Application of CUL2-TSPYL2-P21 signal axis in delaying cell senescence

Abstract

The invention discloses an application of a CUL2-TSPYL2-P21 signal axis in delaying cell senescence, and a preparation method of the CUL2-TSPYL2-P21 signal axis. The invention finds that the knock-down / knock-out of CUL2 accelerates the aging of hMSC, the activation / overexpression of CUL2 can delay the aging of hMSC, and the CUL2 directly degrades downstream cell proliferation and cycle related protein TSPYL2 through substrate receptor protein APPBP2 in a ubiquitination manner, and further reduces the level of P21, thereby delaying the aging of hMSC. The invention discloses a mechanism for regulating and controlling the aging of human mesenchymal stem cells by a CUL2-APPBP2-TSPYL2 signal axis, and prompts that CUL2 and TSPYL2 can be used as potential targets for delaying aging and improving aging-related diseases, and have important application value.

Description

Technical Field

[0001] The present invention relates to application of CUL2-TSPYL2-P21 signal axis in delaying cell senescence in the biomedical field. Background Art

[0002] Protein homeostasis imbalance is one of the main characteristics of aging in organisms, and it is also an important factor in maintaining stem cell function. However, the relationship between protein homeostasis imbalance and human stem cell aging is still unclear. The ubiquitin-proteasome system (UPS) is one of the main systems for protein degradation in organisms, among which Cullin-RING E3 ubiquitin ligases (CRLs) are the largest family of multi-subunit E3 ubiquitin ligases in eukaryotic cells. However, the role of Cullin family members in human stem cell aging and homeostasis maintenance remains unclear. Therefore, exploring the most important members of the Cullin family for human mesenchymal stem cell (hMSC) aging and revealing its mechanism for regulating human stem cell aging and homeostasis maintenance will provide potential new targets for intervening in cell and organism aging, which has important theoretical significance and potential application value.

[0003] Cullin 2 (CUL2) is an important member of the Cullin family and a core scaffolding component of the CUL2-RING ubiquitin ligase. It participates in regulating a variety of biological processes, including cell cycle, signal transduction, transcription, and cell growth, through targeted substrate ubiquitination. However, the function of CUL2 in human mesenchymal stem cells and its impact on stem cell homeostasis and aging remain unknown. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to delay cell senescence.

[0005] In order to solve the above technical problems, the present invention first provides the use of proteins in the CUL2-TSPYL2-P21 signal axis or substances that regulate the content or activity of proteins in the signal axis in the preparation of products having the following functions:

[0006] X1) Treating and / or preventing and / or delaying aging;

[0007] X2) treating and / or preventing diseases associated with aging;

[0008] X3) Improve cell cycle;

[0009] The proteins in the CUL2-TSPYL2-P21 signaling axis are CUL2, TSPYL2 and / or P21.

[0010] In the above application, the substance that regulates the protein content or activity in the signal axis may be a substance that increases the content or activity of CUL2, a substance that decreases the content or activity of TSPYL2, and / or a substance that decreases the content or activity of P21.

[0011] In the above application, the substance that increases the content or activity of CUL2 can be a substance that promotes the expression of CUL2 gene or a biological material related to CUL2; the biological material is any one of the following B1) to B4):

[0012] B1) a nucleic acid molecule encoding CUL2;

[0013] B2) an expression cassette containing the nucleic acid molecule described in B1);

[0014] B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0015] B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);

[0016] The substance that reduces the content or activity of TSPYL2 is a substance that knocks out the TSPYL2 gene;

[0017] The substance that reduces the content or activity of P21 is a substance that knocks out the P21 gene.

[0018] In the above applications, the vector may be a plasmid, a cosmid, a phage or a viral vector.

[0019] In the above application, the substance that promotes CUL2 gene expression may be a CRISPR / dCas9 transcription activation system that targets the transcription start site of the CUL2 gene.

[0020] The recombinant vector B3) can be any expression vector as long as it can express the CUL2 gene. In one embodiment of the present invention, the recombinant vector B3) is a recombinant vector obtained by inserting the CUL2 coding gene into the vector pLE4, which can express the CUL2 protein.

[0021] In the above application, the senescence may be cellular senescence;

[0022] Furthermore, the cell senescence may be mesenchymal stem cell senescence.

[0023] In the above applications, the aging can be manifested in decreased cell proliferation ability, increased DNA damage and / or increased ROS levels.

[0024] The present invention also provides a method for preparing a cell aging model, the method comprising: reducing the content or activity of CUL2 in cells, knocking out the CUL2 gene in cells, and / or increasing the content or activity of TSPYL2 in cells to obtain a cell aging model.

[0025] In the above method, the cells may be mesenchymal stem cells.

[0026] The present invention also provides a product, the active ingredients of which are the substance that increases the content or activity of CUL2, the substance that reduces the content or activity of TSPYL2, and / or the substance that reduces the content or activity of P21.

[0027] Experiments have shown that CUL2 is the Cullin family protein that is most susceptible to hMSC aging. Knockdown / knockout of CUL2 accelerates hMSC aging, while activation / overexpression of CUL2 can delay hMSC aging. The inventors also found that CUL2 directly ubiquitinates and degrades the downstream cell proliferation and cycle-related protein TSPYL2 through the substrate receptor protein APPBP2, further downregulating the level of P21, thereby delaying hMSC aging. This study reveals the mechanism by which the CUL2-APPBP2-TSPYL2 signaling axis regulates the aging of human mesenchymal stem cells, suggesting that CUL2 and TSPYL2 may serve as potential targets for delaying aging and improving aging-related diseases. This study has important application value.

[0028] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 .CUL2 is the most critical Cullin member in hMSC aging. A is a flow chart of the screening strategy for the effects of Cullin family members on hMSC aging. B is a heat map of the proportion of SA-β-Gal positive cells after WT, WS and HGPS hMSCs were infected with Cullin-KO lentivirus. The colors from green to pink represent log 2From low to high, *, P < 0.05. C is a Venn diagram showing the common differences of sgRNAs in Cullin family members during the aging process of RS hMSCs, HGPS hMSCs, and WS hMSCs. D is a Western blotting analysis of CUL2 in RS hMSCs (P6) after transfection with CUL2-targeting sgRNA or negative control sgRNA (sgNC) (P2). E is a SA-β-Gal staining analysis performed on P2 after infection of RS hMSCs (P6) with CUL2-targeting sgRNAs or sgNC. The left figure is a representative picture, and the right is a statistical graph of the proportion of SA-β-Gal-positive cells quantified as fold change (sgCUL2vs.sgNC). The statistical graph shows the mean ± SEM, N = 3, three independent replicates, and the scale bar is 100 μm. F is the analysis of the clonal expansion ability of P2 after RS ​​hMSCs (P6) were transfected with CUL2-targeting sgRNAs or sgNC. The left figure is a representative picture, and the right figure is a statistical graph of the clonal expansion ability quantified as fold change (sgCUL2 vs. sgNC). The statistical graph shows the mean ± SEM, and N = 3 represents three independent replicates. G is a Western blotting analysis of sh-CUL2 or sh-GL2 transfected in RS hMSCs (P6). H is a SA-β-Gal staining analysis of sh-CUL2 or sh-GL2 transfected in RS hMSCs (P6). The left figure is a representative picture, and the right figure is a statistical graph of the SA-β-Gal positive cell ratio quantified as fold change (shCUL2 vs. shGL2). The statistical graph shows the mean ± SEM, N = 3, three independent replicates, and the scale bar is 100 μm. I is the analysis of clonal expansion experiment of RS hMSCs (P6) transfected with sh-CUL2 or sh-GL2. The left figure is a representative picture, and the right figure is the quantification of clonal expansion ability as fold change (shCUL2 vs. shGL2). The statistical graph shows the mean ± SEM, and N = 3 represents three independent replicates.

[0030] Figure 2 .Establishment of CUL2 knockout hESC. A is a schematic diagram of CUL2 knockout using CRISPR / cas9-mediated non-homologous end joining (NHEJ). Sanger sequencing results showed that 1 bp was inserted into the exon 3 region. B is CUL2 + / + hESCs or CUL2 - / - Western blotting analysis of CUL2 protein levels in hESCs. N = 3 represents three independent replicates. C represents CUL2 + / + hESCs and CUL2- / - Immunofluorescence analysis of pluripotency markers SOX2, OCT4, and NANOG in hESCs. D is the immunofluorescence analysis of CUL2 + / + hESCs and CUL2 - / - Expression changes of TuJ1 (ectoderm), SMA (mesoderm) and FOXA2 (endoderm) in teratomas of hESCs. Scale bar, 25 μm. E is CUL2 + / + hESCs and CUL2 - / - Karyotype analysis of hESCs. F is CUL2 + / + hESCs and CUL2 - / - Whole genome sequencing of hESCs to analyze copy number variation. G is CUL2 + / + hESCs and CUL2 - / - Immunofluorescence analysis of Ki67 in hESCs. Representative images are shown on the left. The proportion of Ki67-positive cells was quantified as fold change (CUL2 - / - hESCs vs. CUL2 + / + hESCs) and are presented as mean ± SEM. N = 3 represents three independent replicates. Scale bar, 50 μm.

[0031] Figure 3 .CUL2 deficiency accelerates hMSC senescence. A is from CUL2 + / + hESC or CUL2 - / - Schematic diagram of hESC differentiation into hMSC. B is CUL2 + / + and CUL2 - / - Western blotting analysis of CUL2 protein levels in hMSCs (P4). N = 3, three independent replicates. C is CUL2 + / + and CUL2 - / - Growth curve analysis of hMSCs. D is CUL2 + / + and CUL2 - / - Immunofluorescence analysis of Ki67 in hMSCs (P6). Representative images are shown on the left. The proportion of Ki67-positive cells was quantified as fold change (CUL2 - / - vs. CUL2 + / + ), and are presented as mean ± SEM. N = 3 represents three independent replicates. Scale bar, 50 μm. E is CUL2 + / + and CUL2 - / - Cell cycle analysis of hMSCs (P6). F is CUL2 + / + and CUL2 - / - hMSCs (P6) clonal expansion experiment. The left picture is a representative image, and the right picture is the clonal expansion capacity quantified as fold change (CUL2 + / + vs. CUL2- / - ), and are expressed as mean ± SEM. N = 3 represents three independent replicates. G is CUL2 + / + and CUL2 - / - SA-β-Gal staining analysis of hMSCs (P6). The left picture is a representative image. The right picture is the fold change of the proportion of SA-β-Gal positive cells (CUL2 - / - vs. CUL2 + / + ) and are presented as mean ± SEM. N = 3, three independent replicates. Scale bar, 100 μm; H is RT-qPCR detection of CUL2 + / + and CUL2 - / - Changes in the mRNA levels of IL6, CXCL8, CDKN2A, CDKN1A, LMNB1 and TMPO in hMSCs (P9). I is CUL2 + / + and CUL2 - / - Western blotting analysis of LAP2β, Lamin B1, HP1α and P21 in hMSCs (P9). JM is CUL2 + / + and CUL2 - / - Immunofluorescence staining analysis of Lamin B1 (H), H3K9me3 (I), LAP2β (J), and HP1α (M) in hMSCs (P6). The left figure is a representative image. Fluorescence intensity is quantified as fold change (CUL2 - / - vs. CUL2 + / + ) for statistics. Scale bar, 50μm. N is CUL2 + / + and CUL2 - / - Immunofluorescence staining analysis of γ-H2AX in hMSCs (P6). The left figure is a representative image. The proportion of γ-H2AX positive cells was quantified as fold change (CUL2 - / - vs. CUL2 + / + ), the right side is represented as mean ± SEM. N = 3 represents three independent replicates. Scale bar, 50 μm. O is CUL2 stained with H2DCFDA by flow cytometry analysis + / + and CUL2 - / - Changes in cellular ROS levels in hMSCs. Quantitative data on the right are shown as mean ± sEM, N = 3 biological replicates. P represents the results of implanting CUL2 expressing luciferase (Luc) in the tibialis anterior muscle of nude mice. + / + or CUL2 - / - Activity analysis of hMSCs (P5). The figure shows the statistical data of Luc activity detected on days 0, 1, 2, 3, and 4 after implantation. Q is the number of cells infected with CUL2 using lentivirus expressing Luc or CUL2. - / -Western blotting analysis of CUL2 in hMSCs (P6). R is CUL2 mediated by lentivirus expressing Luc or CUL2 - / - Immunofluorescence analysis of Ki67 in hMSCs (P6). Representative images are shown on the left. The proportion of Ki67-positive cells was quantified as fold change (CUL2 - / - Luc vs CUL2 + / + -Luc, CUL2 - / - -CUL2 vs CUL2 + / + -Luc) and are presented as mean ± SEM. N = 3 represents three independent replicates. Scale bar, 50 μm. S represents CUL2 cells infected with lentivirus expressing Luc or CUL2 - / - SA-β-Gal staining analysis of hMPCs (P6). Representative images are shown on the left. The proportion of SA-β-Gal positive cells was quantified as fold change (CUL2 - / - Luc vs CUL2 + / + -Luc, CUL2 - / - -CUL2 vs CUL2 + / + -Luc) and are presented as mean ± SEM. N = 3, three independent replicates. Scale bar, 100 μm. CUL2 + / + -LUC means CUL2 + / + hMSCs are cells to be transfected using control virus transfection, CUL2 - / - -LUC indicates control cells, CUL2 + / + -CUL2 indicates cells overexpressing CUL2.

[0032] Figure 4 .The effect of CUL2 deficiency on hMSC homeostasis. A is flow cytometry analysis to detect CUL2 + / + P2) and CUL2 - / - (P2) hMSC markers (CD73, CD90 and CD105) in hMSCs. B is toluidine blue staining to characterize CUL2 + / + hMSCs(P4) and CUL2 - / - Chondrogenic capacity of hMSCs (P4). Representative images are shown on the left. The cross-sectional area of ​​chondrocyte spheres was quantified as fold change (CUL2 + / + vs. CUL2 - / - ), the right side is represented as mean ± SEM. N = 3 represents three independent replicates. Scale bar, 100 μm. C is Von Kossa staining to characterize CUL2 + / + hMSCs(P4) and CUL2 - / -Osteogenic capacity of hMSCs (P4). Representative images are shown on the left. Von kossa-positive areas were quantified as fold change (CUL2 + / + vs. CUL2 - / - ), and are presented as mean ± SEM. N = 3 represents three independent replicates. D is Oil Red O staining to characterize CUL2 + / + hMSCs(P4) and CUL2 - / - Adipogenic capacity of hMSCs (P4). Representative images are shown on the left. The absorbance of Oil Red O was quantified as fold change (CUL2 + / + vs. CUL2 - / - ), and are expressed as mean ± SEM. N = 3 represents three independent replicates. Scale bar, 250 μm. E is the whole genome sequencing of CUL2 + / + and CUL2 - / - Analysis of copy number variation in the whole genome of hMSCs (P4). F is CUL2 + / + hMSCs and CUL2 - / - Heat map of RNA-seq reproducibility analysis in hMSCs (P4). G is CUL2 + / + hMSCs and CUL2 - / - Heat map of differentially expressed genes between hMSCs (P4). The color key from green to pink indicates the score of differential gene expression from low to high. H is CUL2 + / + and CUL2 - / - Box plots of differentially expressed genes in hMSCs (P4). Boxes show median (center line) and interquartile range. I is CUL2 + / + and CUL2 - / - Cluster enrichment pathway analysis between hMSCs (P4), the color keys from gray to pink or green represent low to high enrichment levels. J is the lentiviral transduction of CUL2 expressing Luc or CUL2 - / - Analysis of clonal expansion capacity of hMPCs (P6). Representative images are shown on the left. Clonal expansion capacity is quantified as fold change (CUL2 - / - -Luc vs CUL2 + / + -Luc, CUL2 - / - -CUL2 vs CUL2 + / + -Luc) and are presented as mean ± SEM. N = 3 represents three independent replicates. CUL2 + / + -LUC means CUL2 + / + hMSCs are cells to be transfected using control virus transfection, CUL2 - / - -LUC indicates control cells, CUL2 + / + -CUL2 indicates cells overexpressing CUL2.

[0033] Figure 5.Ectopic expression of CUL2 delays hMSC senescence. A is Western blotting analysis of CUL2 in replicatively aged RS hMSCs. EP is early P4 cells, and LP is late P12 cells. B is Western blotting analysis of CUL2 in RS hMSCs (P10) infected with CRISPR-activating sgRNA (SAM-CUL2) or negative control (SAM-NC). C is SA-β-Gal staining analysis of RS hMSCs (P10) infected with CRISPR-activating sgRNA (SAM-CUL2) or negative control (SAM-NC). The left figure is a representative image. The proportion of SA-β-Gal-positive cells was quantified as fold change (SAM-CUL2 vs. SAM-NC) and expressed as mean ± SEM. N = 3 represents three independent replicates. Scale bar, 100 μm. D is clonal expansion analysis of RS hMSCs (P10) infected with CRISPR activating sgRNA (SAM-CUL2) or negative control (SAM-NC). The left panel is a representative image. The clonal expansion capacity was quantified as fold change (SAM-CUL2 vs. SAM-NC) and expressed as mean ± SEM. N = 3 represents three independent replicates. E is Western blotting analysis of CUL2 in HGPS hMSCs (P6) infected with CRISPR activating sgRNA (SAM-CUL2) or negative control (SAM-NC). F is SA-β-Gal staining analysis of HGPS hMSCs (P6) infected with CRISPR activating sgRNA (SAM-CUL2) or negative control (SAM-NC). The left panel is a representative image. The proportion of SA-β-Gal-positive cells was quantified as fold change (SAM-CUL2 vs. SAM-NC) and expressed as mean ± SEM. N = 3 represents three independent replicates. Scale bar, 100 μm. G is clonal expansion analysis of HGPS hMSCs (P6) infected with CRISPR-activating sgRNA (SAM-CUL2) or negative control (SAM-NC). Representative images are shown on the left. Clonal expansion capacity was quantified as fold change (SAM-CUL2 vs. SAM-NC) and expressed as mean ± SEM. N = 3 represents three independent replicates. H is Western blotting analysis of RS hMSCs after FLAG-CUL2 overexpression lentivirus transfection. I is SA-β-Gal staining analysis of RS hMSCs after FLAG-CUL2 overexpression lentivirus transfection. J is Ki67-positive cell analysis of RS hMSCs after FLAG-CUL2 overexpression lentivirus transfection. K is clonal expansion analysis of RS hMSCs after FLAG-CUL2 overexpression lentivirus transfection.L is Western blotting analysis of HGPS hMSCs transfected with FLAG-CUL2 overexpressing lentivirus. M is SA-β-Gal staining analysis of HGPS hMSCs transfected with FLAG-CUL2 overexpressing lentivirus. N is clonal expansion analysis of HGPS hMSCs transfected with FLAG-CUL2 overexpressing lentivirus. O is H3K9me3 abundance analysis of RS hMSCs transfected with FLAG-CUL2 overexpressing lentivirus. HO indicates Luc control virus, and CUL2 indicates FLAG-CUL2 overexpressing lentivirus.

[0034] Figure 6 .CUL2 regulates TSPYL2 protein stability through the ubiquitin-proteasome pathway. A shows CUL2 + / + and CUL2 - / - Volcano plot distribution of differentially expressed proteins (DEPs) in hMSCs (P4). B shows CUL2 + / + and CUL2 - / - Dot plots of gene clustering and pathway analysis of upregulated (pink) and downregulated (green) DEPs enrichment between hMSCs (P4). The color key from gray to pink or green indicates low to high enrichment levels. The size of the dot indicates the number of enriched genes. C is a dot plot showing genes upregulated by DEPs but with no significant changes in transcriptome levels. The size of the dot from low to high indicates -log 10 Size (adjusted p value). D is a network diagram showing the correlation between DEPs and positive or negative regulation of the cell cycle. The color key from green to pink represents log 2 (fold change) from low to high. Node size represents absolute log 2(Fold change). E: HEK293T cells transfected with FLAG-TSPYL2 / HA-CUL2 were collected and immunoprecipitated with FLAG antibody. F: HEK293T cells and WT hMSCs (P6) were collected for immunoprecipitation. Anti-TSPYL2 antibody was used for immunoprecipitation, and anti-CUL2 antibody was used for immunoblotting. G: Western blotting analysis of TSPYL2 protein in WT hMSCs (P6) after treatment with MG132 (0 μM). MG132 (25 μM); bafilomycin A1 (0 μM, 12h), bafilomycin A1 (0.25 μM, 12h) or bafilomycin A1 (0.5 μM, 12h). H: Western blotting analysis of TSPYL2 in WT hMSCs (P6) after treatment with different doses of MLN4924 for 24 hours. I is Western blotting analysis of the changes in TSPYL2 and CUL2 protein expression in WT hMSCs (P6) infected with lentivirus expressing Luc or CUL2. J is RT-qPCR analysis of the changes in TSPYL2 mRNA levels in WT hMSCs (P6) infected with lentivirus expressing Luc or CUL2. K is CUL2 + / + and CUL2 - / - Western blotting analysis of TSPYL2 protein in hMSCs (P6). L is RT-qPCR analysis of CUL2 + / + and CUL2 - / - Changes in TSPYL2 mRNA levels in hMSCs (P6). M is CUL2 + / + hMSCs and CUL2 - / - hMSCs (P4) were incubated with 40 μg / ml cycloheximide (CHX) for the indicated time and analyzed by Western blotting with anti-TSPYL2 and GAPDH. The left figure shows representative images, and the right shows decay curves for quantitative analysis using Image J. N is the number of CUL2 cells treated with MG132 (25 μM, 5 h). + / + hMSCs and CUL2 - / - hMSCs (P6) were collected and immunoprecipitated with anti-TSPYL2 antibody to enrich TSPYL2 protein. The ubiquitination of TSPYL2 was then detected by immunoblotting with anti-polyubiquitin antibody.

[0035] Figure 7.TSPYL2 promotes hMSC senescence. A is Western blotting analysis of TSPYL2 levels in RS hMSCs. P4, early stage (EP), P12, late stage (LP). B is Western blotting analysis of TSPYL2 protein levels in RS hMSCs (P6) infected with lentivirus expressing Luc or TSPYL2. C is clonal expansion analysis of RS hMSCs (P6) infected with lentivirus overexpressing Luc or TSPYL2. The left figure is a representative picture. The clonal expansion capacity was quantified as fold change (TSPYL2 vs. Luc) and expressed as mean ± SEM. N = 3 represents three independent replicates. D is Ki67 immunofluorescence analysis of RS hMSCs (P6) transduced with lentivirus overexpressing Luc or TSPYL2. The left figure is a representative picture. The proportion of Ki67-positive cells was quantified as fold change (TSPYL2 vs. Luc) and expressed as mean ± SEM. N = 3 represents three independent replicates. Scale bar, 50 μm. E is SA-β-gal staining of RS hMSCs (P6) infected with lentivirus overexpressing Luc or TSPYL2. The left panel is a representative image. The proportion of SA-β-Gal-positive cells was quantified as fold change (TSPYL2 vs. Luc) and shown as mean ± SEM. N = 3 represents three independent replicates. Scale bar, 100 μm. F is Western blotting analysis of TSPYL2 protein levels in RS hMSCs (P6) infected with lentivirus expressing sg-NC or sg-TSPYL2. G is clonal expansion assay analysis of RS hMSCs (P6) infected with lentivirus expressing sg-NC or sg-TSPYL2. The left panel is a representative image. The clonal expansion capacity was quantified as fold change (sgTSPYL2 vs. sgNC) and shown as mean ± SEM. N = 3 represents three independent replicates. H is a Ki67 immunofluorescence analysis of RS hMSCs (P6) transduced with lentivirus expressing sg-NC or sg-TSPYL2. The left panel is a representative image. The proportion of Ki67-positive cells was quantified as fold change (sgTSPYL2 vs. sgNC) and presented as mean ± SEM on the right. N = 3, three independent replicates. Scale bar, 50 μm. I is SA-β-Gal staining of RS hMSCs (P6) transduced with lentivirus expressing sg-NC or sg-TSPYL2. The left panel is a representative image. The proportion of SA-β-Gal-positive cells was quantified as fold change (sgTSPYL2 vs. sgNC) and presented as mean ± SEM on the right. N = 3, three independent replicates. Scale bar, 100 μm. J is CUL2 infected with lentivirus expressing sg-NC or sg-TSPYL2. + / + 、CUL2 - / -Western blotting analysis of TSPYL2 protein levels in hMSCs (P6). K: CUL2 cells infected with lentivirus expressing sg-NC or sg-TSPYL2 + / + or CUL2 - / - Clonal expansion analysis of hMSCs (P6). Representative images are shown on the left. Clonal expansion capacity was quantified as fold change (CUL2 - / - -sgNC vs CUL2 + / + -sgNC,CUL2 - / - -sgTSPYL2vsCUL2 + / + -sgNC) and are presented as mean ± SEM. N = 3 represents three independent replicates. L represents CUL2 cells infected with lentivirus expressing sg-NC or sg-TSPYL2 + / + or CUL2 - / - SA-β-Gal staining analysis of hMSCs (P6). Representative images are shown on the left. The proportion of SA-β-Gal positive cells was quantified as fold change (CUL2 - / - -sgNC vs CUL2 + / + -sgNC,CUL2 - / - -sgTSPYL2vsCUL2 + / + -sgNC) and are presented as mean ± SEM. N = 3 represents three independent replicates. Scale bar, 100 μm. M represents CUL2 cells infected with lentivirus expressing sg-NC or sg-TSPYL2 + / + or CUL2 - / - Immunofluorescence staining analysis of Ki67 in hMSCs (P6). Representative images are shown on the left. The proportion of Ki67-positive cells was quantified as fold change (CUL2 - / - -sgNC vs CUL2 + / + -sgNC,CUL2 - / - -sgTSPYL2vsCUL2 + / + -sgNC) and expressed as mean ± SEM. N = 3 represents three independent replicates. Scale bar, 50 μm. N is Western blotting analysis of the changes in P21 protein levels in RS hMSCs (P6) transduced with lentivirus expressing Luc or TSPYL2. O is Western blotting analysis of the changes in P21 protein levels in RShMSCs (P6) infected with lentivirus expressing sg-NC or sg-TSPYL2. P is the analysis of clonal expansion experiments of RS hMSCs transduced with lentivirus expressing Luc-sgNC, TSPYL2-sgNC or TSPYL2-sgP21. The left figure is a representative picture. The clonal expansion capacity is quantified as the fold change (CUL2 - / --sgNC vs CUL2 + / + -sgNC,CUL2 - / - -sgTSPYL2 vs CUL2 + / + -sgNC) and are presented as mean ± SEM. N = 3, three independent replicates. Q is SA-β-Gal staining of RS hMSCs (P4) transduced with lentivirus expressing Luc-sgNC, TSPYL2-sgNC, or TSPYL2-sgP21. The left figure is a representative image. The proportion of SA-β-gal-positive cells was quantified as fold change (TSPYL2-sgNC vs. Luc-sgNC, TSPYL2-sgP21 vs. Luc-sgNC) and are presented as mean ± SEM. N = 3, three independent replicates. Scale bar, 100 μm. R is a model diagram of CUL2-mediated TSPYL2 ubiquitination regulating hMSC senescence.

[0036] Figure 8 .CUL2 gene deletion increases TSPYL2 protein expression. A is CUL2 + / + hMSCs and CUL2 - / - Bar graph of peptide length distribution (P4) of proteins identified in hMSCs proteomics. B is CUL2 + / + hMSCs and CUL2 - / - Bar graph showing the distribution of peptide numbers of proteins identified in the proteomics of hMSCs (P4). C is CUL2 + / + and CUL2 - / - Dot plot of principal component analysis of hMSCs (P4) proteomics data. D The left box plot shows CUL2 + / + and CUL2 - / - Protein abundance of TSPYL2 in hMSCs (P4); CUL2 on the right + / + and CUL2 - / - The expression level of TSPYL2 in hMSCs (P4). E is the Western blotting analysis of the protein level changes of Luc-sgNC, TSPYL2-sgNC or TSPYL2-sgP21 in RS hMSCs (P4) infected with lentivirus. DETAILED DESCRIPTION

[0037] The experimental methods in the following examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples are all commercially available unless otherwise specified. The quantitative tests in the following examples are all repeated at least three times, and the results are averaged.

[0038] All animal experiments were approved by the Animal Care and Use Committee of Xuanwu Hospital, Capital Medical University. Mice were from SiPeiFu (Beijing) Biotechnology Co., Ltd. and maintained at 25°C with a 12-h light-dark cycle using standard laboratory chow. Anesthesia or euthanasia was performed using isoflurane or cervical dislocation.

[0039] (1) Clonal expansion experiment:

[0040] Using TrypLE TM The expression enzyme separates the cells into single cells. 2000 cells were then inoculated in each well of a 12-well plate. After a culture period of approximately 12 days, the cells were washed twice with PBS, fixed in a 4% paraformaldehyde (PFA) solution for 30 minutes, and then stained with a crystal violet solution (Biohao, C0520). After rinsing with water, images were captured using an Epson perfect V370 photo scanner. Relative colony density was quantitatively analyzed using ImageJ software.

[0041] (2) Senescence-associated β-galactosidase (SA-β-Gal) staining:

[0042] The cells were washed twice with PBS. The cells were placed in fixation buffer (2% formaldehyde, 0.2% glutaraldehyde in PBS) for 5 min. Next, the cells were in SA-β-Gal staining buffer (5 mM K 4 [Fe(CN) 6 ], 5 mM K 3 [Fe(CN) 6 ], 150 mM NaCl, 40 mM citrate / Na phosphate buffer, 2 mM MgCl 2 The cells were stained overnight at 37° C. with 1 mg / ml X-Gal. The stained cells were then imaged using a digital microscope camera (Olympus).

[0043] (3) Copy number variation (CNV) analysis:

[0044] DNeasy Blood & Tissue Kit (QIAGEN) was used for genomic DNA extraction, DNA quality control, library construction and sequencing. The initial step was to trim the raw reads using Trim Galore (version 0.4.5) and then align the human hg19 genome using Bowtie2 (version 2.2.9). Subsequently, the read counts for each 500-kb bin were obtained using the "readCounter" function in the hmmcopy_utils tool (https: / / github.com / shahcompbio / hmmcopy). In order to correct for GC content, copy number and mappability effects, the present invention used the R / Bioconductor package HMMcopy (version 1.26.0).

[0045] (4) Western blotting

[0046] hESCs or hMSCs were lysed for 30 min using RIPA lysis buffer plus protease and phosphatase inhibitors (Roche, 11836170001). Protein extracts were quantified using a BCA protein assay kit (Dingguo Changsheng Biotech, BCA-02) and separated by SDS-PAGE. The antibodies used for Western blot analysis were: anti-CUL2 (SantaCruz, sc-166506, 1:2000 dilution), anti-TSPYL2 (Proteintech, 12087-2-AP, 1:2000), anti-LAP2β (BD, 611000, 1:1000), anti-HP1α (Cell Signaling Technology, 2616s, 1:2000), anti-LAMIN B1 (Abcam, ab16048, 1:1000), anti-p21waf / cip1 (Cell Signaling Technology, 2947s, 1:1000), anti-β-Tubulin (Immunoway, YM-3030, 1:3000), anti-GAPDH (Santa Cruz, sc-166506, 1:2000), anti-TSPYL2 (Proteintech, 12087-2-AP, 1:2000), anti-LAP2β (BD, 611000, 1:1000), anti-HP1α (Cell Signaling Technology, 2616s, 1:2000), anti-LAMIN B1 (Abcam, ab16048, 1:1000), anti-p21waf / cip1 (Cell Signaling Technology, 2947s, 1:1000), anti-β-Tubulin (Immunoway, YM-3030, 1:3000), anti-GAPDH (Santa Cruz, sc-365062, 1:4000 dilution), goat anti-mouse IgG (ZSGB-bio, zb-2305, 1:5000 dilution), goat anti-rabbit IgG (ZSGB-bio, ZB-2305, 1:5000 dilution), goat anti-rabbit IgG (ZSGB-bio, ZB-2307, 1:5000 dilution).

[0047] (5) Immunofluorescence staining

[0048] The cells were passaged on coverlips (Thermo) and immunofluorescence staining was performed when the cells grew to 80%. After washing with PBS, the cells were fixed with 4% paraformaldehyde (PFA) and then permeabilized with 0.4% Triton X-10 for 15 minutes. Incubated with 10% donkey serum (Jackson ImmunoResearch) at room temperature for 1 hour. Then incubated with primary antibodies and incubated overnight at 4°C. After washing with PBS, incubated with specific secondary antibodies, washed with PBS, and then sealed with sealing media, and confocal images were collected using the Zeiss-LSM 900 imaging system.

[0049] The antibodies used for immunofluorescence staining were as follows: anti-OCT4 (Santa Cruz, sc-5279, 1:20 00), anti-SOX2 (Santa Cruz, sc-17320, 1:200), anti-NANOG (Abcam, ab21624, 1:50), anti-Ki67 (ZSGB-BIO, ZM-0166, 1:1000), anti-H3K9me3 (Abcam, ab8898, 1:1000), anti-LAP2β (BD Bioscience, 611000, 1:500), anti-TUJ1 (Sigma, T2200, 1:5000), anti-SMA (Sigma, A5228, 1:5000), anti-FOXA2 (Cell Signaling Technology, 8186S, 1:500), anti-LAMIN (Cell Signaling Technology, 8186S, 1:500). B1 (Abcam, ab16048, 1:500), anti-HPp1α (Cell Signaling Technology, 2616S, 1:500), anti-γ-H2AX (Millipore, 05-636, 1:1000), Alexa 488 donkey anti-mouse IgG (Invitrogen, A21202, 1:500) and Alexa 568 donkey anti-rabbit IgG (Invitrogen, A10042, 1:500). Nuclear DNA staining was performed using Hoechst 33342 (Thermo).

[0050] (6) Quantitative reverse transcription PCR (RT-qPCR)

[0051] RNA was isolated from hMSCs using Trizol (Invitrogen, 15596018). Reverse transcription of cDNA was performed using HiScript IIQSelect RT SuperMix for qPCR (+ gDNA wiper) (Vazyme, R233-01). The cDNA was analyzed using a Bio-Rad CFX Opus 384 real-time fluorescence quantitative PCR system. Real-time fluorescence quantitative PCR was performed using SYBR qPCR SuperMixPlus (novoprotein, E096). The primers used for RT-qPCR detection are as follows:

[0052] IL6 forward primer: ACTCCTTCTCCACAAGCGCC;

[0053] IL6 reverse primer: TGGAATCTTCTCCTGGGGGTA;

[0054] CXCL8 forward primer: TACTCCAAACCTTTCCACCCC;

[0055] CXCL8 reverse primer: CCCAGTTTTCCTTGGGGTCC;

[0056] CDKN1A forward primer: CTGTCTTGTACCCTTGTGCCTC;

[0057] CDKN1A reverse primer: TGGAGTGGTAGAAATCTGTCATGCT;

[0058] CDKN2A forward primer: GGGTCGGGTAGAGGAGGTG;

[0059] CDKN2A reverse primer: GCTGCCCATCATCATGACCT;

[0060] LMNB1 forward primer: GTATGAAGAGGAGATTAACGAGAC;

[0061] LMNB1 reverse primer: TACTCAATTTGACGCCCAG;

[0062] TMPO forward primer: TGAAGAGTGAGTTGGTCGCC;

[0063] TMPO reverse primer: GTGAGGTGCTGCAGGTAGAG;

[0064] TSPYL2 forward primer: AAGAGGGCATTGAGGAAGGC;

[0065] TSPYL2 reverse primer: TTGGGACCTGAAGCACATCC;

[0066] GAPDH forward primer: GGCAAATTCCATGGCACCG;

[0067] GAPDH reverse primer: AGCATCGCCCCACTTGATTT.

[0068] (7) Cell culture

[0069] In order to establish a cell model to study the function of CUL2 gene, CUL2 was constructed by deleting CUL2 gene in H9 hESCs (WiCell Research Institute). - / - hESCs. + / + and CUL2 - / - hESCs were cultured on mitomycin c treated mouse embryonic fibroblast (MEF) feeder layers using hESC medium. hESC medium consisted of DMEM / F-12 (Thermo) supplemented with 20% knockout serum replacement (Thermo), 2mM glutamine (Thermo), 0.1mM non-essential amino acids (NEAA, Thermo), 1% penicillin-streptomycin (PS, Thermo), 55μM β-mercaptoethanol, and 10ng / ml (Joint Protein Central) bFGF. In certain cases, hESCs can be cultured on matrigel plates using mTeSR medium. Human mesenchymal stem cells (hMSCs) were cultured in hMSC medium consisting of MEMα basal medium (Thermo) supplemented with 10% fetal bovine serum (FBS), 1% PS, 1% NEAA, and 1ng / ml bFGF. HEK293T cells were cultured in DMEM supplemented with 10% fetal bovine serum and 1% PS.

[0070] (8)CUL2 + / + and CUL2 - / - Directed differentiation and characterization of hMSCs

[0071] CUL2 + / + or CUL2 - / - hMSCs are expressed by CUL2 + / + or CUL2 - / - hESCs were differentiated. First, hESCs were induced to form embryoid bodies (EBs) and then cultured in hMSC differentiation medium. The hMSC differentiation medium is MEMα basal medium with 10% FBS, 0.1mM NEAA, 5ng / ml TGFβ (Humanzyme), 1ng / ml bFGF and 1% penicillin-streptomycin. After about 10 days, the cells were transferred to hMSC medium for storage. hMSCs were screened using flow cytometry (FACS) technology using positive markers such as CD73, CD90 and CD105. In contrast, negative markers including CD14, CD19 and CD34 were used to evaluate hMSCs by FACS analysis (BD FACS Calibur).

[0072] The following antibodies were used for fluorescence activated cell sorting (FACS) assays at their respective dilutions: Antibodies used for specific marker detection were as follows: anti-CD73-PE (BD Bioscience, 550257, 1:20 00 dilution), anti-CD90-FITC (BD Bioscience, 555595, 1:30 00 dilution), anti-CD105-APC (BD Bioscience, 17-1057-42, 1:20 00 dilution), anti-CD14-PE (BD Bioscience, 555398, 1:20 00 dilution), anti-CD19-APC (BD Bioscience, 555415, 1:20 00 dilution), anti-CD34-FITC (BD Bioscience, 555415, 1:20 00 dilution). CUL2 was evaluated by specific staining techniques + / + or CUL2 - / - The differentiation potential of hMSCs into adipocytes, osteoblasts, and chondrocytes. Oil red O staining was used to detect adipocyte differentiation, Von Kossa staining was used to detect osteoblast differentiation, and toluidine blue staining was used to detect chondrocyte differentiation.

[0073] (9) Cell cycle analysis

[0074] Cells were digested with TrypLE enzymes and washed with PBS, then fixed overnight in precooled 70% ethanol. The next day, at 4°C with 2,500rpm centrifugation, supernatant was discarded from each tube, the cell pellet was resuspended and incubated at 37°C for 30 minutes with PBS solution containing RNase A (0.2mg / mL, TIANGEN, for RNA degradation), propidium iodide (0.02mg / mL, PI, Invitrogen) and Triton X-100 (0.1%). Cell cycle was measured using a flow cytometer (BD FACSCalibur).

[0075] (10) RNA-seq data processing

[0076] To process RNA-seq raw data, low-quality data were first removed using Trim Galore (version 0.4.5) and sequence reads were obtained. The processed data were then aligned to the human HG19 reference genome using STAR (version 2.7.1a) software with strand-specific parameters. Gene expression levels were determined by calculating the number of reads assigned to each gene using featurecots (version 2.0.1). To identify differentially expressed genes (DEGs), we used absolute log 2The criteria of (fold change) greater than 0.5 and Benjamin-Hochberg adjusted p value less than 0.05 were implemented in the R package DESeq2 (version 1.38.1). We used metscape to identify enriched Gene Ontology (GO) terms and pathways.

[0077] (11) Determination of cell apoptosis and cellular ROS

[0078] Annexin V-EGFP apoptosis detection kit (Vigorous Biotechnology) was used to detect CUL2 + / + and CUL2 - / - hMSCs were subjected to apoptosis assay. In addition, H2DCFDA (Thermo Fisher) was used to assess CUL2 + / + or CUL2 - / - Cellular ROS levels in hMSCs. Flow cytometry was used to quantitatively observe apoptotic cells and cellular reactive oxygen species.

[0079] (12)Co-immunoprecipitation(Co-IP)

[0080] Cells were collected and lysed on ice with a lysis buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 0.3% NP-40, 1 mM EDTA, 1 mM PMSF and 1× protease and phosphatase inhibitors. For immunoprecipitation (IP), protein extracts were incubated overnight with continuous rotation at 4°C in the presence of specific antibodies (2 μg). Subsequently, incubation was continued for 3 hours with ProteinA / G+ agarose beads (Santa Cruz, sc-2003). After thorough washing, the precipitated proteins were analyzed by western blotting. Antibodies used for immunoprecipitation and western blotting included: anti-FLAG (Sigma, F1804), anti-MYC-tag (MBL, M192-3), anti-TSPYL2 (Proteintech, 12087-2-AP), anti-CUL2 (Santa Cruz, sc-166506), normal rabbit IgG control (Cell Signaling Technology, 2927S), and mouse IgG control (CellSignaling Technology, 5415S).

[0081] (13) In vivo ubiquitination assay

[0082] CUL2 + / + hMSCs and CUL2 - / -hMSCs (P6) were incubated with MG132 (25 μM) for 5 h, and immunoprecipitation analysis was performed using anti-TSPYL2 (Proteintech, 12087-2-AP). Anti-multi-ubiqutin (MBL, D058-3) and anti-TSPYL2 (Proteintech, 12087-2-AP) were used to detect ubiquitinated TSPYL2 protein.

[0083] (14) Coomassie blue staining-liquid chromatography-tandem mass spectrometry (LC-MS / MS)

[0084] HEK293T cells expressing FLAG tags (Luc, CUL2 or TSPYL2) were collected and lysed using immunoprecipitation lysis buffer (50mM Tris-HCl, pH 7.4, 150mM NaCl, 0.3% NP-40, 1mM EDTA, 1mM PMSF) containing a protease inhibitor cocktail (Roche, 11836170001). The lysate was incubated with anti-flag M2 resin at 4°C overnight. After washing, the enriched protein complex was eluted with excess FLAG peptide. The eluted protein was separated by SDS-PAGE and stained with Coomassie blue (Beijing Dingguo Changsheng Biotechnology Co., Ltd., WB-0101). The protein bands of interest were excised and analyzed by liquid chromatography-mass spectrometry (LC-MS / MS) using a Q mass spectrometer (Thermo Scientific).

[0085] (15) Data Independent Acquisition (DIA) Quantitative Proteomics

[0086] Data independent acquisition (DIA) quantitative proteomics was performed by Beijing Proteome Research Center. 7 CUL2 + / + and CUL2 - / -hMSCs were lysed on ice for 30 min in lysis buffer (8 M urea, 100 mM Tris-HCl, pH 7.6, with protease inhibitors). After centrifugation at 18,000 g for 15 min, the supernatant was collected and the protein concentration was quantified by the BCA method (Dingguo Changsheng Biotechnology, BCA-02), and 6 samples were digested by the filter-assisted sample preparation (FASP) method. 2 μg of peptide was used for each sample for enzymatic digestion. Mass spectrometry analysis was performed using a Thermo Q Exactive HF mass spectrometer (Thermo) for a single 120-min DIA experiment. Mass spectrometry data were processed by Spectronout Pulsar 16.1 (Biognosys) using the DirectlyDIA method. Peptide identification was performed by searching in the UniProt human database. The p-value was calculated using a kernel density estimator, and the q-value cutoff was set to 0.01 at the precursor and protein levels. Protein abundance was quantified by the peak area of ​​the product ions, and at least three product ions were selected for average intensity quantification. Protein abundance was log 2 The differential expression of proteins (DEPs) was analyzed using the R package limma (version 3.50.3). DEPs were defined as those with a Benjamin-Hochberg corrected p value less than 0.05 and an absolute log 2 (fold change) is greater than 0.485.

[0087] (16) Teratoma experiment

[0088] For hESC teratoma experiments, 4 × 10 6 CUL2 + / + hESCs or CUL2 - / - hESCs were implanted into the inguinal region of NOD / SCID male mice (6-8 weeks old, STEMCELL (Beijing) Biotechnology Co., Ltd.) at a ratio of 1:4 Matrigel (BD Biosciences) and mTeSR medium (STEMCELL Technologies). The implanted mice were monitored for approximately 8 weeks, and the collected teratomas were further analyzed.

[0089] (17) Cycloheximide tracking test

[0090] To analyze protein half-life, cells were incubated with cycloheximide (CHX, Sigma, C7698) for an appropriate time. Subsequently, cells were collected, lysed, and subjected to western blotting analysis. The relative intensity of TSPYL2 protein was quantified using ImageJ 1.37v software.

[0091] Example 1: CUL2 is the Cullin member most susceptible to hMSC aging

[0092] 1. Effect of CUL2 gene knockout on cell senescence

[0093] 1) Construction of recombinant vector

[0094] The DNA fragments obtained by annealing the corresponding forward primer and reverse primer were inserted into the Lenti-CRISPRv2 vector (Addgene, #52961) using BsmBI (NEB, R0580) to obtain the recombinant vectors Lenti-CRISPRv2-sg-CUL2-1, Lenti-CRISPRv2-sg-CUL2-2, Lenti-CRISPRv2-sg-CUL2-3, Lenti-CRISPRv2-sg-CUL2-4, Lenti-CRISPRv2-sg-CUL2-5, Lenti-CRISPRv2-sg-CUL2-6, Lenti-CRISPRv2-sg-CUL2-7, Lenti-CRISPRv2-sg-CUL2-8, Lenti-CRISPRv2-sg-CUL2-9, Lenti-CRISPRv2-sg-CUL2-10, Lenti-CRISPRv2-sg-CUL2-21, Lenti-CRISPRv2-sg-CUL2-32, Lenti-CRISPRv2-sg-CUL2-33, Lenti-CRISPRv2-sg-CUL2-11, Lenti-CRISPRv2-sg-CUL2-22, Lenti-CRISPRv2-sg-CUL2-33, Lenti-CRISPRv2-sg-CUL2-34, Lenti-CRISPRv2-sg-CUL2-11, Lenti-CRISPRv2-sg-CUL2-2 ...4, Lenti-CRISPRv2-sg-CUL2-35, Lenti-CRISPRv2-sg-CUL2-36 SPRv2-sgNC, Lenti-CRISPRv2-sg-CUL2-1, Lenti-CRISPRv2-sg-CUL2-2, Lenti-CRISPRv2-sg-CUL2-3 can transcribe three sgRNAs targeting the CUL2 gene, namely sg-CUL2-1, sg-CUL2-2 and sg-CUL2-3, and Lenti-CRISPRv2-sgNC can transcribe the negative control sgRNA. The target sequences of each sgRNA and its corresponding primers are as follows:

[0095] Target sequence of sg-CUL2-1: TTTGACGACAATAAAAGCCG

[0096] Forward primer: CACCGTTTGACGACAATAAAAGCCG;

[0097] Reverse primer: AAACCGGCTTTTATTGTCGTCAAAC.

[0098] Target sequence of sg-CUL2-2: AATACGTCGAAAGAGCAACA

[0099] Forward primer: CACCGAATACGTCGAAAGAGCAACA;

[0100] Reverse primer: AAACTGTTGCTCTTTCGACGTATTC.

[0101] Target sequence of sg-CUL2-3: ACAGAAGCGGACCTTCAGTA

[0102] Forward primer: CACCGACAGAAGCGGACCTTCAGTA;

[0103] Reverse primer: AAACTACTGAAGGTCCGCTTCTGTC.

[0104] Target sequence of negative control sgRNA (sgNC): ACTGCTGCTGACATCTCTTA

[0105] Forward primer: CACCG ACTGCTGCTGACATCTCTTA;

[0106] Reverse primer: AAACTAAGAGATGTCAGCAGCAGTC.

[0107] 2) Preparation of recombinant lentivirus

[0108] CUL2 knockout lentivirus 1: HEK293T cells were plated into an appropriate number of 10 cm culture dishes. When the cells grew to 90% density, the target plasmid (Lenti-CRISPRv2-sg-CUL2-1) and the auxiliary plasmid were transfected into HEK293T cells using the transfection reagent PEI (Polysciences, 24765-1) at a mass ratio of target plasmid: psPAX2 (addgene, #12260): pMD2.G (addgene, #12259) = 4:3:2. After transfection, the medium was changed within 7-12 hours; 24 hours after transfection, the medium was discarded and 5 ml of fresh medium was added for the first virus concentration. 48 to 72 hours after transfection, filter with a 0.45 μm filter and collect the viral supernatant; centrifuge the virus at 1,9400g for 2 hours and 45 minutes, discard the supernatant to obtain CUL2 knockout lentivirus 1, add a small amount of serum, resuspend and aliquot, and store at -80°C.

[0109] According to the above steps, lenti-CRISPRv2-sg-CUL2-1 was replaced with lenti-CRISPRv2-sg-CUL2-2, lenti-CRISPRv2-sg-CUL2-3, and Lenti-CRISPRv2-sg-NC to obtain CUL2 knockout lentivirus 2, CUL2 knockout lentivirus 3, and gene knockout control lentivirus, respectively.

[0110] 3) Infect target cells with lentivirus

[0111] The cells to be infected are human RS MSCs (ie RS hMSCs), HGPS hMSCs, and WS hMSCs. Among them, human RS MSCs are described in the literature “Huize Pan et al., SIRT6 safeguards human mesenchymal stem cells from oxidative stress by coactivating NRF2, Cell Res. 2016 Feb; 26(2): 190-205. doi: 10.1038 / cr.2016.4. Epub 2016 Jan 15., PMID: 26768768”; HGPS hMSCs are described in the literature “Zeming Wu et al., Differential stem cell aging kinetics in Hutchinson-Gilford progeria syndrome and Werner syndrome, Protein Cell. 2018 Apr; 9(4): 333-350. doi: 10.1007 / s13238-018-0517-8. Epub 2018 Feb 23., PMID: 29476423”; WS hMSCs are described in the literature “Weiqi Zhang et al., Aging stem cells. A Werner syndrome stem cell model unveils heterochromatin alterations as a driver of human aging, Science. 2015 Jun 5; 348(6239): 1160-3. doi: 10.1126 / science.aaa1356. Epub 2015 Apr 30., PMID: 25931448”.

[0112] Human MSCs, HGPS hMSCs and WS hMSCs were infected with CUL2 knockout lentivirus 1, CUL2 knockout lentivirus 2, CUL2 knockout lentivirus 3 and gene knockout control lentivirus of CUL2, a member of the Cullin family, respectively. SA-β-Gal staining was used to detect the effect of knockout of the Cullin member CUL2 gene on hMSC cell senescence. Figure 1 In the A), it was found that knocking out CUL2 by three independent sgRNAs in three aging stem cell systems all led to an increase in the proportion of SA-β-Gal positive cells ( Figure 1 (B and C).

[0113] After RS ​​hMSCs (P6) (i.e., the 6th generation of RS hMSCs) were infected with three CUL2 knockout lentiviruses, SA-β-Gal staining and clonal expansion experiments were performed. Western blotting analysis showed that all three sgRNAs successfully knocked down CUL2, and its knockdown led to an increase in the proportion of SA-β-Gal positive cells. Clonal expansion experiments showed that the clone formation ability was reduced ( Figure 1 (in DF).

[0114] 2. Effect of knockdown of CUL2 gene expression on cell senescence

[0115] 1) Construction of recombinant vector

[0116] The DNA fragment obtained by annealing the corresponding forward primer and reverse primer was inserted into the pLVTHM vector (Addgene, #12247) using MluI (NEB, R3198S) and ClaI (NEB, R0197S), and the recombinant vectors pLVTHM-sh-CUL2-1, pLVTHM-sh-CUL2-2 and pLVTHM-sh-GL2 were obtained respectively. pLVTHM-sh-CUL2-1 and pLVTHM-sh-CUL2-2 can transcribe two shRNAs that reduce the expression of CUL2 gene, namely sh-CUL2-1 and sh-CUL2-2, and pLVTHM-sh-GL2 can transcribe the control shRNA (i.e. sh-GL2). The target sequences of each shRNA and its corresponding primers are as follows:

[0117] Target sequence of sh-CUL2-1: ACGCAAGAATGCTGGCAAA;

[0118] Forward primer: CGCGTG ACGCAAGAATGCTGGCAAA TTCAAGAGA TTTGCCAGCATTCTTGCGT TTTTTGGAAAT;

[0119] Reverse primer: CGATTTCCAAAAA ACGCAAGAATGCTGGCAAA TCTCTTGAA TTTGCCAGCATTCTTGCG T CA.

[0120] Target sequence of sh-CUL2-2: ACGTTTAATTCATGGGTTA;

[0121] Forward primer: CGCGTG ACGTTTAATTCATGGGTTA TTCAAGAGA TAACCCATGAATTAAACGT TTTTTGGAAAT;

[0122] Reverse primer: CGATTTCCAAAAA ACGTTTAATTCATGGGTTA TCTCTTGAA TAACCCATGAATTAAACG T CA.

[0123] Target sequence of sh-GL2: CTGATCATAATCAGCCAT;

[0124] Forward primer: CGCGTG CTGATCATAATCAGCCAT TTCAAGAGATACCGACTAATACTAGTCTTTTTTGGAAAT;

[0125] Reverse primer: CGATTTCCAAAAA CTGATCATAATCAGCCAT TCTCTTGAATAACCGACTAATACTAGTC.

[0126] 2) Preparation of recombinant lentivirus

[0127] Lentivirus was prepared using pLVTHM-sh-CUL2-1, pLVTHM-sh-CUL2-2 and pLVTHM-sh-GL2, respectively, to obtain CUL2 knockdown lentivirus 1, CUL2 knockdown lentivirus 2 and gene knockdown control lentivirus, respectively.

[0128] 3) Infection of target cells

[0129] The cells to be infected were RS hMSCs (P6).

[0130] The obtained lentivirus was transfected into the transfected cells respectively, and Western blotting analysis showed that the shRNA of CUL2 successfully knocked down CUL2. The decrease in CUL2 expression led to an increase in the proportion of SA-β-Gal positive cells. The clonal expansion experiment showed that the clonal formation ability was reduced ( Figure 1 Medium GI).

[0131] Example 2: CUL2 deficiency accelerates senescence of hMSCs

[0132] 1. Obtaining CUL2-deficient human embryonic stem cells (hESCs)

[0133] To further investigate whether and how CUL2 acts as a protective factor against hMSC aging, the inventors used CRISPR / Cas9-mediated gene editing technology to knock out CUL2 in human embryonic stem cells (hESCs).

[0134] 1) Preparation of recombinant vector:

[0135] The DNA fragment obtained by annealing the forward primer and the reverse primer was inserted into the pCAG-mCherry-gRNA vector (Addgene, #87110) using AflII (NEB, R0520S) to obtain the recombinant vector pCAG-mCherry-gRNA-CUL2, which can transcribe the sgRNA targeting exon 3 of the CUL2 gene (target sequence AATACGTCGAAAGAGCAACA). The primers used are as follows:

[0136] Forward primer: tttcttggctttatatatcttgtggaaaggacgaaacacc AATACGTCGAAAGAGCAA CA ;

[0137] Reverse primer: gactagccttattttaacttgctatttctagctctaaaac TGTTGCTCTTTCGACGTA TT .

[0138] 2) Cell transfection

[0139] Before gene knockout, H9 hESCs (WiCell Research Institute, also referred to as CUL2 + / + hESCs) in mTeSR containing Y-27632 (a ROCK inhibitor, Selleck) TM 1 medium for 24 hours. Then, 4D nuclear factor (Lonza) was used to culture the CUL2 + / + hESCs were electroporated with the indicator vectors pCAG-mCherry-gRNA-CUL2 and pCas9_GFP (Addgene, #44719). After electroporation, the cells were plated in mTeSR containing Y-27632. TM 1 medium on a matrigel plate for another 48 hours. GFP and mCherry double positive cells were sorted using a flow cytometry (FACS) system. Subsequently, these sorted cells were cultured on MEF feeder cells using hESC medium. Candidate hESCs were collected for amplification and Sanger sequencing of their CUL2 gene, and the selected single clones were recorded as CUL2 - / - hESCs, sequencing results showed that CUL2 - / - In hESCs, a nucleotide pair (G / C) is inserted into the third exon of the CUL2 gene, and the nucleotide inserted in the coding strand is G ( Figure 2 (A).

[0140] Detection of CUL2 by Western blotting- / - The protein content of CUL2 in hESCs was measured by using CUL2 + / + hESCs were used as a control. The results also showed that CUL2 was successfully knocked out ( Figure 2 (middle B).

[0141] Immunofluorescence analysis of CUL2 - / - hESCs and CUL2 + / + The protein levels of pluripotency markers SOX2, OCT4, and NANOG in hESCs were analyzed, and the results showed that CUL2 - / - Expression of pluripotency markers in hESCs and CUL2 + / + hESCs are embryonic stem cells ( Figure 2 Middle C).

[0142] Immunofluorescence analysis of CUL2 - / - hESCs and CUL2 + / + Expression changes of TuJ1 (ectoderm), SMA (mesoderm), and FOXA2 (endoderm) in hESCs teratomas showed that CUL2 - / - hESCs embryonic stem cells have well maintained the potential for germ layer differentiation ( Figure 2 (middle D).

[0143] In addition, karyotyping and genome-wide copy number variation (CNV) analysis showed that CUL2 deficiency did not affect the integrity of the karyotype and genome ( Figure 2 (E, F).

[0144] In addition, immunofluorescence results showed that the loss of CUL2 did not affect cell proliferation ( Figure 2 Middle G).

[0145] These findings suggest that CUL2 is not essential for maintaining the pluripotency and self-renewal capacity of hESCs.

[0146] 2. CUL2 deficiency promotes hMSC senescence

[0147] 1) Effects of CUL2 deficiency on hMSCs

[0148] To further investigate the effect of CUL2 deficiency on hMSCs, the inventors isolated human embryonic stem cells CUL2 + / + hESCs and CUL2 - / - hESCs were differentiated into human mesenchymal stem cells (hMSCs), denoted as CUL2 + / + hMSCs and CUL2 - / - hMSC( Figure 3 (A).

[0149] By using western blotting analysis, the inventors confirmed that in CUL2 - / - CUL2 was successfully knocked out in hMSCs (P4) Figure 3 (middle B).

[0150] Flow cytometry detection of CUL2 + / + hMSCs(P2) and CUL2 - / - hMSC markers (CD73, CD90 and CD105) in hMSCs (P2) + / + and CUL2 - / - hMSCs all express the classic hMSC markers CD73, CD90, and CD105 ( Figure 4 (A).

[0151] With CUL2 + / + Similar to hMSCs, CUL2 - / - hMSCs successfully differentiated into chondrocytes, osteoblasts, and adipocytes, and there was no significant difference in their differentiation abilities ( Figure 4 In addition, CNV analysis showed that CUL2 deletion did not affect the genomic integrity of hMSCs ( Figure 4 Middle E).

[0152] Through growth curve and clonal expansion experiments, the inventors found that CUL2 - / - hMSCs and CUL2 + / + Compared with hMSCs, the proliferation capacity was decreased ( Figure 3 Similarly, CUL2 deficiency accelerated the senescence of hMSCs, as evidenced by a decrease in the proportion of Ki67-positive cells ( Figure 3 Middle D), the proportion of cells in S phase decreased ( Figure 3 E), and an increase in the proportion of SA-β-Gal positive cells ( Figure 3 Middle G).

[0153] In addition, the inventors detected a series of aging markers after CUL2 loss, and RT-qPCR detection showed upregulation of classic aging-related markers CDKN1A (P21) and CDKN2A (P16) ( Figure 3 Middle H, Figure 4 H), Western blotting and immunofluorescence staining analysis showed that the expression of heterochromatin-related proteins LAP2β, LaminB1, H3K9me3, HP1α, and P21 were downregulated ( Figure 3 I, J, K, L, M), and CUL2 - / - Upregulation of SASP-related genes in hMSCs ( Figure 3 Middle H).

[0154] RNA-seq analysis showed that CUL2 deficiency led to downregulation of gene expression related to cell cycle (such as CCNB1 and PLK1) and cell proliferation ( Figure 4 F, G, I), which is consistent with the phenotype observed in hMSCs lacking CUL2. - / - Increased DNA damage and ROS in hMSCs Figure 3 Medium NO).

[0155] 2) Preparation of Luciferase overexpression vector for animal experiments:

[0156] PCR was performed using forward and reverse primers with Luciferase-pcDNA3 (addgene, #18964) plasmid as template, and the PCR product was inserted into the vector pLE4 (donated by Dr. Tomoaki Hishida) using restriction ligase XhoI (NEB, R0146S) and SalI (R0138S) to obtain the recombinant vector pLE4-FLAG-Luciferase (pLE4-LUC), which can transcribe Luciferase mRNA with FLAG tag. The luciferase sequence is derived from the Luciferase-pcDNA3 (addgene, #18964) plasmid, and the primer sequences used are as follows:

[0157] Forward Primer:

[0158] CCGCTCGAGGCCACCATGGACTACAAGGACGACGATGACAAGATGGAAGACGCCAAAAACATAAAGAAA;

[0159] Reverse primer: ACGCGTCGACCTACAATTTGGACTTTCCGCCCTTC.

[0160] For in vivo hMSC transplantation experiments, approximately 1 × 10 6 CUL2 expressing luciferase after transfection with pLE4-FLAG-Luciferase (pLE4-LUC) + / + hMSCs or CUL2 - / - hMSCs were injected into the tibialis anterior muscle of male immunodeficient nude mice (6-8 weeks old, Sibeifu (Beijing) Biotechnology Co., Ltd.). Luciferin activity was analyzed using an in vivo imaging system.

[0161] By fluorescein-labeled CUL2 + / + and CUL2 - / -hMSCs were transplanted into the tibialis anterior muscle of immunodeficient mice and the inventors found that CUL2 - / - The in vivo retention capacity of hMSCs was affected compared with wild-type hMSCs ( Figure 3 (in P).

[0162] 3) Effects of CUL2 supplementation on hMSCs

[0163] hMSCs were used as templates, and PCR amplification was performed using FLAG-CUL2 forward primer and FLAG-CUL2 reverse primer; the obtained PCR product was digested with XbaI (NEB, R0145S) and SalI (NEB, R0138S) to obtain a large fragment, and the pLE4 vector (donated by Dr. Tomoaki Hishida) was digested with XbaI (NEB, R0145S) and SalI (NEB, R0138S) to obtain a vector backbone, and the obtained recombinant vector with the correct sequence was recorded as pLE4-FLAG-CUL2. pLE4-FLAG-CUL2 is a recombinant vector obtained by replacing the DNA fragment between the XbaI and SalI recognition sequences of the pLE4 vector with the DNA fragment shown at positions 11-2285 of SEQ ID No.1 in the sequence list, and the recombinant vector can express the fusion protein formed by the CUL2 protein shown in SEQ ID No.2 and FLAG.

[0164] FLAG-CUL2 forward primer: CGCGGATCCGCCACCATGGACTACAAGGACGACGACGACAAGATGTACAGAGTAACATGGTCAACT;

[0165] FLAG-CUL2 reverse primer: ACGCGTCGACTCACGCGACGTAGCTGTATTCAT.

[0166] pLE4-LUC: A recombinant vector obtained by replacing the DNA fragment between the XhoI and SalI recognition sequences of the pLE4 vector with the DNA fragment shown at positions 1-1686 of SEQ ID No.3 in the sequence list. The recombinant vector can express LUC (luciferase) shown in SEQ ID No.4.

[0167] Preparation of lentivirus expressing CUL2:

[0168] Preparation of recombinant lentivirus: FLAG-CUL2 overexpression lentivirus was prepared using FLAG-CUL2.

[0169] According to the above method, pLE4-FLAG-CUL2 was replaced with pLE4-LUC to obtain the control virus.

[0170] The CUL2 obtained above - / - hMPCs (P6) are cells to be transfected, and are transfected with a lentivirus expressing CUL2 or a control virus to obtain cells expressing CUL2 or control cells.

[0171] The results showed that reintroduction of CUL2 into CUL2 - / - After being injected into hMSCs, the decrease in cell proliferation and accelerated senescence caused by CUL2 deficiency were attenuated. Figure 3 Middle QS, Figure 4 (in Chinese).

[0172] In conclusion, the above results indicate that CUL2 plays an important role in the aging process of hMSCs.

[0173] Example 3: Overexpression of CUL2 delays senescence of hMSCs

[0174] The inventors used Western blotting analysis to find that the expression of CUL2 was reduced in late generation RS hMSCs ( Figure 5 (A), the inventors further investigated whether re-overexpression of CUL2 could delay cell senescence.

[0175] 1. Construction of recombinant vector

[0176] Lentiviral CRISPR / cas9-mediated activation involves cloning the target sequence of CUL2 sgRNA into the lentiSAMv2 vector (Addgene, #75112) using BsmBI (NEB, R0580), and the resulting recombinant vectors are designated as lentiSAMv2-sg-CUL2-1, lentiSAMv2-sg-CUL2-2, and lentiSAMv2-sg-CUL2-3. lentiSAMv2-sg-CUL2-1, lentiSAMv2-sg-CUL2-2 and lentiSAMv2-sg-CUL2-3 can transcribe sgRNAs targeting sg-CUL2-1, sg-CUL2-2 and sg-CUL2-3, respectively. The sgRNA target sequences for activating CUL2 (SAM-CUL2) are: sg-CUL2-1: GGACTGCTAATAACAATATGT, sg-CUL2-2: GCATTGACAGCAAGCCCAGCA, sg-CUL2-3: GCAGTGGGAGTTAGGTGGAAT.

[0177] According to the above method, the sgRNA target sequence was replaced with SAM-NC (TAGACAACCGCGGAGAATGC) to obtain the negative control vector lentiSAMv2-sg-NC.

[0178] 2. Preparation of recombinant lentivirus

[0179] CUL2 activation lentivirus 1: According to step 1, 2), replace Lenti-CRISPRv2-sg-CUL2-1 with lentiSAMv2-sg-CUL2-1 to obtain CUL2 activation lentivirus 1.

[0180] According to the above steps, lentiSAMv2-SAM-CUL2-1 was replaced with lentiSAMv2-SAM-CUL2-2, lentiSAMv2-SAM-CUL2-3, and lentiSAMv2-sg-NC to obtain CUL2-activated lentivirus 2, CUL2-activated lentivirus 3, and negative control lentivirus, respectively.

[0181] 3. Infection of target cells

[0182] The cells to be infected were RS hMSCs (P10) and HGPS hMSCs (P6).

[0183] By manipulating the CRISPR / Cas9 activation system to activate the expression of CUL2, the inventors observed that the activation of CUL2 alleviated the senescent phenotype of RS hMSCs, as manifested by a decrease in the proportion of SA-β-Gal-positive cells and an increase in the clone-forming ability ( Figure 5 The inventors also found a similar phenomenon in HGPS hMSCs ( Figure 5 Consistently, overexpression of CUL2 in RShMSCs (using the FLAG-CUL2 overexpression lentivirus or control virus in Example 2 to transfect cells) reduced the proportion of SA-β-Gal-positive cells and increased cell proliferation, including increasing Ki67-positive cells and enhancing clonal expansion ability and protein expression abundance of H3K9me3 ( Figure 5 In HGPS hMSCs, overexpression of CUL2 also produced a similar phenotype ( Figure 5 These results indicate that overexpression of CUL2 delayed the senescence of hMSCs.

[0184] Example 4: CUL2 regulates TSPYL2 protein stability via the ubiquitin-proteasome pathway

[0185] Since the main function of CUL2 is to assemble with Elongin B and Elongin C, Roc1 and various substrate recognition receptors into CRL2 E3 ubiquitin ligase (CRL2) and degrade downstream substrate proteins, the inventors further identified the key downstream substrates regulated by CUL2 in hMSC aging. To this end, the inventors conducted a quantitative proteomics study and found 253 down-regulated and 244 up-regulated differentially expressed proteins ( Figure 6 Middle A, Figure 8 Cluster analysis of differentially expressed proteins showed that CUL2 knockout activated the HIF-1 signaling pathway and increased ROS metabolism ( Figure 6 B); impaired cell cycle, DNA repair, cell growth and regeneration ( Figure 6 B). The inventors focus on those - / - Genes whose protein levels were upregulated in hMSCs but whose mRNAs were still not upregulated were selected as candidate substrates of CUL2 ( Figure 6 Among them, testis-specific Y-encoded similar protein 2 (TSPYL2), also known as cell division autoantigen 1 (CDA1), which is considered to be an inhibitor of cell proliferation and tumor growth, ranked fourth among the up-regulated proteins and ranked first among the up-regulated proteins related to the cell cycle ( Figure 6 C, D, Figure 8 The inventors found that TSPYL2 testis-specific Y-encoded similar protein 2 (TSPYL2), also known as cell division autoantigen 1 (CDA1), was the most significantly changed protein among the cell cycle-related proteins and was significantly upregulated, which is consistent with the mechanism by which CUL2 loss leads to upregulation of substrate proteins.

[0186] To verify whether TSPYL2 is a potential substrate of CRL2, the inventors first co-transfected HEK293T cells with lentivirus expressing FLAG-TSPYL2 or HA-CUL2. Protein co-immunoprecipitation results showed that there was an interaction between CUL2 and TSPYL2 ( Figure 6 In addition, endogenous antibodies against TSPYL2 were also able to precipitate CUL2 in HEK293T and WT hMSCs ( Figure 6 Middle F).

[0187] Preparation of recombinant vectors: Human Flag-tagged TSPYL2 gene or HA-tagged CUL2 gene was used to replace the DNA fragment between the XhoI and SalI recognition sequences of the pLE4 vector to obtain pLE4-Flag-TSPYL2 and pLE4-HA-CUL2, respectively.

[0188] The sequence of the Human Flag-tagged TSPYL2 gene is SEQ ID No. 5, and the sequence of the encoded protein is SEQ ID No. 6 (protein).

[0189] The HA-tagged CUL2 gene sequence is SEQ ID No.7, and the sequence of the encoded protein is SEQ ID No.8.

[0190] Preparation of TSPYL2 lentivirus: TSPYL2 overexpression lentivirus was prepared using pLE4-Flag-TSPYL2.

[0191] According to the above method, pLE4-Flag-TSPYL2 was replaced with pLE4-HA-CUL2 and pLE4-LUC (luciferase), respectively, to obtain TSPYL2 lentivirus and control virus.

[0192] To further clarify whether the degradation of TSPYL2 protein occurs through the ubiquitin-proteosome pathway, the inventors found that treatment of WT hMSCs with the proteosome inhibitor MG132 led to increased TSPYL2 protein levels, while treatment with the lysosomal inhibitor (BFA1) did not change TSPYL2 protein levels ( Figure 6 In addition, incubation of WT hMSCs with the neddylation inhibitor MLN4924 resulted in a dose-dependent increase in TSPYL2 protein levels ( Figure 6 H), indicating that TSPYL2 may be a substrate of CRLs E3 ligase. To further confirm that TSPYL2 is regulated by CUL2, overexpression of CUL2 in WT hMSCs resulted in a decrease in TSPYL2 protein level while its mRNA level did not change ( Figure 6 In contrast, the inventors found that CUL2 + / + Compared with hMSCs, CUL2 - / - The TSPYL2 protein level in hMSCs was significantly increased ( Figure 6 Middle K), the protein half-life was prolonged without changes in its mRNA level ( Figure 6 Next, the inventors tested whether the accumulation of TSPYL2 protein caused by CUL2 was mediated by CUL2-mediated ubiquitination of TSPYL2. - / - The ubiquitination level of TSPYL2 in hMSCs is much lower than that of CUL2 + / + hMSCs( Figure 6Together, these results suggest that TSPYL2 is a substrate of Cullin E3 ubiquitin ligase complexes (CRLs) and is degraded via the CRL2-mediated ubiquitin-proteosome pathway.

[0193] Example 5: TSPYL2 promotes hMSC senescence by upregulating P21 expression

[0194] The inventors of the present invention aimed to investigate the role of TSPYL2 in hMSC aging.

[0195] 1. The abundance of TSPYL2 increases in late-generation hMSCs

[0196] The inventors used Western blotting to detect changes in the protein level of TSPYL2 in early and late generation hMSCs undergoing replicative senescence and found that the abundance of TSPYL2 increased in late generation cells ( Figure 7 (A).

[0197] 2. Effect of TSPYL2 on Cell Senescence

[0198] 1) Construction of TSPYL2 overexpression vector and lentivirus

[0199] The TSPYL2 overexpression vector was the same as pLE4-Flag-TSPYL2 in Example 4. pLE4-LUC was used as a control.

[0200] Using hMSCs as template, PCR amplification was performed using FLAG-TSPYL2 forward primer and FLAG-TSPYL2 reverse primer; the obtained PCR product was digested with EcoRI (NEB, R0101S) and XbaI (NEB, R0145S) to obtain a large fragment and connected with the pHBLV-CMVIE-IRES-Puro (pHBLV) vector (Hanheng Biotechnology Co., Ltd.) after digestion with EcoRI (NEB, R0101S) and XbaI (NEB, R0145S) to obtain a vector backbone, and the obtained recombinant vector with the correct sequence was recorded as pLE4-FLAG-TSPYL2. pLE4-FLAG-TSPYL2 is a recombinant vector obtained by replacing the DNA fragment between the EcoRI and XbaI recognition sequences of the pHBLV vector with the DNA fragment shown in SEQ ID No. 5 in the sequence list, and the recombinant vector can express the fusion protein formed by the TSPYL2 protein shown in SEQ ID No. 6 and FLAG.

[0201] FLAG-TSPYL2 forward primer: CCGGAATTCGCCACCATGGACTACAAGGACGACGATGACAAGATGGACCGCCCAGATGAGG;

[0202] FLAG-TSPYL2 reverse primer: CTAGTCTAGATTATCCGGTTTTCCCCCTCTTCC.

[0203] pHBLV-FLAG-LUC: A recombinant vector obtained by replacing the DNA fragment between the XhoI and BamHI recognition sequences of the pHBLV vector with the DNA fragment shown in positions 10-1692 of SEQ ID No.9 in the sequence list. The recombinant vector can express LUC (luciferase) shown in SEQ ID No.4.

[0204] According to the virus preparation method, TSPYL2 lentivirus and LUC lentivirus were prepared using pLE4-FLAG-TSPYL2 and pHBLV-FLAG-LUC respectively.

[0205] 2) Construction of TSPYL2 and P21 knockout vectors and lentivirus

[0206] The DNA fragments obtained by annealing the corresponding forward primer and reverse primer were inserted into the Lenti-CRISPRv2 vector (Addgene, #52961) using BsmBI (NEB, R0580) to obtain the recombinant vectors Lenti-CRISPRv2-sg-TSPYL2-1, Lenti-CRISPRv2-sg-TSPYL2-2, Lenti-CRISPRv2-sg-P21, and Lenti-CRISPRv2-sg-NC, respectively. Lenti-CRISPRv2-sg-TSPYL2-1 and Lenti-CRISPRv2-sg-TSPYL2-2 can transcribe two sgRNAs targeting the TSPYL2 gene, namely sg-TSPYL2-1 and sg-TSPYL2-2; Lenti-CRISPRv2-sg-P21 can transcribe the sgRNA targeting the P21 gene, namely sg-P21-1; Lenti-CRISPRv2-sg-NC can transcribe the negative control sgRNA. The target sequences of each sgRNA and its corresponding primers are as follows:

[0207] Target sequence of sg-TSPYL2-1: GGTGCTGGCCGATATGAGGG;

[0208] Forward primer: CACCGGGTGCTGGCCGATATGAGGG;

[0209] Reverse primer: AAACCCCTCATATCGGCCAGCACCC.

[0210] Target sequence of sg-TSPYL2-2: GGAAGAGGCGATCATCATAG;

[0211] Forward primer: CACCGGGAAGAGGCGATCATCATAG;

[0212] Reverse primer: AAACCTATGATGATCGCCTCTTCCC.

[0213] Target sequence of sg-P21-1: AGTCGAAGTTCCATCGCTCA;

[0214] Forward primer: CACCGAGTCGAAGTTCCATCGCTCA;

[0215] Reverse primer: AAACTGAGCGATGGAACTTCGACTC.

[0216] Target sequence of negative control sgRNA (sgNC): ACTGCTGCTGACATCTCTTA;

[0217] Forward primer: CACCG ACTGCTGCTGACATCTCTTA;

[0218] Reverse primer: AAACTAAGAGATGTCAGCAGCAGTC.

[0219] TSPYL2 knockout lentivirus 1: According to step 1, 2), replace Lenti-CRISPRv2-sg-CUL2-1 with Lenti-CRISPRv2-sg-TSPYL2-1 to obtain TSPYL2 knockout lentivirus 1.

[0220] According to the above steps, Lenti-CRISPRv2-sg-TSPYL2-1 was replaced with Lenti-CRISPRv2-sg-TSPYL2-2, Lenti-CRISPRv2-sg-P21, and Lenti-CRISPRv2-sg-NC to obtain TSPYL2 knockout lentivirus 2, P21 knockout lentivirus, and gene knockout control lentivirus, respectively.

[0221] 3) Transfection of target cells

[0222] RS hMSCs (P6), CUL2 + / + hMSCs(P6) or CUL2 - / - hMSCs (P6) are cells to be transfected, and are transfected using the viruses obtained in steps 1) and 2).

[0223] The results showed that overexpression of TSPYL2 in RShMSCs reduced cell proliferation and clone formation ability and accelerated cell senescence ( Figure 7 In contrast, knockdown of TSPYL2 increased cell proliferation and colony formation ability and reduced the proportion of senescent cells ( Figure 7 These results indicate that high expression of TSPYL2 accelerates hMSC senescence. To further clarify whether TSPYL2 is involved in CUL2-induced cell senescence, the inventors - / - We further knocked down TSPYL2 in hMSCs and observed that TSPYL2 knockout alleviated the decreased cell proliferation and accelerated senescence caused by CUL2 deficiency ( Figure 7 Chinese JM).

[0224] Inspired by previous studies demonstrating that TSPYL2 upregulates P21 expression, the inventors hypothesized that TSPYL2 might accelerate cellular senescence by promoting P21 expression. Consistently, the inventors found that overexpression of TSPYL2 led to an increase in P21 protein levels, while knockout of TSPYL2 had the opposite effect ( Figure 7 (N, O).

[0225] In addition, the inventors observed that the decreased clone formation ability and increased proportion of senescent cells caused by TSPYL2 overexpression could be partially alleviated after further knockdown of P21 ( Figure 7 P, Q, Figure 7 In conclusion, our results suggest that the CUL2-TSPYL2-P21 signaling axis can delay hMSC aging ( Figure 7 (middle R).

[0226] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Use of proteins in the CUL2-TSPYL2-P21 signaling axis or substances that regulate the content or activity of proteins in the signaling axis in the preparation of products having the following functions: X1) Treating and / or preventing and / or delaying aging; X2) treating and / or preventing diseases associated with aging; X3) Improve cell cycle; The proteins in the CUL2-TSPYL2-P21 signaling axis are CUL2, TSPYL2 and / or P21.

2. The use according to claim 1, characterized in that: The substance that regulates the protein content or activity in the signal axis is a substance that increases the content or activity of CUL2, a substance that decreases the content or activity of TSPYL2, and / or a substance that decreases the content or activity of P21.

3. The use according to claim 2, characterized in that: The substance that increases the content or activity of CUL2 is a substance that promotes the expression of CUL2 gene or a biological material related to CUL2; the biological material is any one of the following B1) to B4): B1) a nucleic acid molecule encoding CUL2; B2) an expression cassette containing the nucleic acid molecule described in B1); B3) a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3); The substance that reduces the content or activity of TSPYL2 is a substance that knocks out the TSPYL2 gene; The substance that reduces the content or activity of P21 is a substance that knocks out the P21 gene.

4. The use according to claim 3, characterized in that: The substance that promotes CUL2 gene expression is a CRISPR / dCas9 transcription activation system that targets the transcription start site of the CUL2 gene.

5. The use according to any one of claims 1 to 4, characterized in that: The senescence is cellular senescence; Furthermore, the cell senescence is mesenchymal stem cell senescence.

6. The use according to any one of claims 1 to 5, characterized in that: The aging is manifested in decreased cell proliferation ability, increased DNA damage and / or increased ROS levels.

7. A method for preparing a cell aging model, comprising: The cell senescence model is obtained by reducing the CUL2 content or activity in the cell, knocking out the CUL2 gene in the cell, and / or increasing the TSPYL2 content or activity in the cell.

8. The method according to claim 7, characterized in that: The cells are mesenchymal stem cells.

9. A product, the active ingredient of which is the substance for increasing the content or activity of CUL2, the substance for reducing the content or activity of TSPYL2, and / or the substance for reducing the content or activity of P21 as claimed in any one of claims 2 to 4.

Images