5 μL of deionized water.

[0054] Reaction procedure: pre-denaturation (94℃, 4 min), denaturation (94℃, 30 s) - annealing (56℃, 1 min) - extension (72℃, 1 min) for 35 cycles, and extension (72℃, 10 min).​

[0055] (5) The pyrosequencing is performed on the amplification product 1 by using the primer PGS1 to detect the polymorphism of SNP1.

[0056] The pyrosequencing results of the amplification products 1 of the three to-be-tested samples at SNP1 are all the base G and the base C (the B of the A), Figure 1 It can be determined that the three to-be-tested samples all contain Panax ginseng and other Panax species.

[0057] (6) Further, the fragment (the A) containing the specific SNP site SNP2 of Panax quinquefolium is amplified by using the amplification primers PGF2 and PGR2 as the template of the genomic DNA of the three to-be-tested samples. Figure 2

[0058] The total volume of the PCR system (25 μL) is 12.5 μL of 2×Taq Master Mix, 1 μL of the forward and reverse primers (2.5 μmol / L) respectively, 2 μL of the DNA template and 8.5 μL of deionized water.

[0059] The reaction procedure is as follows: pre-denaturation (94℃, 4min), denaturation (94℃, 30S) - annealing (56℃, 1min) - extension (72℃, 1min) for 35 cycles, and extension (72℃, 10min).

[0060] (7) The pyrosequencing is performed on the amplification product 2 by using the primer PGS2 to detect the polymorphism of SNP2.

[0061] The pyrosequencing results of the amplification products 2 of the three to-be-tested samples at SNP2 are all the base C and the base T (the B of the A), Figure 2 It can be determined that the three to-be-tested samples all contain Panax quinquefolium and other Panax species.

[0062] It can be seen that the three mixed samples are identified by the specific SNP site detection of the pyrosequencing instrument, the result is consistent with the actual situation, and the effectiveness and accuracy of the method are proved.

[0063] Example 3. Identification of Panax quinquefolium and Panax notoginseng in mixed powders of medicinal materials

[0064] The example provides a method for rapidly identifying Panax quinquefolium and Panax notoginseng in mixed powders, which specifically comprises the following steps:

[0065] (1) Three kinds of genuine Panax notoginseng medicinal materials are collected, are cut and dried, are crushed, are passed through a 100-mesh sieve, and are sealed in self-sealing bags for use, to obtain Panax notoginseng powder 1, Panax notoginseng powder 2 and Panax notoginseng powder 3.

[0066] ​(2) Take the American ginseng medicinal material powder sample and the Panax notoginseng medicinal material powder sample respectively, and mix them into mixed powder samples with a total mass of 100 mg respectively, and the specific mixed sample information is shown in Table 3:

[0067] Table 3. Information of the to-be-tested samples mixed with different powders

[0068]

[0069] (3) Take the 6 to-be-tested sample powders in Table 3 respectively, and perform genomic DNA extraction on the 6 to-be-tested sample powders respectively by using the improved CTAB method to obtain 6 to-be-tested sample genomic DNAs.

[0070] (4) Take the 6 to-be-tested sample genomic DNAs as templates respectively, and perform PCR amplification on the fragment (A) at the specific SNP site SNP2 of American ginseng by using the amplification primers PGF2 and PGR2 to obtain amplification product 2. Figure 2

[0071] The total volume (25 μL) of the PCR system: 12.5 μL of 2x Taq Master Mix, 1 μL of forward and reverse primers (2.5 μmol / L) respectively, 2 μL of DNA template and 8.5 μL of deionized water.

[0072] Reaction procedure: pre-denaturation (94℃, 4 min), denaturation (94℃, 30 s) - annealing (56℃, 1 min) - extension (72℃, 1 min) for 35 cycles, and extension (72℃, 10 min).

[0073] (7) Perform pyrosequencing on the amplification product 2 by using the primer PGS2 to detect the polymorphism of SNP2.

[0074] The pyrosequencing results of the amplification product 2 of the 6 to-be-tested samples at SNP2 show that powder sample 1, powder sample 2 and powder sample 3 both show base C and base T (A), so it can be determined that the 3 to-be-tested samples both contain American ginseng and other Panax species other than American ginseng. Figure 3 The pyrosequencing results of the amplification product 2 of the 6 to-be-tested samples at SNP2 show that powder sample 4, powder sample 5 and powder sample 6 only show base T (B), so it can be determined that the 3 to-be-tested samples only contain other Panax species other than American ginseng. Figure 3

[0075] It can be seen that the 6 mixed samples are identified by detecting the specific SNP site by using the pyrosequencing instrument, the results are consistent with the actual situation, and the effectiveness and accuracy of the method are proved.

[0076] ​​The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a specific example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the application intends to include any change, use or improvement of the application, including the change made by the conventional technology known in the art out of the range disclosed in the application, and the application of some basic features.

Claims

1. Use of a substance for detecting SNP polymorphism in identifying or assisting in identifying American ginseng, characterized in that: The SNP is SNP2, which is a SNP in the chloroplast genome of a Panax species and is the 164th nucleotide of SEQ ID No. 5 in the sequence list, and the nucleotide is C or T.

2. The use according to claim 1, characterized in that: The substance is a substance for detecting SNP2 polymorphism; the substance for detecting SNP2 polymorphism is the following E1), E2) or E3): E1) containing a PCR primer pair for amplifying a genomic DNA fragment including the SNP2 site; E2) a PCR reagent containing the PCR primer pair described in E1); E3) A kit containing the PCR primer pair described in E1) or the PCR reagent described in E2).

3. The use according to claim 2, characterized in that: The PCR primer pair for amplifying the genomic DNA fragment including the SNP2 site is a primer pair consisting of PGF2 and PGR2: The PGF2 is a single-stranded DNA shown in SEQ ID No. 6 in the sequence list; The PGR2 is a single-stranded DNA shown in SEQ ID No. 7 in the sequence table.

4. The use according to claim 3, characterized in that: The 5' end of the PGR2 may be labeled with biotin.

5. The use according to claim 4, characterized in that: The material for detecting the SNP2 polymorphism further comprises a primer PGS2 for pyrophosphate sequencing, and the PGS2 is a single-stranded DNA shown in SEQ ID No. 8 in the sequence table.

6. A method for identifying or assisting in identifying American ginseng using SNPs, characterized in that: The method comprises the steps of detecting the polymorphism of SNP2 in the sample to be tested, and determining the content of American ginseng in the sample to be tested; The SNP2 is a SNP in the chloroplast genome of a Panax species, which is the 164th nucleotide of SEQ ID No. 5 in the sequence list, and its nucleotide is C or T; The judgment criteria are: when the nucleotide of SNP2 is only C, the sample to be tested is American ginseng; when the nucleotide of SNP2 is only T, American ginseng does not exist in the sample to be tested, but other species of Panax ginseng exist besides American ginseng; when the nucleotide of SNP2 contains both C and T, both American ginseng and other species of Panax ginseng exist in the sample to be tested.

7. The method according to claim 6, characterized in that: The method for detecting the polymorphism of SNP2 in the test sample is to use the genomic DNA of the test sample as a template, perform PCR amplification with a primer pair consisting of the single-stranded DNA shown in SEQ ID No. 6 in the sequence listing and the single-stranded DNA shown in SEQ ID No. 7 in the sequence listing, and then perform pyrophosphate sequencing using the single-stranded DNA shown in SEQ ID No. 8 in the sequence listing as a primer; the 5' end of the single-stranded DNA shown in SEQ ID No. 7 in the sequence listing is labeled with biotin.

Images