A diflubenzuron / SPc / dsCHS multi-component compound insecticide and its preparation method

Abstract

The present invention provides a diflubenzuron / SPc / ds CHS Multi-component compound insecticide and preparation method thereof, the compound insecticide comprises diflubenzuron / SPc complex and ds CHS , the ds CHS The mass ratio of ds to SPc in the diflubenzuron / SPc complex is 0.1-5:1; the ds CHS The nucleotide sequence of the diflubenzuron / SPc / ds CHS Multi-component insecticide CHS Chitin synthase gene, after being treated with diflubenzuron, CHS Gene expression is elevated in response to the reduction of chitin, in ds CHS Silencing the chitin synthase gene through RNAi will further disrupt the chitin synthesis of aphids, increasing their mortality rate from 46.67% to 82.22%.

Description

Technical Field

[0001] The present invention belongs to the field of insecticides, and in particular relates to a diflubenzuron / SPc / ds CHS Multi-component compound insecticide and preparation method thereof. Background Art

[0002] Faced with the limitations of traditional synthetic pesticides due to environmental pollution and increased pest resistance, there is an urgent need to reduce the use of chemical pesticides and to develop control technologies that delay the development of pest resistance. RNAi technology has become a revolutionary direction for green pesticides due to its high specificity and low residue potential. However, it is limited by the fact that dsRNA is easily degraded in the insect body and has low efficiency at a single target, making it difficult to achieve a good control effect alone. However, combining chemical pesticides with dsRNA can reduce the use of chemical pesticides while optimizing the control effect and reducing the impact on non-target insects. Among them, diflubenzuron inhibits the synthesis of chitin in the insect cuticle, causing the larvae to be unable to molt normally and eventually die. It relies on the insect's molting process, so compared to neurotoxic insecticides, its insecticidal speed is slower and cannot achieve rapid control of aphid populations. Although diflubenzuron mainly acts on chitin synthesis, high-dose application may have adverse effects on natural enemy insects (such as parasitic wasps and predatory insects). ds CHS It is highly specific and only targets the key genes of target pests without affecting non-target insects, thereby improving the compatibility of biological control. Summary of the Invention

[0003] In view of this, the present invention aims to overcome the defects in the prior art and proposes a diflubenzuron / SPc / ds CHS Multi-component compound insecticide and preparation method thereof.

[0004] To achieve the above object, the technical solution of the present invention is achieved as follows:

[0005] The present invention provides a diflubenzuron / SPc / ds CHS Multi-component compound insecticide, the compound insecticide comprises diflubenzuron / SPc complex and ds CHS , the ds CHS The mass ratio of ds to SPc in the diflubenzuron / SPc complex is 0.1-5:1; the ds CHS The nucleotide sequence is shown in SEQ ID NO.1.

[0006] Furthermore, the diflubenzuron / SPc complex is formed by incubating the nanocarrier SPc and diflubenzuron, and the mass ratio of the nanocarrier SPc to diflubenzuron is 0.5-3:1.

[0007] The present invention also provides a diflubenzuron / SPc / ds CHS The preparation method of the multi-component compound insecticide comprises the following steps:

[0008] Step 1 is to incubate the nanocarrier SPc with diflubenzuron to obtain a diflubenzuron / SPc complex;

[0009] Step 2 is to combine the diflubenzuron / SPc complex with ds CHS Incubate to obtain the diflubenzuron / SPc / ds CHS Multi-component compound insecticide.

[0010] Furthermore, the incubation step in step 1 is performed at a temperature of 20-35° C. and for a time of 1-30 minutes.

[0011] Furthermore, the incubation step in step 2 is performed at a temperature of 20-35° C. and for a time of 1-30 minutes.

[0012] The present invention provides a chitin synthesis inhibitor, which contains 1-100% by mass of the diflubenzuron / SPc / ds CHS Multi-component compound insecticide.

[0013] The star-shaped polycation (SPc), with its combined hydrophobic core and multifunctional hydrophilic shell, not only enhances the stability of dsRNA but also, through a multi-component synergistic delivery strategy, achieves a dual linkage effect of "gene regulation + chemical intervention," significantly improving control effectiveness and reducing R&D costs. This technological system, through the multifunctional integration of nanocarriers and the spatiotemporal synergy of multiple active ingredients, offers a new paradigm for addressing the challenges of RNA pesticide industrialization, combining high efficiency, sustainability, and environmental friendliness.

[0014] Compared with the prior art, the present invention has the following advantages:

[0015] The diflubenzuron / SPc / ds of the present invention CHS Multi-component insecticide CHS Chitin synthase gene, after being treated with diflubenzuron, CHS Gene expression is elevated in response to the reduction of chitin, in ds CHS Silencing the chitin synthase gene through RNAi will further disrupt the chitin synthesis of aphids, increasing their mortality rate from 46.67% to 82.22%. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 This is an isothermal calorimetric diagram of the titration of SPc with diflubenzuron according to an embodiment of the present invention;

[0017] Figure 2 The mortality rate of green peach aphids after treatment with the insecticides diflubenzuron and diflubenzuron / SPc according to the embodiments of the present invention is shown in Figure A, which is a root suction method and Figure B, which is a backboard drip method.

[0018] Figure 3 This is the transcriptome analysis of green peach aphid after treatment with diflubenzuron and diflubenzuron / SPc complex as described in the examples of the present invention: Figure A shows gene expression, Figures B and C show gene pathways, and Figure D shows gene expression levels;

[0019] Figure 4 ds described in the embodiment of the present invention CHS Isothermal titration calorimetry results for the titration of diflubenzuron / SPc: Figure A shows the binding interaction, and Figure B shows the isothermal titration calorimetry results.

[0020] Figure 5 The diflubenzuron, diflubenzuron / SPc and diflubenzuron / SPc / ds described in the embodiments of the present invention CHS Transmission electron micrographs of: Figure A shows diflubenzuron, Figure B shows diflubenzuron / SPc, and Figure C shows diflubenzuron / SPc / ds CHS ;

[0021] Figure 6 The diflubenzuron / SPc / ds described in Example 1 of the present invention CHS Effects of multiple complexes on peach aphids: Figure A shows CHS Figure 2 shows the gene expression levels, and Figure B shows the mortality rate. DETAILED DESCRIPTION

[0022] Unless otherwise defined, the technical terms used in the following examples have the same meanings as commonly understood by those skilled in the art to which this invention belongs. The experimental reagents used in the following examples, unless otherwise specified, are conventional biochemical reagents; the experimental methods described, unless otherwise specified, are conventional methods.

[0023] For the preparation method of SPc, please refer to the article "A Facile-Synthesized Star Polycation Constructed as a Highly Efficient Gene Vector in Pest Management".

[0024] The present invention will be described in detail below with reference to the embodiments.

[0025] Example 1 Drug-carrying capacity and binding force of nanocarrier (SPc) for diflubenzuron

[0026] After incubating SPc with an excess of diflubenzuron, the mixture was dialyzed using a 20,000 dp dialysis bag to remove any diflubenzuron not bound to the nanocarriers. This resulted in a diflubenzuron / SPc complex, and the drug loading efficiency of SPc on diflubenzuron was calculated. Next, diflubenzuron and SPc were added according to the drug loading efficiency, and the mixture was incubated at room temperature for 15 minutes to obtain the diflubenzuron / SPc complex.

[0027] Isothermal titration calorimetry (ITC) was used to analyze the interaction between diflubenzuron and SPc. Specifically, 250 μL of diflubenzuron (0.1 mM) was titrated against 2 mL of SPc (0.01 mM) solution. The isothermal titration calorimeter (TANANO) was set up with the following test conditions: a detection temperature of 25°C, and 19 titrations were performed, with 10 μL injections per session, every 90 seconds. The titration data were processed using NanoAnalyze™ software and fitted with an independent model to obtain thermodynamic parameters such as Ka, ΔH, and ΔS.

[0028] Diflubenzuron can spontaneously combine with SPc in aqueous solution to form a diflubenzuron / SPc complex. The drug loading rate measured by freeze-drying method was 31.1%. Isothermal titration calorimetry results showed that ( Figure 1 As shown in Figure 2), diflubenzuron has a higher binding coefficient Ka (M -1 ) is 6.85×10 4 , indicating a strong interaction between the two. The entropy change, ΔH, was -9654 kcal / mol, and the functional change, ΔS, was -32.3 kcal / mol / deg. Based on the Gibbs free energy: ΔG = ΔH - TΔS, the calculated Gibbs free energy of the interaction, ΔG, was -23.76 kcal / mol, indicating spontaneous binding of diflubenzuron and SPc. Based on the ΔH and ΔS values ​​of the reaction, it can be inferred that the binding between diflubenzuron and SPc is primarily hydrogen bonding.

[0029] Example 2 Indoor biological activity determination of diflubenzuron / SPc complex

[0030] The toxicity of diflubenzuron to Myzus persicae (Myzus persicae) was tested using a dorsal spot test. Diflubenzuron reagents were prepared using the original drug at concentrations of 5 mg / L, 25 mg / L, 50 mg / L, 100 mg / L, 200 mg / L, and 500 mg / L. A control group containing the same concentration of DMSO was used, and the mortality rate within 3 days was calculated. Each treatment included 30 Myzus persicae, with three biological replicates.

[0031] The toxicity of diflubenzuron / SPc multicomponent complex to aphids was evaluated by the back plate drop method. The following treatments were set: water (control), SPc, diflubenzuron (LC 20 ) and diflubenzuron / SPc. Approximately 30 peach aphids were fed each treatment, with three replicates. Mortality was observed and recorded within three days.

[0032] The toxicity of the diflubenzuron / SPc multicomponent complex to aphids was further evaluated using the root aspiration method. Treatment groups and concentrations were the same as above, with approximately 30 peach aphids treated in each group, with three replicates. Aphid mortality was recorded over a three-day period.

[0033] After 3 days of treatment with diflubenzuron, the mortality of 3rd instar peach aphids was determined by toxicity test. The median lethal concentration (LC 50 ) is 92.107 mg / L, and the sublethal concentration (LC 20 ) was 21.866 mg / L (as shown in Table 1).

[0034] Table 1 Toxicity of diflubenzuron to Myzus persicae

[0035]

[0036] Three days after treatment with the diflubenzuron / SPc complex, the mortality rate of peach aphids was measured. It was found that the mortality rate of peach aphids caused by the dorsal dripping of diflubenzuron was 20.56%, while the mortality rate of the diflubenzuron / SPc complex reached 46.11%, an increase of 124.32% compared with the treatment with diflubenzuron alone. The mortality rate of peach aphids caused by the root suction method was 23.89%, while the mortality rate of the diflubenzuron / SPc complex reached 41.67%, an increase of 74.42% compared with the treatment with diflubenzuron alone. Figure 2 shown.

[0037] Example 3 Analysis of the lethal mechanism of green peach aphids treated with diflubenzuron

[0038] Thirty peach aphids were treated with water and diflubenzuron, respectively, with three replicates per treatment. Total RNA was extracted 24 hours after treatment. Transcriptome libraries were constructed using the Illumina HiSeq sequencing platform and aligned and annotated against the KEGG database using BLASTX. The expression levels of individual transcripts were expressed using FPKM values. Differentially expressed genes (DEGs) between treatments were analyzed using DESeq, with a fold change ≥ 2.0 and an FDR < 0.01, to further explore the molecular mechanisms underlying the lethal effects of the interference on peach aphids.

[0039] Transcriptome analysis revealed that the expression of 625 genes was significantly altered after treatment with diflubenzuron / SPc complex compared to that after treatment with diflubenzuron. A total of 476 genes were upregulated and 149 genes were downregulated (e.g. Figure 3 KEGG analysis revealed that DEGs can be divided into multiple gene pathways, such as fat digestion and absorption, hormone synthesis and metabolism, and stratum corneum formation (e.g. Figure 3 At the same time, we selected several differentially expressed genes to verify the accuracy of the transcriptome (e.g. Figure 3 (as shown in Figure D in the figure).

[0040] The main target of diflubenzuron is the chitin synthesis pathway of insects. We found that the diflubenzuron / SPc complex is more effective than diflubenzuron alone in treating peach aphids. We found that the chitin synthetase gene ( CHS ) was significantly upregulated ( Figure 3 Chitin synthase is a key enzyme in the chitin synthesis pathway of insects. It is crucial for the synthesis of insect cuticles and affects a series of metamorphosis such as the formation of new cuticles and the shedding of old cuticles. Therefore, further interference CHS Genes will further hinder the growth and development of peach aphids, affect the life activities of aphids, further affect the molting behavior of aphids, and eventually lead to their death.

[0041] Example 4 ds CHS With diflubenzuron / SPc / ds CHS Synthesis of multi-component insecticides

[0042] First, total RNA from each instar of P. persicae was extracted using an RNA extraction kit (Quanshijin, China), and its quality was checked by measuring RNA concentration and performing 1% agarose gel electrophoresis. Subsequently, the RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara, Japan).

[0043] After retrieving the sequence information for CHS (gene ID: 111032968) from the NCBI website, primers for the target fragment were designed and synthesized (forward primer: TGTTCTTCATGACGTCCCAA, nucleotide sequence shown in SEQ ID NO. 2; backward primer: GTTTTTCCGGGTGTAGCAAA, nucleotide sequence shown in SEQ ID NO. 3). Using Myzus persicae cDNA as a template, the target CHS fragment was amplified by PCR using these primers, and the amplified product was detected by agarose gel electrophoresis. The target band was recovered using a gel extraction kit, ligated with the pMD19T-Vector, and transformed into competent Escherichia coli (DH5α) cells. The transformation product was evenly plated on LB solid medium supplemented with 100 mg / L ampicillin and incubated in an inverted manner at 37°C overnight. The next day, a single colony was selected as a template for PCR verification, and the gene sequence of the positive strain was sequenced.

[0044] The plasmid of the strain with the correct sequencing results was extracted as a template, and PCR amplification was performed again using CHS primers with T7 sequence, and the amplified product was recovered using a gel recovery kit. Finally, ds CHS .

[0045] Press SPc and ds CHSAdd ds at a mass ratio of 1:1 CHS Diflubenzuron / SPc was incubated at room temperature for 15 min to obtain diflubenzuron / SPc / ds CHS Multi-component insecticide.

[0046] Example 5 Diflubenzuron / SPc / ds CHS Analysis and characterization of the binding mechanism of multi-component insecticides

[0047] Isothermal titration calorimetry (ITC) was used to analyze the relationship between diflubenzuron / SPc and ds CHS The specific operation is as follows: in 2 mL of diflubenzuron / SPc (0.1 mM) solution, 250 μL of 1 mM ds CHS , and record the thermodynamic parameters during the titration process to analyze the binding mechanism of multi-component insecticides.

[0048] Isothermal titration calorimetry results showed that (eg Figure 4 shown), ds CHS Has a lower dissociation coefficient K with diflubenzuron / SPc d (M) is 7.9×10 -6 , indicating a strong interaction between the two. The entropy change, ΔH, was -10.1 kJ / mol, and the functional change, ΔS, was 64.1 J / mol•K. Based on the Gibbs free energy: ΔG = ΔH - TΔS, the calculated Gibbs free energy, ΔG, of the interaction between the two substances was -29.2 kJ / mol, indicating spontaneous binding of dsCHS and diflubenzuron / SPc. Based on the ΔH and ΔS values ​​of the reaction, it can be inferred that the binding between dsCHS and diflubenzuron / SPc is primarily electrostatic.

[0049] In addition, high-sensitivity Zeta potential and particle size analyzer were used to determine the CHS , SPc and its different combinations (diflubenzuron / SPc, ds CHS / SPc、Diflubenzuron / SPc / ds CHS The particle morphology was observed by transmission electron microscopy to characterize the structural characteristics of the multi-component insecticide.

[0050] The test conditions were: temperature 25°C, solvent water, three tests, and a stabilization time of 120 s. Meanwhile, 10 μL of the sample solution was taken and placed on a copper grid to dry. The morphology was then photographed and observed using a projection electron microscope.

[0051] The particle size of diflubenzuron in aqueous solution was 1353.99 nm, the particle size of diflubenzuron / SPc complex was reduced to 248.07 nm, and the particle size of diflubenzuron / SPc / ds CHS The particle size of the ternary insecticide was 349.01 nm (as shown in Table 2).

[0052] Table 2 Particle size of different components

[0053]

[0054] The above results are consistent with the results of transmission electron microscopy. Diflubenzuron is in the form of crystal blocks, while Diflubenzuron / SPc is in the form of regular spheres of uniform size (e.g. Figure 5 shown).

[0055] Example 6 Diflubenzuron / SPc / ds CHS Activity testing of multi-component insecticides

[0056] Evaluation of diflubenzuron / SPc / ds by back plate drop method CHS Multicomponent complex with diflubenzuron / SPc / ds eGFP (ds GFP The nucleotide sequence of is shown in SEQ ID NO.4) to aphids. Figure 6 As shown, diflubenzuron / SPc / ds CHS The expression level of CHS gene was significantly reduced. eGFP The mortality rate was 46.67%, diflubenzuron / SPc / ds CHS The mortality rate increased to 82.22%.

[0057] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A diflubenzuron / SPc / ds CHS Multi-component compound insecticide, characterized by: The compound insecticide comprises a diflubenzuron / SPc complex and ds CHS , the ds CHS The mass ratio of ds to SPc in the diflubenzuron / SPc complex is 0.1-5:1; the ds CHS The nucleotide sequence is shown in SEQ ID NO.1; The diflubenzuron / SPc complex is formed by incubating the nanocarrier SPc with diflubenzuron, with the mass ratio of the nanocarrier SPc to diflubenzuron being 0.5-3:1; SPc has a structure of both a hydrophobic core and a multifunctional hydrophilic shell; The diflubenzuron / SPc / ds CHS The preparation method of the multi-component compound insecticide comprises the following steps: Step 1 is to incubate the nanocarrier SPc with diflubenzuron to obtain a diflubenzuron / SPc complex; Step 2 is to combine the diflubenzuron / SPc complex with ds CHS Incubate to obtain the diflubenzuron / SPc / ds CHS Multi-component compound insecticide; The incubation step in step 1 is performed at a temperature of 20-35° C. for 1-30 minutes; The temperature of the incubation step in step 2 is 20-35° C. and the time is 1-30 minutes.

2. Diflubenzuron / SPc / ds according to claim 1 CHS The preparation method of the multi-component compound insecticide is characterized by: The steps include: Step 1 is to incubate the nanocarrier SPc with diflubenzuron to obtain a diflubenzuron / SPc complex; Step 2 is to combine the diflubenzuron / SPc complex with ds CHS Incubate to obtain the diflubenzuron / SPc / ds CHS Multi-component compound insecticide.

3. Diflubenzuron / SPc / ds according to claim 2 CHS The preparation method of the multi-component compound insecticide is characterized by: The temperature of the incubation step in step 1 is 20-35° C. and the time is 1-30 minutes.

4. Diflubenzuron / SPc / ds according to claim 2 CHS The preparation method of the multi-component compound insecticide is characterized by: The temperature of the incubation step in step 2 is 20-35° C. and the time is 1-30 minutes.

5. A chitin synthesis inhibitor, characterized in that: The inhibitor comprises 1-100% by mass of the diflubenzuron / SPc / ds according to claim 1 CHS Multi-component compound insecticide.

Images