SiRNA for inhibiting APP gene expression and conjugate and application thereof

By designing specific sequences of siRNA to inhibit APP gene expression, the problem that the prior art is difficult to effectively inhibit APP gene expression is solved, and effective treatment of Alzheimer's and cerebral amyloid vascular disease is achieved.

CN120099004APending Publication Date: 2025-06-06BEIJING GLYEXO GENE TECH CO LTD

Patent Information

Application Number
CN202510312292.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-08-01
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The prior art is difficult to effectively inhibit APP gene expression, leading to the progress of Alzheimer's and cerebral amyloid vascular disease.

Method used

A siRNA was designed, containing specific nucleotide sequences I and II, which could specifically inhibit the expression of APP genes and verify its effectiveness by in vitro and in vivo experiments.

Benefits of technology

It significantly reduced the APP mRNA level, inhibited the expression of APP protein and the production of Aβ, thereby slowing the progress of Alzheimer's and cerebral amyloid vascular disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005314906690000101
    Figure BDA0005314906690000101
  • Figure BDA0005314906690000102
    Figure BDA0005314906690000102
  • Figure BDA0005314906690000111
    Figure BDA0005314906690000111
Patent Text Reader

Abstract

The invention belongs to the field of biological medicine, and relates to siRNA and a conjugate for inhibiting APP gene expression, the siRNA comprises a positive-sense strand and an antisense strand, the positive-sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II; each nucleotide in the nucleotide sequence I and the nucleotide sequence II is modified or unmodified nucleotide; the nucleotide sequence I and the nucleotide sequence II are at least partially reversely complementary to form a double-stranded region; the nucleotide sequence I is basically consistent with a first section of nucleotide sequence, and the first section of nucleotide sequence is a section of nucleotide sequence with the length of at least 19 nucleotides in mRNA expressed by an APP gene. The siRNA can specifically induce degradation of APP mRNA, so that synthesis of APP in the liver is inhibited, APP protein is induced to be reduced durably, pathological deposition of Abeta and other related toxic proteins is reduced, and the siRNA has a good patent medicine prospect.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of the Chinese invention patent application with application number 202411052122.5, application date August 1, 2024, and invention name “siRNA and its conjugates and applications for inhibiting APP gene expression”. Technical Field

[0002] The invention belongs to the field of biomedicine and relates to siRNA and a conjugate for inhibiting APP gene expression. Background Art

[0003] Alzheimer's disease (AD) is the leading cause of dementia and is defined by amyloid-β plaques and neurofibrillary tangles, manifested by amnesia, or visual, language, executive, behavioral, or motor dysfunction.

[0004] Cerebral amyloid angiopathy (CAA) is a common neurodegenerative disease in the brain of the elderly, characterized by the deposition of amyloid β (Aβ) in intracranial microvessels (pial arteries, cortical arterioles, capillaries). Clinically, it can manifest as different subtypes such as cerebral lobar hemorrhage, cognitive dysfunction, rapidly progressive dementia, and cerebral amyloid attacks; it should be considered in middle-aged and elderly patients with dementia, mental symptoms, and repeated or multiple cerebral lobar hemorrhages. There is currently no specific treatment.

[0005] The human APP (Amyloid Precursor Protein) gene is located on chromosome 21q21.3 and contains 20 exons, encoding amyloid precursor protein and APP membrane protein. Studies have confirmed that amyloid β-protein (Aβ) produced by the decomposition of APP protein is an important pathological cause of both AD and CAA. Both APP and Aβ are related to AD. The toxicity of Aβ depends on the expression of APP, and the role of APP goes beyond the production of toxic fragments. Aging accelerates the accumulation of Aβ by inducing APP process and upregulating β-secretase. Transgenic mice that overexpress APP also have significant changes in vasoactive signals, leading to neurovascular dysfunction. The reduction of APP will lead to a simultaneous reduction of Aβ and all other toxic APP metabolites, which will alleviate the toxic environment associated with AD and slow down the progression of the disease. Therefore, targeting APP to reduce the formation of Aβ is the focus of drug development.

[0006] Currently, therapies targeting APP include immunotherapy or APP secretase inhibitors, but the key issue in immunotherapy is the effective delivery of drugs to the brain. Others may be terminated in clinical trials due to toxicity or side effects. The clinical evidence for antibody drugs targeting Aβ protein is concentrated in early AD patients, so patients in the middle and late stages do not meet the indications for medication, and have toxic side effects such as cerebral edema. Other specific drugs for AD, such as acetylcholine inhibitors, can only relieve mild to moderate AD symptoms and have no significant therapeutic effect. Summary of the invention

[0007] The purpose of the present invention is to provide a siRNA molecule capable of inhibiting the expression of APP gene, so as to provide a new treatment method for Alzheimer's disease and cerebral amyloid angiopathy.

[0008] In one aspect, the present invention provides an siRNA, which comprises a sense chain and an antisense chain, the sense chain comprises a nucleotide sequence I, and the antisense chain comprises a nucleotide sequence II; each nucleotide in the nucleotide sequence I and the nucleotide sequence II is a modified or unmodified nucleotide; the nucleotide sequence I and the nucleotide sequence II are at least partially reverse-complementary to form a double-stranded region; the nucleotide sequence I is substantially identical to a first nucleotide sequence, and the first nucleotide sequence is a nucleotide sequence of at least 19 nucleotides in length in the mRNA expressed by the APP gene.

[0009] In a preferred embodiment, the first nucleotide sequence is a nucleotide sequence of 19 to 25 nucleotides in length in the mRNA expressed by the APP gene, for example, 19, 20, 21, 22, 23, 24 or 25 nucleotides.

[0010] In a preferred embodiment, the first nucleotide sequence is a nucleotide sequence of at least 19 nucleotides in the high activity interval of the mRNA expressed by the APP gene, such as a nucleotide sequence of 19 to 25 nucleotides. The high activity interval is positions 334-804, 2305-2327 and 2813-2835 of the mRNA expressed by the APP gene, preferably positions 334-356, 490-512, 503-525, 635-656, 641-662, 782-804, 2305-2327 and 2813-2835; the mRNA expressed by the APP gene is shown in NCBI refseq ID NM_000484.4; specifically, the sequence of the mRNA expressed by the APP gene is shown in SEQ ID NO:1.

[0011] The high activity interval means that the siRNA and siRNA conjugate designed within this interval can effectively reduce the APPmRNA level. Figure 1 The results were divided into intervals according to whether the observed maximum inhibition rate of APP mRNA by siRNA and siRNA conjugates fell within 40-60%, 60%-80% or greater than 80%.

[0012] In a preferred embodiment, the nucleotide sequence I has at least 70%, at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with the first stretch of nucleotides.

[0013] In some embodiments, in the above siRNA, the nucleotide sequence II is substantially reverse complementary, essentially reverse complementary, or completely reverse complementary to the first nucleotide sequence.

[0014] The sense strand and antisense strand are the same or different in length, the sense strand is 16-23 nucleotides long, and the antisense strand is 19-26 nucleotides long. In some embodiments, the length ratio of the sense strand and antisense strand of the siRNA is 16 / 21, 19 / 21, 21 / 23, 19 / 24.

[0015] In a specific embodiment, the sequence I comprises at least 15 consecutive nucleotides as shown in any one of SEQ ID NOs: 2-111, such as at least 15, 16, 17, 18, 19, 20 or 21 nucleotides. Preferably, the sequence I is as shown in any one of SEQ ID NOs: 2-111.

[0016] In a specific embodiment, the sequence II comprises at least 15 consecutive nucleotides as shown in any one of SEQ ID NOs: 112-221, such as at least 15, 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides. Preferably, the sequence II is as shown in any one of SEQ ID NOs: 112-221.

[0017] In a specific embodiment, the siRNA comprises a sense strand and an antisense strand, which is:

[0018] 1) The sequence of the sense strand is shown in SEQ ID NO: 2, and the sequence of the antisense strand is shown in SEQ ID NO: 112;

[0019] 2) the sequence of the sense strand is shown in SEQ ID NO: 3, and the sequence of the antisense strand is shown in SEQ ID NO: 113;

[0020] 3) the sequence of the sense strand is shown in SEQ ID NO: 4, and the sequence of the antisense strand is shown in SEQ ID NO: 114;

[0021] 4) the sequence of the sense strand is shown in SEQ ID NO: 5, and the sequence of the antisense strand is shown in SEQ ID NO: 115;

[0022] 5) the sequence of the sense strand is shown in SEQ ID NO: 6, and the sequence of the antisense strand is shown in SEQ ID NO: 116;

[0023] 6) the sequence of the sense strand is shown in SEQ ID NO: 7, and the sequence of the antisense strand is shown in SEQ ID NO: 117;

[0024] 7) The sequence of the sense strand is shown in SEQ ID NO: 8, and the sequence of the antisense strand is shown in SEQ ID NO: 118;

[0025] 8) the sequence of the sense strand is shown in SEQ ID NO:9, and the sequence of the antisense strand is shown in SEQ ID NO:119;

[0026] 9) the sequence of the sense strand is shown in SEQ ID NO: 10, and the sequence of the antisense strand is shown in SEQ ID NO: 120;

[0027] 10) The sequence of the sense strand is shown in SEQ ID NO: 11, and the sequence of the antisense strand is shown in SEQ ID NO: 121;

[0028] 11) The sequence of the sense strand is shown in SEQ ID NO: 12, and the sequence of the antisense strand is shown in SEQ ID NO: 122;

[0029] 12) the sequence of the sense strand is shown in SEQ ID NO: 13, and the sequence of the antisense strand is shown in SEQ ID NO: 123;

[0030] 13) the sequence of the sense strand is shown in SEQ ID NO: 14, and the sequence of the antisense strand is shown in SEQ ID NO: 124;

[0031] 14) the sequence of the sense strand is shown in SEQ ID NO: 15, and the sequence of the antisense strand is shown in SEQ ID NO: 125;

[0032] 15) the sequence of the sense strand is shown in SEQ ID NO: 16, and the sequence of the antisense strand is shown in SEQ ID NO: 126;

[0033] 16) the sequence of the sense strand is shown in SEQ ID NO: 17, and the sequence of the antisense strand is shown in SEQ ID NO: 127;

[0034] 17) The sequence of the sense strand is shown in SEQ ID NO: 18, and the sequence of the antisense strand is shown in SEQ ID NO: 128;

[0035] 18) The sequence of the sense strand is shown in SEQ ID NO: 19, and the sequence of the antisense strand is shown in SEQ ID NO: 129;

[0036] 19) The sequence of the sense strand is shown in SEQ ID NO: 20, and the sequence of the antisense strand is shown in SEQ ID NO: 130;

[0037] 20) the sequence of the sense strand is shown in SEQ ID NO:21, and the sequence of the antisense strand is shown in SEQ ID NO:131;

[0038] 21) the sequence of the sense strand is shown in SEQ ID NO: 22, and the sequence of the antisense strand is shown in SEQ ID NO: 132;

[0039] 22) the sequence of the sense strand is shown in SEQ ID NO: 23, and the sequence of the antisense strand is shown in SEQ ID NO: 133;

[0040] 23) the sequence of the sense strand is shown in SEQ ID NO: 24, and the sequence of the antisense strand is shown in SEQ ID NO: 134;

[0041] 24) the sequence of the sense strand is shown in SEQ ID NO: 25, and the sequence of the antisense strand is shown in SEQ ID NO: 135;

[0042] 25) the sequence of the sense strand is shown in SEQ ID NO: 26, and the sequence of the antisense strand is shown in SEQ ID NO: 136;

[0043] 26) the sequence of the sense strand is shown in SEQ ID NO: 27, and the sequence of the antisense strand is shown in SEQ ID NO: 137;

[0044] 27) the sequence of the sense strand is shown in SEQ ID NO: 28, and the sequence of the antisense strand is shown in SEQ ID NO: 138;

[0045] 28) the sequence of the sense strand is shown in SEQ ID NO: 29, and the sequence of the antisense strand is shown in SEQ ID NO: 139;

[0046] 29) The sequence of the sense strand is shown in SEQ ID NO:30, and the sequence of the antisense strand is shown in SEQ ID NO:140;

[0047] 30) the sequence of the sense strand is shown in SEQ ID NO:31, and the sequence of the antisense strand is shown in SEQ ID NO:141;

[0048] 31) the sequence of the sense strand is shown in SEQ ID NO:32, and the sequence of the antisense strand is shown in SEQ ID NO:142;

[0049] 32) the sequence of the sense strand is shown in SEQ ID NO:33, and the sequence of the antisense strand is shown in SEQ ID NO:143;

[0050] 33) the sequence of the sense strand is shown in SEQ ID NO:34, and the sequence of the antisense strand is shown in SEQ ID NO:144;

[0051] 34) the sequence of the sense strand is shown in SEQ ID NO:35, and the sequence of the antisense strand is shown in SEQ ID NO:145;

[0052] 35) the sequence of the sense strand is shown in SEQ ID NO:36, and the sequence of the antisense strand is shown in SEQ ID NO:146;

[0053] 36) the sequence of the sense strand is shown in SEQ ID NO:37, and the sequence of the antisense strand is shown in SEQ ID NO:147;

[0054] 37) the sequence of the sense strand is shown in SEQ ID NO:38, and the sequence of the antisense strand is shown in SEQ ID NO:148;

[0055] 38) the sequence of the sense strand is shown in SEQ ID NO:39, and the sequence of the antisense strand is shown in SEQ ID NO:149;

[0056] 39) The sequence of the sense strand is shown in SEQ ID NO:40, and the sequence of the antisense strand is shown in SEQ ID NO:150;

[0057] 40) The sequence of the sense strand is shown in SEQ ID NO:41, and the sequence of the antisense strand is shown in SEQ ID NO:151;

[0058] 41) The sequence of the sense strand is shown in SEQ ID NO:42, and the sequence of the antisense strand is shown in SEQ ID NO:152;

[0059] 42) the sequence of the sense strand is shown in SEQ ID NO:43, and the sequence of the antisense strand is shown in SEQ ID NO:153;

[0060] 43) the sequence of the sense strand is shown in SEQ ID NO:44, and the sequence of the antisense strand is shown in SEQ ID NO:154;

[0061] 44) the sequence of the sense strand is shown in SEQ ID NO:45, and the sequence of the antisense strand is shown in SEQ ID NO:155;

[0062] 45) the sequence of the sense strand is shown in SEQ ID NO:46, and the sequence of the antisense strand is shown in SEQ ID NO:156;

[0063] 46) the sequence of the sense strand is shown in SEQ ID NO:47, and the sequence of the antisense strand is shown in SEQ ID NO:157;

[0064] 47) the sequence of the sense strand is shown in SEQ ID NO:48, and the sequence of the antisense strand is shown in SEQ ID NO:158;

[0065] 48) The sequence of the sense strand is shown in SEQ ID NO:49, and the sequence of the antisense strand is shown in SEQ ID NO:159;

[0066] 49) The sequence of the sense strand is shown in SEQ ID NO:50, and the sequence of the antisense strand is shown in SEQ ID NO:160;

[0067] 50) The sequence of the sense strand is shown in SEQ ID NO:51, and the sequence of the antisense strand is shown in SEQ ID NO:161;

[0068] 51) The sequence of the sense strand is shown in SEQ ID NO:52, and the sequence of the antisense strand is shown in SEQ ID NO:162;

[0069] 52) the sequence of the sense strand is shown in SEQ ID NO:53, and the sequence of the antisense strand is shown in SEQ ID NO:163;

[0070] 53) The sequence of the sense strand is shown in SEQ ID NO:54, and the sequence of the antisense strand is shown in SEQ ID NO:164;

[0071] 54) the sequence of the sense strand is shown in SEQ ID NO:55, and the sequence of the antisense strand is shown in SEQ ID NO:165;

[0072] 55) the sequence of the sense strand is shown in SEQ ID NO:56, and the sequence of the antisense strand is shown in SEQ ID NO:166;

[0073] 56) The sequence of the sense strand is shown in SEQ ID NO:57, and the sequence of the antisense strand is shown in SEQ ID NO:167;

[0074] 57) The sequence of the sense strand is shown in SEQ ID NO:58, and the sequence of the antisense strand is shown in SEQ ID NO:168;

[0075] 58) The sequence of the sense strand is shown in SEQ ID NO:59, and the sequence of the antisense strand is shown in SEQ ID NO:169;

[0076] 59) The sequence of the sense strand is shown in SEQ ID NO:60, and the sequence of the antisense strand is shown in SEQ ID NO:170;

[0077] 60) The sequence of the sense strand is shown in SEQ ID NO:61, and the sequence of the antisense strand is shown in SEQ ID NO:171;

[0078] 61) The sequence of the sense strand is shown in SEQ ID NO:62, and the sequence of the antisense strand is shown in SEQ ID NO:172;

[0079] 62) The sequence of the sense strand is shown in SEQ ID NO:63, and the sequence of the antisense strand is shown in SEQ ID NO:173;

[0080] 63) The sequence of the sense strand is shown in SEQ ID NO: 64, and the sequence of the antisense strand is shown in SEQ ID NO: 174;

[0081] 64) The sequence of the sense strand is shown in SEQ ID NO: 65, and the sequence of the antisense strand is shown in SEQ ID NO: 175;

[0082] 65) The sequence of the sense strand is shown in SEQ ID NO:66, and the sequence of the antisense strand is shown in SEQ ID NO:176;

[0083] 66) The sequence of the sense strand is shown in SEQ ID NO: 67, and the sequence of the antisense strand is shown in SEQ ID NO: 177;

[0084] 67) The sequence of the sense strand is shown in SEQ ID NO: 68, and the sequence of the antisense strand is shown in SEQ ID NO: 178;

[0085] 68) The sequence of the sense strand is shown in SEQ ID NO: 69, and the sequence of the antisense strand is shown in SEQ ID NO: 179;

[0086] 69) The sequence of the sense strand is shown in SEQ ID NO: 70, and the sequence of the antisense strand is shown in SEQ ID NO: 180;

[0087] 70) The sequence of the sense strand is shown in SEQ ID NO:71, and the sequence of the antisense strand is shown in SEQ ID NO:181;

[0088] 71) The sequence of the sense strand is shown in SEQ ID NO:72, and the sequence of the antisense strand is shown in SEQ ID NO:182;

[0089] 72) The sequence of the sense strand is shown in SEQ ID NO: 73, and the sequence of the antisense strand is shown in SEQ ID NO: 183;

[0090] 73) The sequence of the sense strand is shown in SEQ ID NO:74, and the sequence of the antisense strand is shown in SEQ ID NO:184;

[0091] 74) The sequence of the sense strand is shown in SEQ ID NO:75, and the sequence of the antisense strand is shown in SEQ ID NO:185;

[0092] 75) the sequence of the sense strand is shown in SEQ ID NO:76, and the sequence of the antisense strand is shown in SEQ ID NO:186;

[0093] 76) The sequence of the sense strand is shown in SEQ ID NO: 77, and the sequence of the antisense strand is shown in SEQ ID NO: 187;

[0094] 77) The sequence of the sense strand is shown in SEQ ID NO: 78, and the sequence of the antisense strand is shown in SEQ ID NO: 188;

[0095] 78) The sequence of the sense strand is shown in SEQ ID NO: 79, and the sequence of the antisense strand is shown in SEQ ID NO: 189;

[0096] 79) The sequence of the sense strand is shown in SEQ ID NO:80, and the sequence of the antisense strand is shown in SEQ ID NO:190;

[0097] 80) The sequence of the sense strand is shown in SEQ ID NO:81, and the sequence of the antisense strand is shown in SEQ ID NO:191;

[0098] 81) The sequence of the sense strand is shown in SEQ ID NO:82, and the sequence of the antisense strand is shown in SEQ ID NO:192;

[0099] 82) the sequence of the sense strand is shown in SEQ ID NO:83, and the sequence of the antisense strand is shown in SEQ ID NO:193;

[0100] 83) The sequence of the sense strand is shown in SEQ ID NO:84, and the sequence of the antisense strand is shown in SEQ ID NO:194;

[0101] 84) the sequence of the sense strand is shown in SEQ ID NO:85, and the sequence of the antisense strand is shown in SEQ ID NO:195;

[0102] 85) The sequence of the sense strand is shown in SEQ ID NO:86, and the sequence of the antisense strand is shown in SEQ ID NO:196;

[0103] 86) The sequence of the sense strand is shown in SEQ ID NO:87, and the sequence of the antisense strand is shown in SEQ ID NO:197;

[0104] 87) The sequence of the sense strand is shown in SEQ ID NO:88, and the sequence of the antisense strand is shown in SEQ ID NO:198;

[0105] 88) The sequence of the sense strand is shown in SEQ ID NO:89, and the sequence of the antisense strand is shown in SEQ ID NO:199;

[0106] 89) The sequence of the sense strand is shown in SEQ ID NO:90, and the sequence of the antisense strand is shown in SEQ ID NO:200;

[0107] 90) The sequence of the sense strand is shown in SEQ ID NO:91, and the sequence of the antisense strand is shown in SEQ ID NO:201;

[0108] 91) The sequence of the sense strand is shown in SEQ ID NO:92, and the sequence of the antisense strand is shown in SEQ ID NO:202;

[0109] 92) The sequence of the sense strand is shown in SEQ ID NO:93, and the sequence of the antisense strand is shown in SEQ ID NO:203;

[0110] 93) The sequence of the sense strand is shown in SEQ ID NO: 94, and the sequence of the antisense strand is shown in SEQ ID NO: 204;

[0111] 94) the sequence of the sense strand is shown in SEQ ID NO:95, and the sequence of the antisense strand is shown in SEQ ID NO:205;

[0112] 95) The sequence of the sense strand is shown in SEQ ID NO:96, and the sequence of the antisense strand is shown in SEQ ID NO:206;

[0113] 96) The sequence of the sense strand is shown in SEQ ID NO: 97, and the sequence of the antisense strand is shown in SEQ ID NO: 207;

[0114] 97) The sequence of the sense strand is shown in SEQ ID NO: 98, and the sequence of the antisense strand is shown in SEQ ID NO: 208;

[0115] 98) The sequence of the sense strand is shown in SEQ ID NO:99, and the sequence of the antisense strand is shown in SEQ ID NO:209;

[0116] 99) The sequence of the sense strand is shown in SEQ ID NO: 100, and the sequence of the antisense strand is shown in SEQ ID NO: 210;

[0117] 100) The sequence of the sense strand is shown in SEQ ID NO: 101, and the sequence of the antisense strand is shown in SEQ ID NO: 211;

[0118] 101) The sequence of the sense strand is shown in SEQ ID NO: 102, and the sequence of the antisense strand is shown in SEQ ID NO: 212;

[0119] 102) the sequence of the sense strand is shown in SEQ ID NO: 103, and the sequence of the antisense strand is shown in SEQ ID NO: 213;

[0120] 103) the sequence of the sense strand is shown in SEQ ID NO: 104, and the sequence of the antisense strand is shown in SEQ ID NO: 214;

[0121] 104) the sequence of the sense strand is shown in SEQ ID NO: 105, and the sequence of the antisense strand is shown in SEQ ID NO: 215;

[0122] 105) the sequence of the sense strand is shown in SEQ ID NO: 106, and the sequence of the antisense strand is shown in SEQ ID NO: 216;

[0123] 106) the sequence of the sense strand is shown in SEQ ID NO: 107, and the sequence of the antisense strand is shown in SEQ ID NO: 217;

[0124] 107) The sequence of the sense strand is shown in SEQ ID NO: 108, and the sequence of the antisense strand is shown in SEQ ID NO: 218;

[0125] 108) The sequence of the sense strand is shown in SEQ ID NO: 109, and the sequence of the antisense strand is shown in SEQ ID NO: 219;

[0126] 109) the sequence of the sense strand is shown in SEQ ID NO: 110, and the sequence of the antisense strand is shown in SEQ ID NO: 220; or

[0127] 110) The sequence of the sense strand is shown in SEQ ID NO:111, and the sequence of the antisense strand is shown in SEQ ID NO:221.

[0128] In one aspect, in the siRNA provided by the present invention, each nucleotide in the nucleotide sequence I and the nucleotide sequence II is a modified nucleotide.

[0129] In a specific embodiment, the modified nucleotide is a fluorinated modified nucleotide or a non-fluorinated modified nucleotide.

[0130] In a specific embodiment, the fluoro-modified nucleotide refers to a nucleotide in which the hydroxyl group at the 2'-position of the ribose group of the nucleotide is replaced by fluorine, and has a structure shown in the following formula (1). The non-fluoro-modified nucleotide refers to a nucleotide or nucleotide analog in which the hydroxyl group at the 2'-position of the ribose group of the nucleotide is replaced by a non-fluoro group. In some embodiments, each non-fluoro-modified nucleotide is independently selected from one of the nucleotides or nucleotide analogs in which the hydroxyl group at the 2'-position of the ribose group of the nucleotide is replaced by a non-fluoro group. The nucleotides in which the hydroxyl group at the 2'-position of the ribose group is replaced by a non-fluoro group are well known to those skilled in the art, and these nucleotides can be selected from one of 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, and 2'-deoxynucleotides. In some embodiments, the 2'-alkoxy-modified nucleotide is a methoxy-modified nucleotide (2'-OMe), as shown in formula (2). In some embodiments, the 2'-substituted alkoxy modified nucleotide, for example, can be a 2'-O-methoxyethyl modified nucleotide (2'-MOE), as shown in formula (3). In some embodiments, the 2'-amino modified nucleotide (2'-NH 2 ) is shown in formula (4). In some embodiments, the 2'-deoxynucleotide (DNA) is shown in formula (5).

[0131]

[0132] Nucleotide analogs refer to groups that can replace nucleotides in nucleic acids but have structures different from adenine ribonucleoside, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide or thymine ribonucleotide. In some embodiments, nucleotide analogs can be isonucleotides, bridged nucleotides or acyclic nucleotides.

[0133] A bridging nucleotide refers to a constrained or inaccessible nucleotide. The bridging nucleotide may contain a five-membered ring, a six-membered ring, or a seven-membered ring with a fixed C3-endosugar condensed bridge structure. In some embodiments, the bridging nucleotide may be LNA, ENA, cET BNA, etc.; wherein LNA is shown in formula (6), ENA is shown in formula (7), and cET BNA is shown in formula (8).

[0134]

[0135] Acyclic nucleotides are a type of nucleotides formed by opening the sugar ring of a nucleotide. In some embodiments, the acyclic nucleotide can be an unlocked nucleic acid (UNA) or a glycerol nucleic acid (GNA), wherein UNA is shown in formula (9) and GNA is shown in formula (10).

[0136]

[0137] In the above formula (9) and formula (10), R is selected from H, OH, or alkoxy (O-alkyl).

[0138] Isonucleotides refer to compounds formed by a change in the position of a base on the ribose ring in a nucleotide. In some embodiments, an isonucleotide may be a compound formed by a base moving from the 1' position to the 2' position or the 3' position of the ribose ring, as shown in formula (11) or formula (12).

[0139]

[0140] In the compounds of formula (11) and formula (12), R is selected from H, OH, F or the non-fluorine groups as described above;

[0141] In the compounds of formula (1) to (12) above, Base represents a base, such as A, U, G, C or T.

[0142] In a specific embodiment, in the direction from the 5' end to the 3' end, one or more nucleotides in positions 7, 9, 10, and 11 of the nucleotide sequence I are fluorinated modified nucleotides; and in the direction from the 5' end to the 3' end, one or more nucleotides in positions 2, 6, 8, 9, 13, 14, 15, and 16 of the nucleotide sequence II are fluorinated modified nucleotides.

[0143] In a specific embodiment, at least a portion of the phosphate groups in the phosphate-sugar backbone of at least one single strand in the sense strand and the antisense strand of the siRNA provided by the present invention is a phosphate group with a modified group. In some implementation methods, the phosphate group with a modified group is a thiophosphate group formed by replacing at least one oxygen atom in the phosphodiester bond in the phosphate group with a sulfur atom; in some embodiments, the phosphate group with a modified group is a thiophosphate group having a structure as shown in formula (13):

[0144]

[0145] In some embodiments, in the siRNA provided by the present invention, preferably, the thiophosphate linkage is present in at least one of the following positions: between the 1st and 2nd nucleotides of the sense strand and / or the antisense strand; between the 2nd and 3rd nucleotides of the sense strand and / or the antisense strand; between the 19th and 20th nucleotides of the antisense strand; between the 20th and 21st nucleotides of the antisense strand; between the 21st and 22nd nucleotides of the antisense strand; between the 22nd and 23rd nucleotides of the antisense strand; or any combination of the above.

[0146] In some embodiments, the 5' terminal nucleotide of the antisense strand of the siRNA is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide, as shown in formula (14), formula (15) and formula (16):

[0147]

[0148] In one aspect, the present invention provides a siRNA conjugate, the siRNA conjugate contains the above-mentioned siRNA and a conjugated group conjugated to the siRNA. In some embodiments, the pharmaceutically acceptable conjugated group in the siRNA conjugate can be galactose or N-acetylgalactosamine, wherein the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, or tetravalent. In some embodiments, the conjugation site of the siRNA and the conjugated group can be at the 3' end or 5' end of the siRNA sense strand, or at the 3' end of the antisense strand, or in the internal sequence of the siRNA.

[0149] In some specific embodiments, the siRNA conjugate of the present invention, the conjugated group is L96, and the structure is as follows:

[0150]

[0151] In a specific embodiment, the siRNA conjugate includes a sense strand and an antisense strand, which is:

[0152] 1) the sequence of the sense strand is shown in SEQ ID NO: 222, and the sequence of the antisense strand is shown in SEQ ID NO: 332;

[0153] 2) the sequence of the sense strand is shown in SEQ ID NO: 223, and the sequence of the antisense strand is shown in SEQ ID NO: 333;

[0154] 3) the sequence of the sense strand is shown in SEQ ID NO: 224, and the sequence of the antisense strand is shown in SEQ ID NO: 334;

[0155] 4) the sequence of the sense strand is shown in SEQ ID NO: 225, and the sequence of the antisense strand is shown in SEQ ID NO: 335;

[0156] 5) the sequence of the sense strand is shown in SEQ ID NO: 226, and the sequence of the antisense strand is shown in SEQ ID NO: 336;

[0157] 6) the sequence of the sense strand is shown in SEQ ID NO: 227, and the sequence of the antisense strand is shown in SEQ ID NO: 337;

[0158] 7) the sequence of the sense strand is shown in SEQ ID NO: 228, and the sequence of the antisense strand is shown in SEQ ID NO: 338;

[0159] 8) the sequence of the sense strand is shown in SEQ ID NO: 229, and the sequence of the antisense strand is shown in SEQ ID NO: 339;

[0160] 9) the sequence of the sense strand is shown in SEQ ID NO: 230, and the sequence of the antisense strand is shown in SEQ ID NO: 340;

[0161] 10) the sequence of the sense strand is shown in SEQ ID NO: 231, and the sequence of the antisense strand is shown in SEQ ID NO: 341;

[0162] 11) the sequence of the sense strand is shown in SEQ ID NO: 232, and the sequence of the antisense strand is shown in SEQ ID NO: 342;

[0163] 12) the sequence of the sense strand is shown in SEQ ID NO: 233, and the sequence of the antisense strand is shown in SEQ ID NO: 343;

[0164] 13) the sequence of the sense strand is shown in SEQ ID NO: 234, and the sequence of the antisense strand is shown in SEQ ID NO: 344;

[0165] 14) the sequence of the sense strand is shown in SEQ ID NO: 235, and the sequence of the antisense strand is shown in SEQ ID NO: 345;

[0166] 15) the sequence of the sense strand is shown in SEQ ID NO: 236, and the sequence of the antisense strand is shown in SEQ ID NO: 346;

[0167] 16) the sequence of the sense strand is shown in SEQ ID NO: 237, and the sequence of the antisense strand is shown in SEQ ID NO: 347;

[0168] 17) the sequence of the sense strand is shown in SEQ ID NO: 238, and the sequence of the antisense strand is shown in SEQ ID NO: 348;

[0169] 18) The sequence of the sense strand is shown in SEQ ID NO: 239, and the sequence of the antisense strand is shown in SEQ ID NO: 349;

[0170] 19) The sequence of the sense strand is shown in SEQ ID NO: 240, and the sequence of the antisense strand is shown in SEQ ID NO: 350;

[0171] 20) the sequence of the sense strand is shown in SEQ ID NO: 241, and the sequence of the antisense strand is shown in SEQ ID NO: 351;

[0172] 21) the sequence of the sense strand is shown in SEQ ID NO: 242, and the sequence of the antisense strand is shown in SEQ ID NO: 352;

[0173] 22) the sequence of the sense strand is shown in SEQ ID NO: 243, and the sequence of the antisense strand is shown in SEQ ID NO: 353;

[0174] 23) the sequence of the sense strand is shown in SEQ ID NO: 244, and the sequence of the antisense strand is shown in SEQ ID NO: 354;

[0175] 24) the sequence of the sense strand is shown in SEQ ID NO: 245, and the sequence of the antisense strand is shown in SEQ ID NO: 355;

[0176] 25) the sequence of the sense strand is shown in SEQ ID NO: 246, and the sequence of the antisense strand is shown in SEQ ID NO: 356;

[0177] 26) the sequence of the sense strand is shown in SEQ ID NO: 247, and the sequence of the antisense strand is shown in SEQ ID NO: 357;

[0178] 27) the sequence of the sense strand is shown in SEQ ID NO: 248, and the sequence of the antisense strand is shown in SEQ ID NO: 358;

[0179] 28) the sequence of the sense strand is shown in SEQ ID NO: 249, and the sequence of the antisense strand is shown in SEQ ID NO: 359;

[0180] 29) the sequence of the sense strand is shown in SEQ ID NO: 250, and the sequence of the antisense strand is shown in SEQ ID NO: 360;

[0181] 30) the sequence of the sense strand is shown in SEQ ID NO: 251, and the sequence of the antisense strand is shown in SEQ ID NO: 361;

[0182] 31) the sequence of the sense strand is shown in SEQ ID NO: 252, and the sequence of the antisense strand is shown in SEQ ID NO: 362;

[0183] 32) the sequence of the sense strand is shown in SEQ ID NO: 253, and the sequence of the antisense strand is shown in SEQ ID NO: 363;

[0184] 33) the sequence of the sense strand is shown in SEQ ID NO: 254, and the sequence of the antisense strand is shown in SEQ ID NO: 364;

[0185] 34) the sequence of the sense strand is shown in SEQ ID NO: 255, and the sequence of the antisense strand is shown in SEQ ID NO: 365;

[0186] 35) the sequence of the sense strand is shown in SEQ ID NO: 256, and the sequence of the antisense strand is shown in SEQ ID NO: 366;

[0187] 36) the sequence of the sense strand is shown in SEQ ID NO: 257, and the sequence of the antisense strand is shown in SEQ ID NO: 367;

[0188] 37) the sequence of the sense strand is shown in SEQ ID NO: 258, and the sequence of the antisense strand is shown in SEQ ID NO: 368;

[0189] 38) the sequence of the sense strand is shown in SEQ ID NO: 259, and the sequence of the antisense strand is shown in SEQ ID NO: 369;

[0190] 39) the sequence of the sense strand is shown in SEQ ID NO: 260, and the sequence of the antisense strand is shown in SEQ ID NO: 370;

[0191] 40) the sequence of the sense strand is shown in SEQ ID NO: 261, and the sequence of the antisense strand is shown in SEQ ID NO: 371;

[0192] 41) The sequence of the sense strand is shown in SEQ ID NO: 262, and the sequence of the antisense strand is shown in SEQ ID NO: 372;

[0193] 42) the sequence of the sense strand is shown in SEQ ID NO: 263, and the sequence of the antisense strand is shown in SEQ ID NO: 373;

[0194] 43) the sequence of the sense strand is shown in SEQ ID NO: 264, and the sequence of the antisense strand is shown in SEQ ID NO: 374;

[0195] 44) the sequence of the sense strand is shown in SEQ ID NO: 265, and the sequence of the antisense strand is shown in SEQ ID NO: 375;

[0196] 45) the sequence of the sense strand is shown in SEQ ID NO: 266, and the sequence of the antisense strand is shown in SEQ ID NO: 376;

[0197] 46) the sequence of the sense strand is shown in SEQ ID NO: 267, and the sequence of the antisense strand is shown in SEQ ID NO: 377;

[0198] 47) the sequence of the sense strand is shown in SEQ ID NO: 268, and the sequence of the antisense strand is shown in SEQ ID NO: 378;

[0199] 48) the sequence of the sense strand is shown in SEQ ID NO: 269, and the sequence of the antisense strand is shown in SEQ ID NO: 379;

[0200] 49) The sequence of the sense strand is shown in SEQ ID NO: 270, and the sequence of the antisense strand is shown in SEQ ID NO: 380;

[0201] 50) the sequence of the sense strand is shown in SEQ ID NO: 271, and the sequence of the antisense strand is shown in SEQ ID NO: 381;

[0202] 51) The sequence of the sense strand is shown in SEQ ID NO: 272, and the sequence of the antisense strand is shown in SEQ ID NO: 382;

[0203] 52) the sequence of the sense strand is shown in SEQ ID NO: 273, and the sequence of the antisense strand is shown in SEQ ID NO: 383;

[0204] 53) The sequence of the sense strand is shown in SEQ ID NO: 274, and the sequence of the antisense strand is shown in SEQ ID NO: 384;

[0205] 54) the sequence of the sense strand is shown in SEQ ID NO: 275, and the sequence of the antisense strand is shown in SEQ ID NO: 385;

[0206] 55) the sequence of the sense strand is shown in SEQ ID NO: 276, and the sequence of the antisense strand is shown in SEQ ID NO: 386;

[0207] 56) the sequence of the sense strand is shown in SEQ ID NO: 277, and the sequence of the antisense strand is shown in SEQ ID NO: 387;

[0208] 57) the sequence of the sense strand is shown in SEQ ID NO: 278, and the sequence of the antisense strand is shown in SEQ ID NO: 388;

[0209] 58) The sequence of the sense strand is shown in SEQ ID NO: 279, and the sequence of the antisense strand is shown in SEQ ID NO: 389;

[0210] 59) The sequence of the sense strand is shown in SEQ ID NO: 280, and the sequence of the antisense strand is shown in SEQ ID NO: 390;

[0211] 60) The sequence of the sense strand is shown in SEQ ID NO: 281, and the sequence of the antisense strand is shown in SEQ ID NO: 391;

[0212] 61) The sequence of the sense strand is shown in SEQ ID NO: 282, and the sequence of the antisense strand is shown in SEQ ID NO: 392;

[0213] 62) The sequence of the sense strand is shown in SEQ ID NO: 283, and the sequence of the antisense strand is shown in SEQ ID NO: 393;

[0214] 63) The sequence of the sense strand is shown in SEQ ID NO: 284, and the sequence of the antisense strand is shown in SEQ ID NO: 394;

[0215] 64) The sequence of the sense strand is shown in SEQ ID NO: 285, and the sequence of the antisense strand is shown in SEQ ID NO: 395;

[0216] 65) The sequence of the sense strand is shown in SEQ ID NO: 286, and the sequence of the antisense strand is shown in SEQ ID NO: 396;

[0217] 66) The sequence of the sense strand is shown in SEQ ID NO: 287, and the sequence of the antisense strand is shown in SEQ ID NO: 397;

[0218] 67) The sequence of the sense strand is shown in SEQ ID NO: 288, and the sequence of the antisense strand is shown in SEQ ID NO: 398;

[0219] 68) The sequence of the sense strand is shown in SEQ ID NO: 289, and the sequence of the antisense strand is shown in SEQ ID NO: 399;

[0220] 69) The sequence of the sense strand is shown in SEQ ID NO: 290, and the sequence of the antisense strand is shown in SEQ ID NO: 400;

[0221] 70) The sequence of the sense strand is shown in SEQ ID NO: 291, and the sequence of the antisense strand is shown in SEQ ID NO: 401;

[0222] 71) The sequence of the sense strand is shown in SEQ ID NO: 292, and the sequence of the antisense strand is shown in SEQ ID NO: 402;

[0223] 72) The sequence of the sense strand is shown in SEQ ID NO: 293, and the sequence of the antisense strand is shown in SEQ ID NO: 403;

[0224] 73) The sequence of the sense strand is shown in SEQ ID NO: 294, and the sequence of the antisense strand is shown in SEQ ID NO: 404;

[0225] 74) The sequence of the sense strand is shown in SEQ ID NO: 295, and the sequence of the antisense strand is shown in SEQ ID NO: 405;

[0226] 75) The sequence of the sense strand is shown in SEQ ID NO: 296, and the sequence of the antisense strand is shown in SEQ ID NO: 406;

[0227] 76) The sequence of the sense strand is shown in SEQ ID NO: 297, and the sequence of the antisense strand is shown in SEQ ID NO: 407;

[0228] 77) The sequence of the sense strand is shown in SEQ ID NO: 298, and the sequence of the antisense strand is shown in SEQ ID NO: 408;

[0229] 78) The sequence of the sense strand is shown in SEQ ID NO: 299, and the sequence of the antisense strand is shown in SEQ ID NO: 409;

[0230] 79) The sequence of the sense strand is shown in SEQ ID NO: 300, and the sequence of the antisense strand is shown in SEQ ID NO: 410;

[0231] 80) The sequence of the sense strand is shown in SEQ ID NO: 301, and the sequence of the antisense strand is shown in SEQ ID NO: 411;

[0232] 81) The sequence of the sense strand is shown in SEQ ID NO: 302, and the sequence of the antisense strand is shown in SEQ ID NO: 412;

[0233] 82) The sequence of the sense strand is shown in SEQ ID NO: 303, and the sequence of the antisense strand is shown in SEQ ID NO: 413;

[0234] 83) The sequence of the sense strand is shown in SEQ ID NO: 304, and the sequence of the antisense strand is shown in SEQ ID NO: 414;

[0235] 84) The sequence of the sense strand is shown in SEQ ID NO: 305, and the sequence of the antisense strand is shown in SEQ ID NO: 415;

[0236] 85) The sequence of the sense strand is shown in SEQ ID NO: 306, and the sequence of the antisense strand is shown in SEQ ID NO: 416;

[0237] 86) The sequence of the sense strand is shown in SEQ ID NO: 307, and the sequence of the antisense strand is shown in SEQ ID NO: 417;

[0238] 87) The sequence of the sense strand is shown in SEQ ID NO: 308, and the sequence of the antisense strand is shown in SEQ ID NO: 418;

[0239] 88) The sequence of the sense strand is shown in SEQ ID NO: 309, and the sequence of the antisense strand is shown in SEQ ID NO: 419;

[0240] 89) The sequence of the sense strand is shown in SEQ ID NO: 310, and the sequence of the antisense strand is shown in SEQ ID NO: 420;

[0241] 90) The sequence of the sense strand is shown in SEQ ID NO:311, and the sequence of the antisense strand is shown in SEQ ID NO:421;

[0242] 91) The sequence of the sense strand is shown in SEQ ID NO:312, and the sequence of the antisense strand is shown in SEQ ID NO:422;

[0243] 92) The sequence of the sense strand is shown in SEQ ID NO: 313, and the sequence of the antisense strand is shown in SEQ ID NO: 423;

[0244] 93) The sequence of the sense strand is shown in SEQ ID NO: 314, and the sequence of the antisense strand is shown in SEQ ID NO: 424;

[0245] 94) The sequence of the sense strand is shown in SEQ ID NO:315, and the sequence of the antisense strand is shown in SEQ ID NO:425;

[0246] 95) The sequence of the sense strand is shown in SEQ ID NO:316, and the sequence of the antisense strand is shown in SEQ ID NO:426;

[0247] 96) The sequence of the sense strand is shown in SEQ ID NO:317, and the sequence of the antisense strand is shown in SEQ ID NO:427;

[0248] 97) The sequence of the sense strand is shown in SEQ ID NO:318, and the sequence of the antisense strand is shown in SEQ ID NO:428;

[0249] 98) The sequence of the sense strand is shown in SEQ ID NO:319, and the sequence of the antisense strand is shown in SEQ ID NO:429;

[0250] 99) The sequence of the sense strand is shown in SEQ ID NO: 320, and the sequence of the antisense strand is shown in SEQ ID NO: 430;

[0251] 100) The sequence of the sense strand is shown in SEQ ID NO: 321, and the sequence of the antisense strand is shown in SEQ ID NO: 431;

[0252] 101) The sequence of the sense strand is shown in SEQ ID NO:322, and the sequence of the antisense strand is shown in SEQ ID NO:432;

[0253] 102) the sequence of the sense strand is shown in SEQ ID NO:323, and the sequence of the antisense strand is shown in SEQ ID NO:433;

[0254] 103) the sequence of the sense strand is shown in SEQ ID NO: 324, and the sequence of the antisense strand is shown in SEQ ID NO: 434;

[0255] 104) the sequence of the sense strand is shown in SEQ ID NO:325, and the sequence of the antisense strand is shown in SEQ ID NO:435;

[0256] 105) the sequence of the sense strand is shown in SEQ ID NO:326, and the sequence of the antisense strand is shown in SEQ ID NO:436;

[0257] 106) the sequence of the sense strand is shown in SEQ ID NO: 327, and the sequence of the antisense strand is shown in SEQ ID NO: 437;

[0258] 107) The sequence of the sense strand is shown in SEQ ID NO: 328, and the sequence of the antisense strand is shown in SEQ ID NO: 438;

[0259] 108) The sequence of the sense strand is shown in SEQ ID NO: 329, and the sequence of the antisense strand is shown in SEQ ID NO: 439;

[0260] 109) the sequence of the sense strand is shown in SEQ ID NO: 330, and the sequence of the antisense strand is shown in SEQ ID NO: 440; or

[0261] 110) The sequence of the sense strand is shown in SEQ ID NO:331, and the sequence of the antisense strand is shown in SEQ ID NO:441.

[0262] In one aspect, the present invention provides a composition comprising the aforementioned siRNA or siRNA conjugate. In a preferred embodiment, the composition is a pharmaceutical composition, further comprising a pharmaceutically acceptable carrier or excipient. The pharmaceutically acceptable carrier or excipient involved in the present invention includes, but is not limited to, water for injection, sodium hydroxide, sodium dihydrogen phosphate monohydrate, sodium dihydrogen phosphate dihydrate, phosphoric acid, sodium chloride, potassium chloride, hydrochloric acid, anhydrous potassium dihydrogen phosphate, anhydrous disodium hydrogen phosphate, PEG2000, PEG6000, cholesterol, distearoylphosphatidylcholine, 1,2-dimyristyl glyceride, and dimethyl adipate.

[0263] In one aspect, the present invention provides use of the aforementioned siRNA, siRNA conjugate or pharmaceutical composition in the preparation of a drug for preventing and / or treating diseases related to excessive APP.

[0264] In one aspect, the present invention provides a method for preventing or treating diseases related to excessive APP, comprising administering the siRNA, siRNA conjugate or pharmaceutical composition of the present invention to a subject.

[0265] In a specific embodiment, the disease related to excessive APP is selected from cerebral amyloid angiopathy (CAA) and Alzheimer's disease (AD).

[0266] The pharmaceutical composition of the present invention can be used alone to treat cerebral amyloid angiopathy (CAA) and Alzheimer's disease (AD), or can be used in combination with standard oral drugs, providing experimental support for the implementation of diversified treatment plans for clinical patients with the above diseases.

[0267] The siRNA for inhibiting APP gene expression of the present invention is generally in the range of about 0.1 mg / kg to about 10.0 mg / kg, preferably about 0.3 mg / kg to about 3.0 mg / kg.

[0268] The administration routes involved in the present invention include intravenous administration, subcutaneous administration, intrathecal injection, intramuscular administration, subcutaneous administration, transdermal administration, airway administration (aerosol), ocular administration, nasal administration, rectal administration, pulmonary administration and local administration (including buccal administration and sublingual administration).

[0269] The siRNA of the present invention can specifically induce the degradation of APP mRNA, thereby inhibiting the synthesis of APP in the liver, inducing a lasting reduction in APP protein, and reducing the pathological deposition of related toxic proteins such as Aβ, and has a good prospect for drug development. Compared with traditional small molecule drugs and antibody drugs, small nucleic acid drugs can directly regulate upstream gene expression and are relatively less likely to develop drug resistance; and small nucleic acid drugs have a long half-life in the body, so the frequency of administration is low (the drug can be given once every six months), and patient compliance is good. Therefore, the present invention can effectively prevent or treat two diseases, AD and CAA, caused by the pathological deposition of toxic proteins such as Aβ produced by the decomposition of APP protein, and provide more effective, safe and convenient therapeutic drugs for the above patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0270] Figure 1 Schematic diagram of the site where the siRNA of the present invention binds to the human APP gene;

[0271] Figure 2 This is the result of the siRNA conjugate of the present invention inhibiting APP expression in vivo. DETAILED DESCRIPTION

[0272] definition

[0273] In the above and below, unless otherwise specified, capital letters C, G, U, A represent cytosine, guanine, uracil, and adenine nucleotides; lowercase letter m represents that the nucleotide adjacent to the left of the letter m is a methoxy-modified nucleotide; lowercase letter f represents that the nucleotide adjacent to the left of the letter f is a fluorinated-modified nucleotide; lowercase letter s represents that the two nucleotides adjacent to the left and right of the letter s are connected by thiophosphate subunits; the letter combination VP represents that the nucleotide adjacent to the right of the letter combination VP is a vinyl phosphate (5'-(E)-vinylphosphonate, E-VP)-modified nucleotide; L96 has the structure of formula (I) and is connected to the 3' end of the sense chain via a phosphate bond.

[0274] In the above and below, the "fluorinated modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2'-position of the ribose group of the nucleotide is replaced by fluorine, and the "non-fluorinated modified nucleotide" refers to a nucleotide or nucleotide analog in which the hydroxyl group at the 2'-position of the ribose group of the nucleotide is replaced by a non-fluorinated group. "Nucleotide analog" refers to a group that can replace nucleotides in nucleic acids but has a structure different from adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides or thymine deoxyribonucleotides. Such as isonucleotides, bridged nucleic acids (BNA for short) or acyclic nucleotides. The "methoxy-modified nucleotide" refers to a nucleotide in which the 2'-hydroxyl group of the ribose group is replaced by a methoxy group. In the context of this article, the expressions "complementary" or "reverse complementary" can be used interchangeably and have the meanings well known to those skilled in the art, that is, in a double-stranded nucleic acid molecule, the bases of one chain are each paired with the bases on the other chain in a complementary manner. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair consists of a purine and a pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered to be complementary to each other, and the sequence of the strand can be inferred from the sequence of its complementary strand. Accordingly, "mismatch" in the art means that in a double-stranded nucleic acid, the bases at corresponding positions are not paired in a complementary form. In the above and below, unless otherwise specified, "substantially reverse complementary" means that there are no more than 3 base mismatches between the two nucleotide sequences involved; "substantially reverse complementary" means that there are no more than 1 base mismatch between the two nucleotide sequences; "completely reverse complementary" means that there is no base mismatch between the two nucleotide sequences. In the above and below, especially when describing the preparation method of the siRNA, pharmaceutical composition or siRNA conjugate disclosed in the present invention, unless otherwise specified, the nucleoside monomer (nucleoside monomer) refers to the modified or unmodified nucleoside phosphoramidite monomer (unmodified or modified RNA phosphoramidites, sometimes RNA phosphoramidites are also called Nucleoside phosphora-midites) used in phosphoramidite solid phase synthesis according to the type and order of nucleotides in the siRNA or siRNA conjugate to be prepared. Phosphoramidite solid phase synthesis is a method used in siRNA synthesis known to those skilled in the art. The nucleoside monomers used in the present invention are all commercially available.

[0275] In Table 1 and Table 2, if there is no VP on the left side of the 5' terminal nucleotide of the sense strand or the modified sense strand connected to the conjugated group, it means that the 5' terminal nucleotide is not connected to a 5' phosphate group or a 5' phosphate derivative group, and its structure is shown in formula (II):

[0276]

[0277] Wherein, Base represents a base, such as A, U, G, C or T; R is a hydroxyl group or is substituted by various groups known to those skilled in the art, for example, R can be 2'-fluoro (2'-F), 2'-alkoxy, 2'-substituted alkoxy, 2'-alkyl, 2'-substituted alkyl, 2'-amino, 2'-substituted amino, or 2'-deoxynucleotide.

[0278] In Tables 1 and 2, if there is no VP on the left side of the 5' terminal nucleotide of the antisense strand or modified antisense strand, it means that the 5' terminal nucleotide is not connected to a 5' phosphate group or a 5' phosphate derivative group, and its structure is also shown in formula (II).

[0279] In Table 1 and Table 2, the 3' position of the 3' terminal nucleotide of the sense strand, the 3' terminal nucleotide of the antisense strand and the modified antisense strand is a hydroxyl group.

[0280] Example 1. siRNA design and synthesis

[0281] 1.1 siRNA design

[0282]

[0283] TCCAAAACAATTTTCTGCAGGATGATTGTACAGAATCATTGCTTATGACATGATCGCTT

[0284] TCTACACTGTATTACATAAATAAATTAAATAAAATAACCCCGGGCAAGACTTTTCTTTG

[0285] AAGGATGACTACAGACATTAAATAATCGAAGTAATTTTGGGTGGGGAGAAGAGGCAG

[0286] ATTCAATTTTCTTTAACCAGTCTGAAGTTTCATTTATGATACAAAAGAAGATGAAAATG

[0287] GAAGTGGCAATATAAGGGGATGAGGAAGGCATGCCTGGACAAACCCTTCTTTTAAGAT

[0288] GTGTCTTCAATTTGTATAAAATGGTGTTTTCATGTAAATAAATACATTCTTGGAGGAGCA(SEQ IDNO:1)

[0289] 1.2 siRNA sequence synthesis

[0290] siRNAs, including negative control siRNA (siCtrl), were synthesized according to standard oligonucleotide solid phase synthesis protocols.

[0291] Oligonucleotide solid phase synthesis scheme: Use commercially available 5'-DMT-2'-TBDMS-rU phosphoramidite monomer, 5'-DMT-2'-TBDMS-rA (Bz) phosphoramidite monomer, 5'-DMT-2'-TBDMS-rC (Ac) phosphoramidite monomer, 5'-DMT-2'-TBDMS-rG (iBu) phosphoramidite monomer. RNA was synthesized at a scale of 500 nmol. The phosphoramidite solution was prepared at a concentration of 50 mM, and 0.3 M benzylthiotetrazolium (BTT) acetonitrile solution was used as an activator. During the synthesis, 0.1 M oxidizing agent (pyridine: THF: water = 20: 78: 2) was used to convert trivalent phosphorus into a pentavalent phosphorus-stabilized phosphate backbone. After the synthesis was completed, the sequence was aminolyzed from the solid phase support and precipitated. The 2'O-tert-butyldimethylsilyl protecting group of 2' was removed with triethylamine trihydrofluoric acid.

[0292] For the RNA sequence that has been synthesized, use ammonia water: methylamine = 1:1 aminolysis solution for 40 minutes at 55°C. After the aminolysis is completed, remove the solid phase carrier CPG powder and take the supernatant to dryness. Add a protective group removal agent, react at 60°C for 2 hours, add n-butanol at a ratio of 1:5, stand at -20°C for 30 minutes, and centrifuge to obtain a precipitate. Add RNase-free water to dissolve and purify with reverse phase chromatography (0.1M triethylamine acetic acid (TEAA) and acetonitrile). The purified sample is ultrafiltered and desalted with PBS. Annealing is performed to obtain siRNA, and the obtained siRNA is verified. The results show that the target siRNA was successfully prepared.

[0293] 1.3 siRNA sequence modification and conjugate synthesis

[0294] The modified siRNA is synthesized according to the oligonucleotide solid phase synthesis scheme. The modified nucleotide group can be introduced into the siRNA of the present disclosure by using a nucleoside monomer with a corresponding modification. The method for preparing a nucleoside monomer with a corresponding modification is also well known to those skilled in the art. The siRNA conjugate is synthesized by conjugating L96 to siRNA with reference to the synthesis method disclosed in WO2014025805A1 or WO2017015109A1.

[0295] The structure of the conjugated group L96 is shown below:

[0296]

[0297] Annealing of oligoribonucleotides to produce siRNA conjugates: anneal the RNA oligomers to be annealed with sterile RNaseFree HO. 2 O (without RNA hydrolase) is prepared into a 200 μM solution. The annealing reaction system is set up as follows: the above solution with a total volume of 100 μL (duplex concentration is 10 nmol) is placed in a 95°C water bath for 10 minutes (≥100 nmol requires high temperature for 20 minutes) → quickly placed in a 60°C water bath to cool naturally → the solution after annealing is stored at 4°C. The complementary chains are mixed by combining equimolar RNA solutions. After identification, the siRNA molecule is correctly constructed. The siRNA solution is prepared into a dry powder for standby use.

[0298] The sequences of the synthesized siRNA molecules are shown in Table 1. The sites that bind to the human APP gene are as follows: Figure 1 As shown:

[0299] Table 1. List of siRNA sequences targeting APP

[0300]

[0301]

[0302]

[0303]

[0304] Wherein, A, U, G, C represent adenine, uracil, guanine, and cytosine nucleotides. The sequences of the synthesized siRNA conjugates are shown in Table 2 below:

[0305] Table 2. Sequence list of siRNA conjugates targeting APP

[0306]

[0307]

[0308]

[0309]

[0310]

[0311]

[0312]

[0313] Among them, the lowercase letter m indicates that the nucleotide adjacent to the left of the letter m is a methoxy-modified nucleotide; the lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a fluorinated-modified nucleotide; the lowercase letter s indicates that the two nucleotides adjacent to the left and right of the letter s are connected by thiophosphate subunits; VP indicates that the nucleotide adjacent to the right of the letter combination VP is a vinyl phosphate (5'-(E)-vinylphosphonate, E-VP) modified nucleotide; L96 represents the L96 conjugated group connected to siRNA.

[0314] Example 2. siRNA in vitro activity screening of HCT116 cell line

[0315] 2.1 Experimental procedures

[0316] 2.1.1 Cell culture

[0317] HCT116 cells (BNCC, BNCC287750) were cultured at 37°C, 5% CO 2 The cells were cultured in a complete DMEM medium (Eallbio, supplemented with 10% FBS) and when the confluence rate reached 80%-90%, the cells were trypsinized, counted and transfected.

[0318] 2.1.2 Preparation of siRNA dilution

[0319] (1) The dry powder of the siRNA to be tested is centrifuged at low temperature and high speed, and then dissolved in ultrapure distilled water to prepare a 100 μM siRNA stock solution.

[0320] (2) Prepare 200 nM siRNA diluent Y.

[0321] a) taking 50 μl of the 100 μM siRNA stock solution prepared in step (1) above, adding 50 μl of ultrapure distilled water to obtain a siRNA dilution solution with a final concentration of 50 μM;

[0322] b) taking 2 μl of the 50 μM siRNA dilution prepared in step a), adding 18 μl of ultrapure distilled water to obtain a siRNA stock solution X with a final concentration of 5 μM;

[0323] c) Take 2 μl of the prepared siRNA stock solution X, add 48 μl of Opti-medium (Gibco, 31985070) to obtain 200 nM siRNA dilution solution Y.

[0324] 2.1.3 HCT116 cell transfection

[0325] Pick 0.6 μl of transfection reagent, add 10 μl of Opti-medium, and get Transfection reagent diluent; The transfection reagent diluent and the 200 nM siRNA diluent Y prepared in step 2.1.2 were mixed in a volume ratio of 1:1 to prepare a transfection mixture, which was allowed to stand for 5 minutes. 10 μl of the transfection mixture was added to a 96-well plate, and 90 μl of HCT116 cells cultured in step 2.1.1 were added (final volume 100 μl / well, the number of cells was 20,000 / well, taking siRNA diluent Y as 200 nM as an example, the concentration of siRNA in this system was 10 nM); the above transfection was followed by culture for 24 hours.

[0326] 2.1.4 RNA extraction

[0327] According to the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit product manual, total RNA from HCT116 cells obtained in step 2.1.3 was extracted.

[0328] 2.1.5 Fluorescence quantitative PCR

[0329] The extracted total RNA was reverse transcribed and analyzed by real-time PCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.

[0330] 2.1.6 Result Analysis

[0331] (1) The Ct value was automatically calculated using the software of the 7500 real-time fluorescence quantitative PCR instrument (Thermo Fisher);

[0332] (2) The relative expression of genes was calculated using the following formula:

[0333] ΔCt1=Ct(APP group)–Ct(ACTIN of APP group)

[0334] ΔCt2=Ct(siCtrl group)–Ct(ACTIN of siCtrl group)

[0335] ΔΔCt=ΔCt1 (APP group)-ΔCt2 (siCtrl group), where siCtrl group represents nonspecific siRNA sequence and is the negative control group;

[0336] mRNA expression relative to siCtrl group = 2 -ΔΔCt

[0337] Inhibition rate (%) = (1-mRNA expression relative to the siCtrl group) × 100%.

[0338] 2.2 Experimental Results

[0339] The inhibitory effects of the siRNA of the present invention are shown in Table 3 below:

[0340] Table 3. Results of in vitro screening of siRNA HCT116 cell line

[0341]

[0342]

[0343]

[0344] It can be seen from Table 3 that some siRNAs of the present invention can significantly inhibit the expression of APP gene in HCT116 cells at 10 nM.

[0345] Example 3. In vitro activity screening of siRNA BE(2)-C cell line

[0346] 3.1 Experimental procedures

[0347] 3.1.1 Cell culture

[0348] BE(2)-C cells (BNCC, BNCC247047) were cultured at 37°C, 5% CO 2The cells were cultured in a complete DMEM medium (Eallbio, supplemented with 10% FBS) and when the confluence rate reached 80%-90%, the cells were trypsinized, counted and transfected.

[0349] 3.1.2 Preparation of siRNA dilution

[0350] (1) The dry powder of the siRNA to be tested is centrifuged at low temperature and high speed, and then dissolved in ultrapure distilled water to prepare a 100 μM siRNA stock solution.

[0351] (2) Prepare 200 nM siRNA diluent Y.

[0352] a) taking 50 μl of the 100 μM siRNA stock solution prepared in step (1) above, adding 50 μl of ultrapure distilled water to obtain a siRNA dilution solution with a final concentration of 50 μM;

[0353] b) taking 2 μl of the 50 μM siRNA dilution prepared in step a), adding 18 μl of ultrapure distilled water to obtain a siRNA stock solution X with a final concentration of 5 μM;

[0354] c) Take 2 μl of the prepared siRNA stock solution X and add 48 μl of Opti-medium to obtain 200 nM siRNA dilution solution Y.

[0355] 3.1.3BE(2)-C cell transfection

[0356] Pick 0.6 μl of transfection reagent, add 10 μl of Opti-medium, and get Transfection reagent diluent; The transfection reagent diluent and the 200 nM siRNA diluent Y prepared in step 3.1.2 were mixed in a volume ratio of 1:1 to prepare a transfection mixture, which was allowed to stand for 5 minutes. 10 μl of the transfection mixture was added to a 96-well plate, and 90 μl of the BE(2)-C cells cultured in step 3.1.1 were added (final volume 100 μl / well, the number of cells was 20,000 / well, and the concentration of siRNA in this system was 10 nM); the cells were cultured for 24 hours after the above transfection.

[0357] 3.1.4 RNA extraction

[0358] According to the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit product manual, total RNA from the BE(2)-C cells obtained in step 3.1.3 was extracted.

[0359] 3.1.5 Fluorescence quantitative PCR

[0360] The extracted total RNA was reverse transcribed and analyzed by real-time PCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.

[0361] 3.1.6 Result Analysis

[0362] (1) The Ct value was automatically calculated using the software of the 7500 real-time fluorescence quantitative PCR instrument (ThermoFisher);

[0363] (2) The relative expression of genes was calculated using the following formula:

[0364] ΔCt1=Ct(APP group)–Ct(ACTIN of APP group)

[0365] ΔCt2=Ct(siCtrl group)–Ct(ACTIN of siCtrl group)

[0366] ΔΔCt=ΔCt1 (APP group)-ΔCt2 (siCtrl group), where siCtrl group represents nonspecific siRNA sequence and is the negative control group;

[0367] mRNA expression relative to siCtrl group = 2 -ΔΔCt

[0368] Inhibition rate (%) = (1-mRNA expression relative to the siCtrl group) × 100%.

[0369] 3.2 Experimental Results

[0370] The inhibitory effects of the siRNA of the present invention are shown in Table 4 below:

[0371] Table 4. Results of in vitro screening of siRNA BE(2)-C cell line

[0372]

[0373]

[0374]

[0375]

[0376] As can be seen from Table 4, some siRNAs of the present invention can significantly inhibit the expression of APP gene in BE(2)-C cells at 10 nM. Based on the in vitro screening results of Examples 2 and 3, the high-efficiency activity intervals for inhibiting APP mRNA were determined to be positions 334-804, 2305-2327, and 2813-2835 calculated according to NCBI refseqID NM_000484.4.

[0377] Example 4. siRNA IC50 determination

[0378] This example investigates the dose-effect relationship between drug dose and biological effect by calculating the half-maximal inhibitory concentration (IC50) of each siRNA, thereby quantitatively reflecting the ability of the drug to cause changes in the index.

[0379] 4.1 According to a method similar to Example 2, IC50 determination of siRNA inhibiting APP gene expression was performed, wherein the concentrations of transfected siRNA were 25nM, 5nM, 1nM, 0.2nM, 0.04nM, 0.008nM, and 0.0016nM, respectively.

[0380] 4.2 Results Analysis

[0381] (1) The Ct value was automatically calculated using the software of the 7500 real-time fluorescence quantitative PCR instrument (Thermo Fisher);

[0382] (2) The relative expression of genes was calculated using the following formula:

[0383] ΔCt1=Ct(APP group)–Ct(ACTIN of APP group)

[0384] ΔCt2=Ct(siCtrl group)–Ct(ACTIN of siCtrl group)

[0385] ΔΔCt=ΔCt1 (APP group)-ΔCt2 (siCtrl group), where siCtrl group represents nonspecific siRNA sequence and is the negative control group;

[0386] mRNA expression relative to siCtrl group = 2 -ΔΔCt

[0387] Inhibition rate (%) = (1-mRNA expression relative to the siCtrl group) × 100%.

[0388] The log value of siRNA concentration was used as the X-axis and the percentage inhibition rate was used as the Y-axis. The analysis software GraphPad

[0389] Prism 8's "log(inhibitor)vs.normalized response--Variable slope" function module was used to fit the dose-effect curve to obtain the IC50 value of each siRNA.

[0390] The fitting formula is: Y = 100 / (1 + 10^((LogIC50-X)×HillSlope))

[0391] Wherein: HillSlope represents the slope of the percentage inhibition rate curve.

[0392] 4.3 Experimental Results

[0393] The IC50 determination results of the siRNA of the present invention are shown in Table 5 below:

[0394] Table 5. siRNA HCT116 cell line IC50 determination results

[0395]

[0396]

[0397] As can be seen from Table 5, some siRNAs of the present invention can significantly inhibit APP gene expression.

[0398] Example 5. In vivo activity screening of siRNA conjugates

[0399] According to the in vitro screening results of Examples 2, 3, and 4 above, some siRNA sequences with good in vitro activity were selected, and their conjugates were verified for in vivo activity.

[0400] 5.1 Experimental procedures

[0401] Male mice (C57BL / 6) aged 6-8 weeks were purchased from Sibeifu (Beijing) Biotechnology Co., Ltd., weighing about 20 g. Each mouse was intravenously injected with 1×10 11A recombinant adeno-associated virus 8 (AAV8) vector containing 100 genome copies. The recombinant AAV8 vector is packaged by an AAV8 capsid protein expression plasmid and a transfer plasmid carrying AAV8-hAPP, wherein the transfer plasmid carries the 151-3583 position of the human APP sequence (NM_000484.4), which is controlled by the TBG promoter. The AAV8-hAPP transgenic mouse model was constructed 14 days after injection. The conjugate was then administered subcutaneously at a dose of 3 mg / kg per mouse. The mice were killed on the 7th day (D7) and the 14th day (D14) after administration, with 6 mice in each group, and liver tissue was taken for mRNA expression detection. Total RNA was extracted by Trizol method, mRNA was reverse transcribed using HiScript III RT SuperMix for qPCR (+gDNA wiper) kit (Cat. No.: R323-01, Vazyme), and real-time fluorescence quantitative PCR was performed using ChamQ Universal SYBR qPCR Master Mix kit (Cat. No.: Q711-03, Vazyme). The results of in vivo activity screening of different siRNA conjugates are shown in Table 6 and Figure 2 shown.

[0402] Table 6. Results of in vivo screening of siRNA conjugates

[0403]

[0404] 5.2 Experimental Results

[0405] The chemically modified siRNA sequences had good activity in mice, and YGND22-9M, YGND22-16M, YGND22-17M, YGND22-23M, YGND22-24M, YGND22-28M, YGND22-71M and YGND22-92M could significantly reduce the expression level of APP in mice. On the 14th day, the inhibition efficiency of YGND22-28M was as high as 81.17%, and that of YGND22-16M was 71.21%.

Claims

1. An siRNA for inhibiting APP gene expression, the siRNA comprising a sense strand and an antisense strand, the sense strand comprising a nucleotide sequence I, the antisense strand comprising a nucleotide sequence II; each nucleotide in the nucleotide sequence I and the nucleotide sequence II is a modified or unmodified nucleotide; the nucleotide sequence I and the nucleotide sequence II are at least partially reverse-complemented to form a double-stranded region; the nucleotide sequence I is substantially identical to a first nucleotide sequence, the first nucleotide sequence is a nucleotide sequence of at least 19 nucleotides in length in the mRNA expressed by the APP gene, preferably, the first nucleotide sequence is a nucleotide sequence of 19 to 25 nucleotides in length in the mRNA expressed by the APP gene, such as 19, 20, 21, 22, 23, 24 or 25 nucleotides; wherein, The siRNA is any of the following: 16) the sequence of the sense strand is shown in SEQ ID NO: 17, and the sequence of the antisense strand is shown in SEQ ID NO: 127; 1) The sequence of the sense strand is shown in SEQ ID NO: 2, and the sequence of the antisense strand is shown in SEQ ID NO: 112; 2) the sequence of the sense strand is shown in SEQ ID NO: 3, and the sequence of the antisense strand is shown in SEQ ID NO: 113; 3) the sequence of the sense strand is shown in SEQ ID NO: 4, and the sequence of the antisense strand is shown in SEQ ID NO: 114; 4) the sequence of the sense strand is shown in SEQ ID NO: 5, and the sequence of the antisense strand is shown in SEQ ID NO: 115; 5) the sequence of the sense strand is shown in SEQ ID NO: 6, and the sequence of the antisense strand is shown in SEQ ID NO: 116; 6) the sequence of the sense strand is shown in SEQ ID NO: 7, and the sequence of the antisense strand is shown in SEQ ID NO: 117; 7) The sequence of the sense strand is shown in SEQ ID NO: 8, and the sequence of the antisense strand is shown in SEQ ID NO: 118; 8) the sequence of the sense strand is shown in SEQ ID NO:9, and the sequence of the antisense strand is shown in SEQ ID NO:119; 9) the sequence of the sense strand is shown in SEQ ID NO: 10, and the sequence of the antisense strand is shown in SEQ ID NO: 120; 10) The sequence of the sense strand is shown in SEQ ID NO: 11, and the sequence of the antisense strand is shown in SEQ ID NO: 121; 11) The sequence of the sense strand is shown in SEQ ID NO: 12, and the sequence of the antisense strand is shown in SEQ ID NO: 122; 12) the sequence of the sense strand is shown in SEQ ID NO: 13, and the sequence of the antisense strand is shown in SEQ ID NO: 123; 13) the sequence of the sense strand is shown in SEQ ID NO: 14, and the sequence of the antisense strand is shown in SEQ ID NO: 124; 14) the sequence of the sense strand is shown in SEQ ID NO: 15, and the sequence of the antisense strand is shown in SEQ ID NO: 125; 15) the sequence of the sense strand is shown in SEQ ID NO: 16, and the sequence of the antisense strand is shown in SEQ ID NO: 126; 17) The sequence of the sense strand is shown in SEQ ID NO: 18, and the sequence of the antisense strand is shown in SEQ ID NO: 128; 18) The sequence of the sense strand is shown in SEQ ID NO: 19, and the sequence of the antisense strand is shown in SEQ ID NO: 129; 19) The sequence of the sense strand is shown in SEQ ID NO: 20, and the sequence of the antisense strand is shown in SEQ ID NO: 130; 20) the sequence of the sense strand is shown in SEQ ID NO:21, and the sequence of the antisense strand is shown in SEQ ID NO:131; 21) the sequence of the sense strand is shown in SEQ ID NO: 22, and the sequence of the antisense strand is shown in SEQ ID NO: 132; 22) the sequence of the sense strand is shown in SEQ ID NO: 23, and the sequence of the antisense strand is shown in SEQ ID NO: 133; 23) the sequence of the sense strand is shown in SEQ ID NO: 24, and the sequence of the antisense strand is shown in SEQ ID NO: 134; 24) the sequence of the sense strand is shown in SEQ ID NO: 25, and the sequence of the antisense strand is shown in SEQ ID NO: 135; 25) the sequence of the sense strand is shown in SEQ ID NO: 26, and the sequence of the antisense strand is shown in SEQ ID NO: 136; 26) the sequence of the sense strand is shown in SEQ ID NO: 27, and the sequence of the antisense strand is shown in SEQ ID NO: 137; 27) the sequence of the sense strand is shown in SEQ ID NO: 28, and the sequence of the antisense strand is shown in SEQ ID NO: 138; 29) The sequence of the sense strand is shown in SEQ ID NO:30, and the sequence of the antisense strand is shown in SEQ ID NO:140; 30) the sequence of the sense strand is shown in SEQ ID NO:31, and the sequence of the antisense strand is shown in SEQ ID NO:141; 31) the sequence of the sense strand is shown in SEQ ID NO:32, and the sequence of the antisense strand is shown in SEQ ID NO:142; 32) the sequence of the sense strand is shown in SEQ ID NO:33, and the sequence of the antisense strand is shown in SEQ ID NO:143; 33) the sequence of the sense strand is shown in SEQ ID NO:34, and the sequence of the antisense strand is shown in SEQ ID NO:144; 34) the sequence of the sense strand is shown in SEQ ID NO:35, and the sequence of the antisense strand is shown in SEQ ID NO:145; 35) the sequence of the sense strand is shown in SEQ ID NO:36, and the sequence of the antisense strand is shown in SEQ ID NO:146; 36) the sequence of the sense strand is shown in SEQ ID NO:37, and the sequence of the antisense strand is shown in SEQ ID NO:147; 37) the sequence of the sense strand is shown in SEQ ID NO:38, and the sequence of the antisense strand is shown in SEQ ID NO:148; 38) the sequence of the sense strand is shown in SEQ ID NO:39, and the sequence of the antisense strand is shown in SEQ ID NO:149; 39) The sequence of the sense strand is shown in SEQ ID NO:40, and the sequence of the antisense strand is shown in SEQ ID NO:150; 40) The sequence of the sense strand is shown in SEQ ID NO:41, and the sequence of the antisense strand is shown in SEQ ID NO:151; 41) The sequence of the sense strand is shown in SEQ ID NO:42, and the sequence of the antisense strand is shown in SEQ ID NO:152; 42) the sequence of the sense strand is shown in SEQ ID NO:43, and the sequence of the antisense strand is shown in SEQ ID NO:153; 43) the sequence of the sense strand is shown in SEQ ID NO:44, and the sequence of the antisense strand is shown in SEQ ID NO:154; 44) the sequence of the sense strand is shown in SEQ ID NO:45, and the sequence of the antisense strand is shown in SEQ ID NO:155; 45) the sequence of the sense strand is shown in SEQ ID NO:46, and the sequence of the antisense strand is shown in SEQ ID NO:156; 46) the sequence of the sense strand is shown in SEQ ID NO:47, and the sequence of the antisense strand is shown in SEQ ID NO:157; 47) the sequence of the sense strand is shown in SEQ ID NO:48, and the sequence of the antisense strand is shown in SEQ ID NO:158; 48) The sequence of the sense strand is shown in SEQ ID NO:49, and the sequence of the antisense strand is shown in SEQ ID NO:159; 49) The sequence of the sense strand is shown in SEQ ID NO:50, and the sequence of the antisense strand is shown in SEQ ID NO:160; 50) The sequence of the sense strand is shown in SEQ ID NO:51, and the sequence of the antisense strand is shown in SEQ ID NO:161; 51) The sequence of the sense strand is shown in SEQ ID NO:52, and the sequence of the antisense strand is shown in SEQ ID NO:162; 52) the sequence of the sense strand is shown in SEQ ID NO:53, and the sequence of the antisense strand is shown in SEQ ID NO:163; 53) The sequence of the sense strand is shown in SEQ ID NO:54, and the sequence of the antisense strand is shown in SEQ ID NO:164; 54) the sequence of the sense strand is shown in SEQ ID NO:55, and the sequence of the antisense strand is shown in SEQ ID NO:165; 55) the sequence of the sense strand is shown in SEQ ID NO:56, and the sequence of the antisense strand is shown in SEQ ID NO:166; 56) The sequence of the sense strand is shown in SEQ ID NO:57, and the sequence of the antisense strand is shown in SEQ ID NO:167; 57) The sequence of the sense strand is shown in SEQ ID NO:58, and the sequence of the antisense strand is shown in SEQ ID NO:168; 58) The sequence of the sense strand is shown in SEQ ID NO:59, and the sequence of the antisense strand is shown in SEQ ID NO:169; 59) The sequence of the sense strand is shown in SEQ ID NO:60, and the sequence of the antisense strand is shown in SEQ ID NO:170; 60) The sequence of the sense strand is shown in SEQ ID NO:61, and the sequence of the antisense strand is shown in SEQ ID NO:171; 61) The sequence of the sense strand is shown in SEQ ID NO:62, and the sequence of the antisense strand is shown in SEQ ID NO:172; 62) The sequence of the sense strand is shown in SEQ ID NO:63, and the sequence of the antisense strand is shown in SEQ ID NO:173; 63) The sequence of the sense strand is shown in SEQ ID NO: 64, and the sequence of the antisense strand is shown in SEQ ID NO: 174; 64) The sequence of the sense strand is shown in SEQ ID NO: 65, and the sequence of the antisense strand is shown in SEQ ID NO: 175; 65) The sequence of the sense strand is shown in SEQ ID NO:66, and the sequence of the antisense strand is shown in SEQ ID NO:176; 66) The sequence of the sense strand is shown in SEQ ID NO: 67, and the sequence of the antisense strand is shown in SEQ ID NO: 177; 67) The sequence of the sense strand is shown in SEQ ID NO: 68, and the sequence of the antisense strand is shown in SEQ ID NO: 178; 68) The sequence of the sense strand is shown in SEQ ID NO: 69, and the sequence of the antisense strand is shown in SEQ ID NO: 179; 69) The sequence of the sense strand is shown in SEQ ID NO: 70, and the sequence of the antisense strand is shown in SEQ ID NO: 180; 70) The sequence of the sense strand is shown in SEQ ID NO:71, and the sequence of the antisense strand is shown in SEQ ID NO:181; 71) The sequence of the sense strand is shown in SEQ ID NO:72, and the sequence of the antisense strand is shown in SEQ ID NO:182; 72) The sequence of the sense strand is shown in SEQ ID NO: 73, and the sequence of the antisense strand is shown in SEQ ID NO: 183; 73) The sequence of the sense strand is shown in SEQ ID NO: 74, and the sequence of the antisense strand is shown in SEQ ID NO: 184; 74) The sequence of the sense strand is shown in SEQ ID NO:75, and the sequence of the antisense strand is shown in SEQ ID NO:185; 75) the sequence of the sense strand is shown in SEQ ID NO:76, and the sequence of the antisense strand is shown in SEQ ID NO:186; 76) The sequence of the sense strand is shown in SEQ ID NO: 77, and the sequence of the antisense strand is shown in SEQ ID NO: 187; 77) The sequence of the sense strand is shown in SEQ ID NO: 78, and the sequence of the antisense strand is shown in SEQ ID NO: 188; 78) The sequence of the sense strand is shown in SEQ ID NO: 79, and the sequence of the antisense strand is shown in SEQ ID NO: 189; 79) The sequence of the sense strand is shown in SEQ ID NO:80, and the sequence of the antisense strand is shown in SEQ ID NO:190; 80) The sequence of the sense strand is shown in SEQ ID NO:81, and the sequence of the antisense strand is shown in SEQ ID NO:191; 81) The sequence of the sense strand is shown in SEQ ID NO:82, and the sequence of the antisense strand is shown in SEQ ID NO:192; 82) the sequence of the sense strand is shown in SEQ ID NO:83, and the sequence of the antisense strand is shown in SEQ ID NO:193; 83) The sequence of the sense strand is shown in SEQ ID NO:84, and the sequence of the antisense strand is shown in SEQ ID NO:194; 84) the sequence of the sense strand is shown in SEQ ID NO:85, and the sequence of the antisense strand is shown in SEQ ID NO:195; 85) The sequence of the sense strand is shown in SEQ ID NO:86, and the sequence of the antisense strand is shown in SEQ ID NO:196; 86) The sequence of the sense strand is shown in SEQ ID NO:87, and the sequence of the antisense strand is shown in SEQ ID NO:197; 87) The sequence of the sense strand is shown in SEQ ID NO:88, and the sequence of the antisense strand is shown in SEQ ID NO:198; 88) The sequence of the sense strand is shown in SEQ ID NO:89, and the sequence of the antisense strand is shown in SEQ ID NO:199; 89) The sequence of the sense strand is shown in SEQ ID NO:90, and the sequence of the antisense strand is shown in SEQ ID NO:200; 90) The sequence of the sense strand is shown in SEQ ID NO:91, and the sequence of the antisense strand is shown in SEQ ID NO:201; 91) The sequence of the sense strand is shown in SEQ ID NO:92, and the sequence of the antisense strand is shown in SEQ ID NO:202; 92) The sequence of the sense strand is shown in SEQ ID NO:93, and the sequence of the antisense strand is shown in SEQ ID NO:203; 93) The sequence of the sense strand is shown in SEQ ID NO: 94, and the sequence of the antisense strand is shown in SEQ ID NO: 204; 94) the sequence of the sense strand is shown in SEQ ID NO:95, and the sequence of the antisense strand is shown in SEQ ID NO:205; 95) The sequence of the sense strand is shown in SEQ ID NO:96, and the sequence of the antisense strand is shown in SEQ ID NO:206; 96) The sequence of the sense strand is shown in SEQ ID NO: 97, and the sequence of the antisense strand is shown in SEQ ID NO: 207; 97) The sequence of the sense strand is shown in SEQ ID NO: 98, and the sequence of the antisense strand is shown in SEQ ID NO: 208; 98) The sequence of the sense strand is shown in SEQ ID NO:99, and the sequence of the antisense strand is shown in SEQ ID NO:209; 99) The sequence of the sense strand is shown in SEQ ID NO: 100, and the sequence of the antisense strand is shown in SEQ ID NO: 210; 100) The sequence of the sense strand is shown in SEQ ID NO: 101, and the sequence of the antisense strand is shown in SEQ ID NO: 211; 101) The sequence of the sense strand is shown in SEQ ID NO: 102, and the sequence of the antisense strand is shown in SEQ ID NO: 212; 102) the sequence of the sense strand is shown in SEQ ID NO: 103, and the sequence of the antisense strand is shown in SEQ ID NO: 213; 103) the sequence of the sense strand is shown in SEQ ID NO: 104, and the sequence of the antisense strand is shown in SEQ ID NO: 214; 104) the sequence of the sense strand is shown in SEQ ID NO: 105, and the sequence of the antisense strand is shown in SEQ ID NO: 215; 105) the sequence of the sense strand is shown in SEQ ID NO: 106, and the sequence of the antisense strand is shown in SEQ ID NO: 216; 106) the sequence of the sense strand is shown in SEQ ID NO: 107, and the sequence of the antisense strand is shown in SEQ ID NO: 217; 107) The sequence of the sense strand is shown in SEQ ID NO: 108, and the sequence of the antisense strand is shown in SEQ ID NO: 218; 108) The sequence of the sense strand is shown in SEQ ID NO: 109, and the sequence of the antisense strand is shown in SEQ ID NO: 219; 109) the sequence of the sense strand is shown in SEQ ID NO: 110, and the sequence of the antisense strand is shown in SEQ ID NO: 220; or 110) The sequence of the sense strand is shown in SEQ ID NO:111, and the sequence of the antisense strand is shown in SEQ ID NO:

221.

2. The siRNA according to claim 1, wherein Each nucleotide in the nucleotide sequence I and the nucleotide sequence II is a modified nucleotide, and the modified nucleotide is a fluorinated modified nucleotide or a non-fluorinated modified nucleotide; preferably, the fluorinated modified nucleotide refers to a nucleotide in which the hydroxyl group at the 2'-position of the ribose group of the nucleotide is replaced by fluorine, and has a structure shown in the following formula (1); the non-fluorinated modified nucleotide refers to a nucleotide or a nucleotide analog in which the hydroxyl group at the 2'-position of the ribose group of the nucleotide is replaced by a non-fluorinated group, and has a structure shown in any one of the following formulas (2) to (12): In formula (1) to formula (12), Base represents a base; In formula (9) and formula (10), R is selected from H, OH or alkoxy (O-alkyl); In formula (11) and formula (12), R is selected from H, OH, F or the non-fluorine group.

3. The siRNA according to claim 2, wherein From the 5' end to the 3' end, one or more nucleotides in positions 7, 9, 10, and 11 of the nucleotide sequence I are fluorinated modified nucleotides; and, from the 5' end to the 3' end, one or more nucleotides in positions 2, 6, 8, 9, 13, 14, 15, and 16 of the nucleotide sequence II are fluorinated modified nucleotides.

4. The siRNA according to claim 2 or 3, wherein At least a portion of the phosphate groups in the phosphate-sugar backbone of at least one single strand in the sense strand and the antisense strand of the siRNA is a phosphate group having a modified group, wherein the phosphate group having a modified group is a thiophosphate group formed by replacing at least one oxygen atom in the phosphodiester bond in the phosphate group with a sulfur atom; preferably, the phosphate group having a modified group is a thiophosphate group having a structure as shown in formula (13): Preferably, the phosphorothioate linkage is present in at least one of the following positions: between the 1st and 2nd nucleotides of the sense strand and / or the antisense strand; between the 2nd and 3rd nucleotides of the sense strand and / or the antisense strand; between the 19th and 20th nucleotides of the antisense strand; between the 20th and 21st nucleotides of the antisense strand; between the 21st and 22nd nucleotides of the antisense strand; between the 22nd and 23rd nucleotides of the antisense strand; or any combination thereof; Most preferably, the 5' terminal nucleotide of the antisense strand of the siRNA is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide, as shown in formula (14), formula (15) and formula (16):

5. A siRNA conjugate comprising the siRNA according to any one of claims 2 to 4 and a conjugated group conjugated to the siRNA, wherein: The conjugated group is L96, and the structure is shown in the following formula (I): Preferably, the siRNA conjugate comprises a sense strand and an antisense strand, which are: 16) the sequence of the sense strand is shown in SEQ ID NO: 237, and the sequence of the antisense strand is shown in SEQ ID NO: 347; 1) the sequence of the sense strand is shown in SEQ ID NO: 222, and the sequence of the antisense strand is shown in SEQ ID NO: 332; 2) the sequence of the sense strand is shown in SEQ ID NO: 223, and the sequence of the antisense strand is shown in SEQ ID NO: 333; 3) the sequence of the sense strand is shown in SEQ ID NO: 224, and the sequence of the antisense strand is shown in SEQ ID NO: 334; 4) the sequence of the sense strand is shown in SEQ ID NO: 225, and the sequence of the antisense strand is shown in SEQ ID NO: 335; 5) the sequence of the sense strand is shown in SEQ ID NO: 226, and the sequence of the antisense strand is shown in SEQ ID NO: 336; 6) the sequence of the sense strand is shown in SEQ ID NO: 227, and the sequence of the antisense strand is shown in SEQ ID NO: 337; 7) the sequence of the sense strand is shown in SEQ ID NO: 228, and the sequence of the antisense strand is shown in SEQ ID NO: 338; 8) the sequence of the sense strand is shown in SEQ ID NO: 229, and the sequence of the antisense strand is shown in SEQ ID NO: 339; 9) the sequence of the sense strand is shown in SEQ ID NO: 230, and the sequence of the antisense strand is shown in SEQ ID NO: 340; 10) the sequence of the sense strand is shown in SEQ ID NO: 231, and the sequence of the antisense strand is shown in SEQ ID NO: 341; 11) the sequence of the sense strand is shown in SEQ ID NO: 232, and the sequence of the antisense strand is shown in SEQ ID NO: 342; 12) the sequence of the sense strand is shown in SEQ ID NO: 233, and the sequence of the antisense strand is shown in SEQ ID NO: 343; 13) the sequence of the sense strand is shown in SEQ ID NO: 234, and the sequence of the antisense strand is shown in SEQ ID NO: 344; 14) the sequence of the sense strand is shown in SEQ ID NO: 235, and the sequence of the antisense strand is shown in SEQ ID NO: 345; 15) the sequence of the sense strand is shown in SEQ ID NO: 236, and the sequence of the antisense strand is shown in SEQ ID NO: 346; 17) the sequence of the sense strand is shown in SEQ ID NO: 238, and the sequence of the antisense strand is shown in SEQ ID NO: 348; 18) The sequence of the sense strand is shown in SEQ ID NO: 239, and the sequence of the antisense strand is shown in SEQ ID NO: 349; 19) The sequence of the sense strand is shown in SEQ ID NO: 240, and the sequence of the antisense strand is shown in SEQ ID NO: 350; 20) the sequence of the sense strand is shown in SEQ ID NO: 241, and the sequence of the antisense strand is shown in SEQ ID NO: 351; 21) the sequence of the sense strand is shown in SEQ ID NO: 242, and the sequence of the antisense strand is shown in SEQ ID NO: 352; 22) the sequence of the sense strand is shown in SEQ ID NO: 243, and the sequence of the antisense strand is shown in SEQ ID NO: 353; 23) the sequence of the sense strand is shown in SEQ ID NO: 244, and the sequence of the antisense strand is shown in SEQ ID NO: 354; 24) the sequence of the sense strand is shown in SEQ ID NO: 245, and the sequence of the antisense strand is shown in SEQ ID NO: 355; 25) the sequence of the sense strand is shown in SEQ ID NO: 246, and the sequence of the antisense strand is shown in SEQ ID NO: 356; 26) the sequence of the sense strand is shown in SEQ ID NO: 247, and the sequence of the antisense strand is shown in SEQ ID NO: 357; 27) the sequence of the sense strand is shown in SEQ ID NO: 248, and the sequence of the antisense strand is shown in SEQ ID NO: 358; 29) the sequence of the sense strand is shown in SEQ ID NO: 250, and the sequence of the antisense strand is shown in SEQ ID NO: 360; 30) the sequence of the sense strand is shown in SEQ ID NO: 251, and the sequence of the antisense strand is shown in SEQ ID NO: 361; 31) the sequence of the sense strand is shown in SEQ ID NO: 252, and the sequence of the antisense strand is shown in SEQ ID NO: 362; 32) the sequence of the sense strand is shown in SEQ ID NO: 253, and the sequence of the antisense strand is shown in SEQ ID NO: 363; 33) the sequence of the sense strand is shown in SEQ ID NO: 254, and the sequence of the antisense strand is shown in SEQ ID NO: 364; 34) the sequence of the sense strand is shown in SEQ ID NO: 255, and the sequence of the antisense strand is shown in SEQ ID NO: 365; 35) the sequence of the sense strand is shown in SEQ ID NO: 256, and the sequence of the antisense strand is shown in SEQ ID NO: 366; 36) the sequence of the sense strand is shown in SEQ ID NO: 257, and the sequence of the antisense strand is shown in SEQ ID NO: 367; 37) the sequence of the sense strand is shown in SEQ ID NO: 258, and the sequence of the antisense strand is shown in SEQ ID NO: 368; 38) the sequence of the sense strand is shown in SEQ ID NO: 259, and the sequence of the antisense strand is shown in SEQ ID NO: 369; 39) the sequence of the sense strand is shown in SEQ ID NO: 260, and the sequence of the antisense strand is shown in SEQ ID NO: 370; 40) the sequence of the sense strand is shown in SEQ ID NO: 261, and the sequence of the antisense strand is shown in SEQ ID NO: 371; 41) The sequence of the sense strand is shown in SEQ ID NO: 262, and the sequence of the antisense strand is shown in SEQ ID NO: 372; 42) the sequence of the sense strand is shown in SEQ ID NO: 263, and the sequence of the antisense strand is shown in SEQ ID NO: 373; 43) the sequence of the sense strand is shown in SEQ ID NO: 264, and the sequence of the antisense strand is shown in SEQ ID NO: 374; 44) the sequence of the sense strand is shown in SEQ ID NO: 265, and the sequence of the antisense strand is shown in SEQ ID NO: 375; 45) the sequence of the sense strand is shown in SEQ ID NO: 266, and the sequence of the antisense strand is shown in SEQ ID NO: 376; 46) the sequence of the sense strand is shown in SEQ ID NO: 267, and the sequence of the antisense strand is shown in SEQ ID NO: 377; 47) the sequence of the sense strand is shown in SEQ ID NO: 268, and the sequence of the antisense strand is shown in SEQ ID NO: 378; 48) the sequence of the sense strand is shown in SEQ ID NO: 269, and the sequence of the antisense strand is shown in SEQ ID NO: 379; 49) The sequence of the sense strand is shown in SEQ ID NO: 270, and the sequence of the antisense strand is shown in SEQ ID NO: 380; 50) the sequence of the sense strand is shown in SEQ ID NO: 271, and the sequence of the antisense strand is shown in SEQ ID NO: 381; 51) The sequence of the sense strand is shown in SEQ ID NO: 272, and the sequence of the antisense strand is shown in SEQ ID NO: 382; 52) the sequence of the sense strand is shown in SEQ ID NO: 273, and the sequence of the antisense strand is shown in SEQ ID NO: 383; 53) the sequence of the sense strand is shown in SEQ ID NO: 274, and the sequence of the antisense strand is shown in SEQ ID NO: 384; 54) the sequence of the sense strand is shown in SEQ ID NO: 275, and the sequence of the antisense strand is shown in SEQ ID NO: 385; 55) the sequence of the sense strand is shown in SEQ ID NO: 276, and the sequence of the antisense strand is shown in SEQ ID NO: 386; 56) the sequence of the sense strand is shown in SEQ ID NO: 277, and the sequence of the antisense strand is shown in SEQ ID NO: 387; 57) The sequence of the sense strand is shown in SEQ ID NO: 278, and the sequence of the antisense strand is shown in SEQ ID NO: 388; 58) The sequence of the sense strand is shown in SEQ ID NO: 279, and the sequence of the antisense strand is shown in SEQ ID NO: 389; 59) The sequence of the sense strand is shown in SEQ ID NO: 280, and the sequence of the antisense strand is shown in SEQ ID NO: 390; 60) The sequence of the sense strand is shown in SEQ ID NO: 281, and the sequence of the antisense strand is shown in SEQ ID NO: 391; 61) The sequence of the sense strand is shown in SEQ ID NO: 282, and the sequence of the antisense strand is shown in SEQ ID NO: 392; 62) The sequence of the sense strand is shown in SEQ ID NO: 283, and the sequence of the antisense strand is shown in SEQ ID NO: 393; 63) The sequence of the sense strand is shown in SEQ ID NO: 284, and the sequence of the antisense strand is shown in SEQ ID NO: 394; 64) The sequence of the sense strand is shown in SEQ ID NO: 285, and the sequence of the antisense strand is shown in SEQ ID NO: 395; 65) The sequence of the sense strand is shown in SEQ ID NO: 286, and the sequence of the antisense strand is shown in SEQ ID NO: 396; 66) The sequence of the sense strand is shown in SEQ ID NO: 287, and the sequence of the antisense strand is shown in SEQ ID NO: 397; 67) The sequence of the sense strand is shown in SEQ ID NO: 288, and the sequence of the antisense strand is shown in SEQ ID NO: 398; 68) The sequence of the sense strand is shown in SEQ ID NO: 289, and the sequence of the antisense strand is shown in SEQ ID NO: 399; 69) The sequence of the sense strand is shown in SEQ ID NO: 290, and the sequence of the antisense strand is shown in SEQ ID NO: 400; 70) The sequence of the sense strand is shown in SEQ ID NO: 291, and the sequence of the antisense strand is shown in SEQ ID NO: 401; 71) The sequence of the sense strand is shown in SEQ ID NO: 292, and the sequence of the antisense strand is shown in SEQ ID NO: 402; 72) The sequence of the sense strand is shown in SEQ ID NO: 293, and the sequence of the antisense strand is shown in SEQ ID NO: 403; 73) The sequence of the sense strand is shown in SEQ ID NO: 294, and the sequence of the antisense strand is shown in SEQ ID NO: 404; 74) The sequence of the sense strand is shown in SEQ ID NO: 295, and the sequence of the antisense strand is shown in SEQ ID NO: 405; 75) The sequence of the sense strand is shown in SEQ ID NO: 296, and the sequence of the antisense strand is shown in SEQ ID NO: 406; 76) The sequence of the sense strand is shown in SEQ ID NO: 297, and the sequence of the antisense strand is shown in SEQ ID NO: 407; 77) The sequence of the sense strand is shown in SEQ ID NO: 298, and the sequence of the antisense strand is shown in SEQ ID NO: 408; 78) The sequence of the sense strand is shown in SEQ ID NO: 299, and the sequence of the antisense strand is shown in SEQ ID NO: 409; 79) The sequence of the sense strand is shown in SEQ ID NO: 300, and the sequence of the antisense strand is shown in SEQ ID NO: 410; 80) The sequence of the sense strand is shown in SEQ ID NO: 301, and the sequence of the antisense strand is shown in SEQ ID NO: 411; 81) The sequence of the sense strand is shown in SEQ ID NO: 302, and the sequence of the antisense strand is shown in SEQ ID NO: 412; 82) The sequence of the sense strand is shown in SEQ ID NO: 303, and the sequence of the antisense strand is shown in SEQ ID NO: 413; 83) The sequence of the sense strand is shown in SEQ ID NO: 304, and the sequence of the antisense strand is shown in SEQ ID NO: 414; 84) The sequence of the sense strand is shown in SEQ ID NO: 305, and the sequence of the antisense strand is shown in SEQ ID NO: 415; 85) The sequence of the sense strand is shown in SEQ ID NO: 306, and the sequence of the antisense strand is shown in SEQ ID NO: 416; 86) The sequence of the sense strand is shown in SEQ ID NO: 307, and the sequence of the antisense strand is shown in SEQ ID NO: 417; 87) The sequence of the sense strand is shown in SEQ ID NO: 308, and the sequence of the antisense strand is shown in SEQ ID NO: 418; 88) The sequence of the sense strand is shown in SEQ ID NO: 309, and the sequence of the antisense strand is shown in SEQ ID NO: 419; 89) The sequence of the sense strand is shown in SEQ ID NO: 310, and the sequence of the antisense strand is shown in SEQ ID NO: 420; 90) The sequence of the sense strand is shown in SEQ ID NO:311, and the sequence of the antisense strand is shown in SEQ ID NO:421; 91) The sequence of the sense strand is shown in SEQ ID NO:312, and the sequence of the antisense strand is shown in SEQ ID NO:422; 92) The sequence of the sense strand is shown in SEQ ID NO: 313, and the sequence of the antisense strand is shown in SEQ ID NO: 423; 93) The sequence of the sense strand is shown in SEQ ID NO: 314, and the sequence of the antisense strand is shown in SEQ ID NO: 424; 94) The sequence of the sense strand is shown in SEQ ID NO:315, and the sequence of the antisense strand is shown in SEQ ID NO:425; 95) The sequence of the sense strand is shown in SEQ ID NO:316, and the sequence of the antisense strand is shown in SEQ ID NO:426; 96) The sequence of the sense strand is shown in SEQ ID NO:317, and the sequence of the antisense strand is shown in SEQ ID NO:427; 97) The sequence of the sense strand is shown in SEQ ID NO:318, and the sequence of the antisense strand is shown in SEQ ID NO:428; 98) The sequence of the sense strand is shown in SEQ ID NO:319, and the sequence of the antisense strand is shown in SEQ ID NO:429; 99) The sequence of the sense strand is shown in SEQ ID NO: 320, and the sequence of the antisense strand is shown in SEQ ID NO: 430; 100) The sequence of the sense strand is shown in SEQ ID NO: 321, and the sequence of the antisense strand is shown in SEQ ID NO: 431; 101) The sequence of the sense strand is shown in SEQ ID NO:322, and the sequence of the antisense strand is shown in SEQ ID NO:432; 102) the sequence of the sense strand is shown in SEQ ID NO:323, and the sequence of the antisense strand is shown in SEQ ID NO:433; 103) the sequence of the sense strand is shown in SEQ ID NO: 324, and the sequence of the antisense strand is shown in SEQ ID NO: 434; 104) the sequence of the sense strand is shown in SEQ ID NO:325, and the sequence of the antisense strand is shown in SEQ ID NO:435; 105) the sequence of the sense strand is shown in SEQ ID NO:326, and the sequence of the antisense strand is shown in SEQ ID NO:436; 106) the sequence of the sense strand is shown in SEQ ID NO:327, and the sequence of the antisense strand is shown in SEQ ID NO:437; 107) The sequence of the sense strand is shown in SEQ ID NO: 328, and the sequence of the antisense strand is shown in SEQ ID NO: 438; 108) The sequence of the sense strand is shown in SEQ ID NO: 329, and the sequence of the antisense strand is shown in SEQ ID NO: 439; 109) the sequence of the sense strand is shown in SEQ ID NO: 330, and the sequence of the antisense strand is shown in SEQ ID NO: 440; or 110) The sequence of the sense strand is shown in SEQ ID NO:331, and the sequence of the antisense strand is shown in SEQ ID NO:

441.

6. A composition comprising the siRNA according to any one of claims 1 to 4 or the siRNA conjugate according to claim 5; preferably, the composition is a pharmaceutical composition, further comprising a pharmaceutically acceptable carrier or excipient; further preferably, the carrier or excipient includes but is not limited to water for injection, sodium hydroxide, sodium dihydrogen phosphate monohydrate, sodium dihydrogen phosphate dihydrate, phosphoric acid, sodium chloride, potassium chloride, hydrochloric acid, anhydrous potassium dihydrogen phosphate, anhydrous disodium hydrogen phosphate, PEG2000, PEG6000, cholesterol, distearoylphosphatidylcholine, 1,2-dimyristyl glyceride, and dimethyl adipate.

7. Use of the siRNA according to any one of claims 1 to 4, the siRNA conjugate according to claim 5, or the pharmaceutical composition according to claim 6 in the preparation of a drug for preventing and / or treating diseases related to excessive APP; preferably, the diseases related to excessive APP are selected from cerebral amyloid angiopathy (CAA) and Alzheimer's disease (AD).

Citation Information

Patent Citations

  • Carbohydrate conjugated RNA agents and process for their preparation

    WO2014025805A1

  • Multi-targeted single entity conjugates

    WO2017015109A1

Cited By

  • Small interfering RNA targeting amyloid beta precursor protein (APP) and uses thereof

    WO2026092658A3