Biomarkers, kits and uses for diagnosing cold exposure-induced prolongation of ventricular repolarization

By detecting the expression level of hsa-miR-125b-5p, the diagnostic challenge of prolonged ventricular repolarization caused by cold exposure has been solved, enabling effective identification and assessment of cardiac risks associated with cold exposure and providing an efficient diagnostic and differential diagnostic tool.

CN120099165BActive Publication Date: 2026-04-10SECOND MEDICAL CENT OF CHINESE PLA GENERAL HOSPITAL
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-06
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

Current technology has not yet clarified the specific mechanisms by which cold environments affect cardiac electrical activity, making it difficult to effectively identify and diagnose ventricular repolarization prolongation caused by cold exposure, which increases the risk of malignant arrhythmias.

Method used

Using hsa-miR-125b-5p as a biomarker, the expression level of hsa-miR-125b-5p in plasma was detected by reverse transcription PCR, real-time quantitative PCR, in situ hybridization or high-throughput sequencing platforms. Kits and primers are provided for the diagnosis, screening, treatment and differential diagnosis of ventricular repolarization prolongation caused by cold exposure.

Benefits of technology

hsa-miR-125b-5p exhibits excellent diagnostic efficacy, effectively identifying ventricular repolarization prolongation caused by cold exposure. It possesses good sensitivity and specificity, and can improve ventricular repolarization prolongation by modulating its expression level, providing a basis for assessing cardiac conditions and differentiating diseases in individuals exposed to cold.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099165B_ABST
    Figure CN120099165B_ABST
Patent Text Reader

Abstract

The application discloses a biomarker, a kit and application for diagnosing ventricular repolarization prolongation caused by cold exposure, and comprises one or more of the following applications: A1) application in preparing a product for diagnosing ventricular repolarization prolongation caused by cold exposure; A2) application in preparing a product for screening ventricular repolarization prolongation caused by cold exposure; A3) application in preparing a product for treating ventricular repolarization prolongation caused by cold exposure; A4) application in preparing a product for evaluating ventricular repolarization prolongation caused by cold exposure; A5) application in preparing a product for distinguishing ventricular repolarization prolongation caused by cold exposure from other heart diseases; and the miRNA marker is hsa-miR-125b-5p, and the nucleotide sequence is shown as SEQ ID No. 1. The expression amount of the hsa-miR-125b-5p marker provided by the application in the plasma of a ventricular repolarization prolongation caused by cold exposure group is significantly higher than that of a control group, has good diagnostic efficiency for ventricular repolarization prolongation caused by cold exposure, and indicates that the hsa-miR-125b-5p is a potential biomarker for ventricular repolarization prolongation caused by cold exposure.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a biomarker for diagnosing ventricular repolarization prolongation caused by cold exposure, and also relates to a corresponding kit and application, and belongs to the technical field of medical molecular diagnosis. BACKGROUND

[0002] In recent years, global attention on polar scientific exploration and resource development has been increasing. However, the polar environment is complex and changeable, which is easy to cause stress reaction of the operating personnel and has adverse effects on their physical and mental health. Among them, the threat of cold environment to health is particularly prominent. Long-term work in a low-temperature environment can cause frostbite and damage to multiple systems, and even endanger life safety in severe cases. Related studies have shown that long-term exposure of the human body to a cold environment can increase the burden on the heart and cause damage to the cardiovascular system, which may in turn induce acute cardiovascular events. Therefore, it is crucial to identify individuals with cardiovascular risk among personnel working in a cold environment.

[0003] The heart, as one of the organs with extremely active metabolic activity in the human body, is extremely sensitive to ischemia and hypoxia and is easily damaged in a cold environment. Previous studies have found that cold environment exposure can prolong the repolarization process of the heart. The small disturbance that occurs during ventricular repolarization is considered a potential factor for triggering malignant arrhythmia, which can lead to sudden cardiac death. Although we have recognized this risk, the specific mechanism of the effect of cold exposure on cardiac electrical activity is still unclear. During cold exposure, the molecular homeostasis regulation of myocardial tissue and cells may play a key role. It needs to be clear that cold exposure is a risk factor for prolonging ventricular repolarization.

[0004] The ventricular repolarization process refers to the process of ventricular muscle cells recovering from the resting potential after contraction (depolarization), which corresponds to the T wave on an electrocardiogram. The QT interval is the time from the start of the QRS complex (ventricular depolarization) to the end of the T wave (repolarization is complete), which reflects the total duration of ventricular depolarization and repolarization. The standard for ventricular repolarization prolongation is that the QTc interval (usually calculated using the Bazett formula) after correcting the heart rate is ≤440 ms for males and ≤460 ms for females, and if it exceeds the above value, it is prolonged, and if it is significantly prolonged (e.g., >500 ms), the risk of arrhythmia will increase significantly. Ventricular repolarization prolongation can easily cause malignant arrhythmia, such as torsades de pointes and ventricular fibrillation, which can lead to syncope and even sudden death.

[0005] MicroRNAs (miRNAs) are small RNA molecules produced in nature, which partially complementarily pair with mRNA, and mainly reduce gene expression through inhibition of translation, mRNA splicing, and de-adenylation. With the rapid development of high-throughput sequencing technology, the number of miRNAs discovered shows a sharp growth trend. miRNAs regulate gene expression through complex regulatory networks, and can serve as biomarkers for various diseases, and are closely related to cardiovascular diseases. In the search for sensitive diagnostic markers, miRNAs show great potential, especially for subtle changes in ventricular repolarization caused by cold exposure. SUMMARY

[0006] The primary technical problem to be solved by the present application is to provide an application of a miRNA marker. The biomarker can be used to prepare a product for diagnosing cold exposure-related ventricular repolarization prolongation, to screen people at risk of such changes in electrocardiogram, to serve as a target for treating ventricular repolarization abnormalities caused by cold exposure, to evaluate the heart condition of people exposed to cold, and to distinguish between ventricular repolarization prolongation caused by cold exposure and other heart diseases.

[0007] Another technical problem to be solved by the present application is to provide a kit for detecting a miRNA marker. The kit can be used to diagnose ventricular repolarization prolongation caused by cold exposure, to screen people at risk of such changes in electrocardiogram, to serve as a target for treating ventricular repolarization abnormalities caused by cold exposure, to evaluate the heart condition of people exposed to cold, and to distinguish between ventricular repolarization prolongation caused by cold exposure and other heart diseases.

[0008] Still another technical problem to be solved by the present application is to provide a primer for detecting the above-mentioned miRNA marker.

[0009] To achieve the above technical purposes, the present application adopts the following technical solutions:

[0010] According to a first aspect of an embodiment of the present application, there is provided an application of a substance for detecting a miRNA marker, including one or more of the following applications:

[0011] A1) an application in the preparation of a product for diagnosing ventricular repolarization prolongation caused by cold exposure;

[0012] A2) an application in the preparation of a product for screening ventricular repolarization prolongation caused by cold exposure;

[0013] A3) an application in the preparation of a product for treating ventricular repolarization prolongation caused by cold exposure;

[0014] A4) an application in the preparation of a product for evaluating ventricular repolarization prolongation caused by cold exposure;

[0015] A5) use in the manufacture of a product for differentiating cold exposure-induced ventricular repolarization prolongation from other cardiac diseases;

[0016] The miRNA marker is hsa-miR-125b-5p, and the nucleotide sequence is shown as SEQ ID No. 1.

[0017] The "product" described above is a product for diagnosing cold exposure-induced ventricular repolarization prolongation by detecting the expression level of hsa-miR-125b-5p through reverse transcription PCR, real-time fluorescent quantitative PCR, in situ hybridization, a chip or a high-throughput sequencing platform.

[0018] More preferably, the substance is a reagent for detecting the expression level of hsa-miR-125b-5p, or a reagent specifically recognizing hsa-miR-125b-5p, or a reagent for detecting the content of hsa-miR-125b-5p.

[0019] More preferably, the substance for detecting hsa-miR-125b-5p is a), b) or c) as follows

[0020] a) a primer for detecting or specifically recognizing hsa-miR-125b-5p;

[0021] b) a reagent set containing the a);

[0022] c) a kit containing the a) or the b).

[0023] More preferably, the primer is an upstream primer shown as SEQ ID No. 2 and a downstream primer shown as SEQ ID No. 3.

[0024] According to a second aspect of the embodiments of the present application, a kit for detecting a miRNA marker is provided, and the kit comprises one or more of the following uses:

[0025] A1) use in the manufacture of a product for diagnosing cold exposure-induced ventricular repolarization prolongation;

[0026] A2) use in the manufacture of a product for screening cold exposure-induced ventricular repolarization prolongation;

[0027] A3) use in the manufacture of a product for treating cold exposure-induced ventricular repolarization prolongation;

[0028] A4) use in the manufacture of a product for evaluating cold exposure-induced ventricular repolarization prolongation;

[0029] A5) use in the manufacture of a product for differentiating cold exposure-induced ventricular repolarization prolongation from other cardiac diseases;

[0030] The miRNA marker is hsa-miR-125b-5p, and the nucleotide sequence is shown as SEQ ID No. 1; the kit comprises reagents for detecting or specifically recognizing hsa-miR-125b-5p, or reagents for detecting the expression amount of hsa-miR-125b-5p.

[0031] By using the kit provided by the application, the expression of the characteristic gene sequence hsa-miR-125b-5p shown as SEQ ID No. 1 in the peripheral blood of the subject can be detected, and then according to the information of up-regulation or down-regulation of the gene expression, the probability of ventricular repolarization prolongation of the subject exposed to the cold environment can be determined, so as to realize the diagnosis, screening and condition evaluation of ventricular repolarization prolongation caused by cold exposure.

[0032] The kit provided by the application can comprise appropriate packaging and instructions for use in the method disclosed in the application.

[0033] The kit provided by the application is a nucleic acid detection kit, which comprises reagents required for RNA extraction and real-time fluorescent quantitative PCR. The kit can further comprise appropriate buffers and polymerases. Such a kit also comprises control primers and / or probes.

[0034] Preferably, the reagent for detecting or specifically recognizing hsa-miR-125b-5p is a specific primer, and the specific primer is an upstream primer shown as SEQ ID No. 2 and a downstream primer shown as SEQ ID No. 3.

[0035] According to a third aspect of the embodiments of the application, a primer for detecting a miRNA marker is provided, and the primer comprises one or more of the following applications:

[0036] A1) application in the preparation of a product for diagnosing ventricular repolarization prolongation caused by cold exposure;

[0037] A2) application in the preparation of a product for screening ventricular repolarization prolongation caused by cold exposure;

[0038] A3) application in the preparation of a product for treating ventricular repolarization prolongation caused by cold exposure;

[0039] A4) application in the preparation of a product for evaluating ventricular repolarization prolongation caused by cold exposure;

[0040] A5) application in the preparation of a product for distinguishing ventricular repolarization prolongation caused by cold exposure from other heart diseases;

[0041] The primer is a primer for detecting the expression amount of hsa-miR-125b-5p or specifically recognizing hsa-miR-125b-5p.

[0042] More preferably, the primers are an upstream primer as shown in SEQ ID No. 2 and a downstream primer as shown in SEQ ID No. 3.

[0043] Compared with the prior art, the present application has the following technical effects:

[0044] (1) The hsa-miR-125b-5p provided by the present application can be used as a potential biomarker for ventricular repolarization prolongation caused by cold exposure. In the clinical trial analysis, the expression level of hsa-miR-125b-5p in the plasma sample of the ventricular repolarization prolongation group caused by cold exposure is significantly higher than that of the control group. The ROC curve of the efficiency of hsa-miR-125b-5p in diagnosing ventricular repolarization prolongation caused by cold exposure shows that hsa-miR-125b-5p has excellent sensitivity and specificity, indicating that it has good diagnostic efficiency. In the relationship between the heart rate corrected QT interval (QTc) of the subject and the expression amount of hsa-miR-125b-5p in the plasma, it can be seen that the QTc length is positively correlated with the expression of hsa-miR-125b-5p, which proves that the level of hsa-miR-125b-5p in the plasma can reflect the severity of ventricular repolarization prolongation caused by cold exposure. Hsa-miR-125b-5p can be used for the diagnosis, screening and condition assessment of ventricular repolarization prolongation caused by cold exposure.

[0045] (2) In animal experiments, a cold exposure C57 mouse animal model was constructed, and C57 mice raised in a room temperature environment were used as a control group. It was found that the expression amount of mmu-miR-125b-5p in the plasma of the cold exposure mice was significantly higher than that of the control group. Reducing the level of mmu-miR-125b-5p can significantly improve the ventricular repolarization prolongation caused by exposure to a cold environment, which is the cellular and molecular biological basis for hsa-miR-125b-5p as a biomarker for ventricular repolarization prolongation caused by cold exposure.

[0046] (3) The relationship between hsa-miR-125b-5p and ventricular repolarization prolongation caused by cold exposure is further verified by using clinical data to construct a verification set, and the expression amount of hsa-miR-125b-5p in other ventricular repolarization prolongation groups caused by cardiovascular diseases is compared to distinguish it from other ventricular repolarization prolongation caused by cardiovascular diseases, and to confirm its diagnostic specificity for ventricular repolarization prolongation caused by cold exposure. BRIEF DESCRIPTION OF DRAWINGS

[0047] Figure 1 A volcano plot of the expression difference of miRNA in the plasma of the ventricular repolarization prolongation group caused by cold exposure and the control group obtained by sequencing;

[0048] Figure 2Figure 2. Comparison of hsa-miR-125b-5p levels in plasma between the cold exposure-induced prolonged ventricular repolarization group and the control group by qRT-PCR;

[0049] Figure 3 Figure 3. ROC curve of hsa-miR-125b-5p for diagnosing cold exposure-induced prolonged ventricular repolarization.

[0050] Figure 4 Figure 4. Relationship between QTc and hsa-miR-125b-5p expression in plasma.

[0051] Figure 5 Figure 5. qRT-PCR verification of hsa-miR-125b-5p knockdown by transfection of hsa-miR-125b-5p inhibitor.

[0052] Figure 6 Figure 6. Comparison of QTc levels among the cold exposure-induced prolonged ventricular repolarization group, the control group and the hsa-miR-125b-5p knockdown group in mice.

[0053] Figure 7 Figure 7. Comparison of hsa-miR-125b-5p levels in plasma among the cold exposure-induced prolonged ventricular repolarization group, the control group and other cardiovascular disease-induced prolonged ventricular repolarization group by qRT-PCR in the verification set.

[0054] Figure 8 Figure 8. ROC curve of hsa-miR-125b-5p for diagnosing cold exposure-induced prolonged ventricular repolarization in the verification set. DETAILED DESCRIPTION

[0055] The technical content of the present application will be described in detail below in combination with the drawings and specific examples. These examples are only used to illustrate the present application and are not used to limit the scope of the present application. The experimental methods not specified in the following examples are usually performed according to the conventional conditions or according to the conditions suggested by the manufacturers. Unless otherwise defined, all professional and scientific terms used herein have the same meaning as familiar to those skilled in the art. In addition, any method and material similar or equivalent to those described can be applied in the present application. The preferred implementation methods and materials described herein are only used for demonstration.

[0056] Firstly, the present application uses 60 subjects who have been working in cold regions for a long time, excluding other heart diseases, and after venous blood sampling, uses the Human miRNA Array chip of Arraystar Company to compare and analyze the serum miRNA expression profiles of subjects with and without ventricular repolarization prolongation, and uses R software to analyze the results, screen miRNAs with significant expression difference (Fold Chang≥2.0, P value<0.05), and then uses qRT-PCR (real-time fluorescent quantitative PCR) to determine the content of the top 10 miRNAs in the patient's plasma, and selects the first one with significant increase for subsequent experiments. Then, the inventors further verified the relationship between the expression amount of hsa-miR-125b-5p and ventricular repolarization prolongation caused by cold exposure at the animal level by constructing an animal model. Finally, the clinical data verification set further confirmed that hsa-miR-125b-5p can be used as a biomarker for ventricular repolarization prolongation caused by cold exposure.

[0057] In order to accurately express the degree of cold, the meteorological field formulates a "cold degree rating table". Specifically, the air temperature from -40℃ below to 9.9℃, the temperature from low to high is divided into eight levels: the first level is "extreme cold", below -40℃; the second level is "severe cold", -30℃ to -39.9℃; the third level is "severe cold", -20℃ to -29.9℃; the fourth level is "great cold", -10℃ to -19.9℃; the fifth level is "small cold", -5℃ to -9.9℃; the sixth level is "light cold", 0℃ to -4.9℃; the seventh level is "slight cold", 0℃ to 4.9℃; the eighth level is "cool", 5℃ to 9.9℃. In the context of the present application, "cold" specifically refers to environmental conditions with a temperature lower than -19.9℃, i.e. the upper limit of temperature is the fourth level "great cold".

[0058] Example 1 Screening of miRNA markers of ventricular repolarization prolongation caused by cold exposure and correlation study

[0059] 1. Clinical samples:

[0060] The venous blood of 60 subjects who have been living in Heilongjiang Province Mohe region (north latitude 52-53°, winter up to 8 months, winter average minimum temperature -23℃, historical extreme minimum temperature -53℃) for more than 1 year, long-term outdoor cold environment work, age 20-40 years old, and excluding other heart diseases.

[0061] 2. RNA extraction and qRT-PCR:

[0062] Peripheral blood was collected using EDTA-anticoagulated blood collection tubes. The plasma was centrifuged at 2500g for 15 min, and the supernatant was transferred to a 2ml sterile tube. Total RNA was extracted using an RNA extraction and separation kit (DP419). Following the manufacturer's instructions, 1 ml of TRIZOL reagent and 200 μL of chloroform were added to the plasma, vortexed for 20 s, and allowed to stand at room temperature for 10 min. The mixture was then centrifuged at 13000 rpm and 4°C for 15 min. The supernatant was carefully aspirated, and 800 μL of isopropanol was added. The mixture was gently mixed by inverting the tube and allowed to stand at -20°C for 1 h. The mixture was then centrifuged at 13000 rpm and 4°C for 15 min, and the supernatant was discarded. Then, 1 ml of 75% ethanol was added, and the precipitate was gently washed. After centrifugation at 13000 rpm and 4°C for 5 min, the supernatant was removed, the tube was dried, and an appropriate amount of nuclease-free H2O was added. The RNA was dissolved at 65°C for 10 min, and the OD value and concentration were measured. The RNA was then stored at -80°C for later use.

[0063] Using a reverse transcription kit (RR037A), 500 ng of RNA was reverse transcribed into cDNA. The reaction system was constructed in 20 μL according to the instructions, as shown in Table 1. The reaction program was: 37℃ for 45 min, 85℃ for 5 min, and maintained at 4℃.

[0064]

[0065] Primer sequences for miRNAs were designed. The cDNA obtained from reverse transcription was diluted 1:10 and reacted using a high-specificity qPCR kit (RR820A). Following the manufacturer's instructions, a 20 μL reaction mixture was constructed as shown in Table 2. The reaction program was: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 5 s, 60℃ annealing for 30 s, and 95℃ extension for 15 s, repeated for 40 cycles. The relative levels of miRNAs were quantified using GAPDH protein and expressed as relative ratios.

[0066]

[0067] 3. miRNA sequencing analysis:

[0068] Total RNA was extracted from blood samples of the cold-exposed ventricular repolarization prolongation group and the control group and sent to Guangzhou Epigenetics Co., Ltd. for miRNA sequencing. miRNAs with significantly different expression levels (Fold change ≥ 2.0, P < 0.05) were screened. Figure 1 As shown. Figure 1 This is a volcano plot showing the differential expression of miRNAs in plasma between the cold-exposed ventricular repolarization prolongation group and the control group, obtained through sequencing. As shown in Table 3, the levels of the top 10 miRNAs in the patient's plasma were then determined using qRT-PCR, and the first miRNA with a significantly elevated level was selected for subsequent experiments.

[0069] 4. QTc detection:

[0070] Twelve-lead electrocardiograms were performed in the same quiet position using an electrocardiograph (ECG-2250, Nikon) with an amplitude of 20 mm / mV and a rate of 50 mm / s. Electrocardiogram parameters were measured manually by a professional cardiologist using a vernier caliper and a magnifying glass. The QT interval was defined as the length from the beginning of the QRS complex to the end of the T wave, measured from the best available QRS wave in lead V3. QTc was calculated using Bazett's formula.

[0071] 5. Definition and grouping of ventricular repolarization prolongation:

[0072] Since all the enrolled subjects were male, QTc > 450 ms was defined as ventricular repolarization prolongation. All subjects were divided into a cold exposure-induced ventricular repolarization prolongation group and a control group.

[0073] 6. Statistical analysis:

[0074] t-test and analysis of variance were used for normal variables, and Mann Whitney U test and Kruskal Wallis test were used for non-normal variables. Statistical analysis was performed using R software (v 4.3.2) and GraphPad Prism software (v 8.01). Biological replicates were shown as single data points superimposed on bar graphs. P < 0.05 was considered to be significantly different. Correlation analysis was used to explore the potential relationship between variables, and the Spearman correlation coefficient was used to evaluate the data effect. The diagnostic performance of the marker for the endpoint event was determined using the receiver operating characteristic curve (ROC).

[0075] 7. Analysis results:

[0076] As shown in Figure 2 , the content of hsa-miR-125b-5p in the plasma of the subjects in the cold exposure-induced ventricular repolarization prolongation group was determined by qRT-PCR. The results showed that the content of hsa-miR-125b-5p in the plasma of the subjects in the cold exposure-induced ventricular repolarization prolongation group was significantly higher than that in the plasma of the subjects in the control group, indicating that hsa-miR-125b-5p is a potential biomarker for cold exposure-induced ventricular repolarization prolongation.

[0077] Figure 3 The ROC curve of hsa-miR-125b-5p in the diagnosis of cold exposure-induced ventricular repolarization prolongation is shown in

[0078] Figure 4The relationship between QTc and the expression of hsa-miR-125b-5p in cold exposure subjects is shown; it can be seen from Figure 4 that QTc is positively correlated with the expression of hsa-miR-125b-5p. Since the influence of other heart diseases and other factors is excluded, only the relationship between the increase of hsa-miR-125b-5p caused by cold exposure and the ventricular repolarization extension marker is considered. Therefore, the level of hsa-miR-125b-5p in plasma can reflect the degree of ventricular repolarization extension caused by cold exposure.

[0079] Example 2 Verification of the relationship between the expression amount of hsa-miR-125b-5p and ventricular repolarization prolongation caused by cold exposure by animal modeling Figure 5

[0080] Hsa-miR-125b-5p is miR-125b-5p of human origin, and since miR-125b-5p is highly conserved among species, it is also expressed in mice (mmu-miR-125b-5p), so the mouse model is used to further confirm the relationship between miR-125b-5p and myocardial injury caused by cold exposure.

[0081] 1. Animal modeling:

[0082] 8-week-old C57 mice were provided by Beijing Sbi Bio-technology Co., Ltd. and divided into two groups, one group was raised in a simulated cold environment (-20℃, 6 hours / day) in a temperature-controlled incubator, and the other group was raised in a normal room temperature environment (21℃) as a control group. After two weeks, the mice were euthanized by injection of excess pentobarbital, and blood samples and hearts were taken for subsequent analysis.

[0083] 2. QTc detection:

[0084] The QTc detection of mice was performed using the electrocardio / myoelectric acquisition and analysis system of Yurun Instrument Co., Ltd. to collect data, and the matching analysis software (LabScribe basic software and ECG special analysis module) was used for data analysis. The anesthetized mice, the concentration of the induced anesthetic was 5% isoflurane, and the maintenance concentration was 1%-2%. Oxygen was inhaled through a mask, and the flow rate was 700 ml / min. The rectal temperature was monitored using a thermal sensor and a heat lamp to maintain the rectal temperature of the mice at 37-38℃. The mice were fixed in the supine position on the detection platform and the electrodes were installed, and the signals were recorded for 5-10 minutes to avoid interference from sound and electric waves. The collected signals were analyzed to obtain significant P waves, QRS waves or T waves.

[0085] 3. Knockdown method of miRNA:

[0086] mmu-miR-125b-5p inhibitors were ordered from Shanghai Jikai Gene Medical Technology Co., Ltd. According to the instructions, tail vein injection was used for transfection, and effect detection was performed 24 h after injection.

[0087] 4. Experimental results:

[0088] Figure 6 It is shown that after transfection with mmu-miR-125b-5p inhibitors, the expression level of mmu-miR-125b-5p in mouse plasma is significantly reduced, indicating that the transfection is successful, and the subsequent experiments are completed on this basis.

[0089] Example 3 Further confirmation of the relationship between the expression amount of hsa-miR-125b-5p and ventricular repolarization prolongation caused by cold exposure by using clinical sample data verification set The QTc of the control group, cold exposure group and mmu-miR-125b-5p knockdown group of mice showed that cold environment exposure can cause the expression of mmu-miR-125b-5p to increase, and after knocking down mmu-miR-125b-5p, the QTc significantly decreased. This may be the cellular and molecular biological basis of miR-125b-5p as a biomarker of cold exposure-induced ventricular repolarization prolongation.

[0090] Figure 7 Figure 8

[0091] 1. Clinical samples:

[0092] During the data collection process of the clinical samples, 10 subjects with cold exposure-induced ventricular repolarization prolongation and 10 subjects in the control group (diagnostic criteria refer to the foregoing) were selected to form a verification set, which was used to verify the relationship between the expression of hsa-miR-125b-5p and cold exposure-induced ventricular repolarization prolongation. In addition, 15 patients each with coronary heart disease, heart valve disease and cardiomyopathy and meeting the diagnostic criteria for ventricular repolarization prolongation were selected as a comparison group in order to further analyze and compare the expression of hsa-miR-125b-5p under different disease states, so as to more accurately evaluate its specificity and potential application value in cold exposure-induced ventricular repolarization prolongation.

[0093] 2. Verification results:

[0094] As Example 4 Sequences, primers and kit compositions involved in the present applicationAs shown, the content of hsa-miR-125b-5p in the plasma of the subjects was determined by the method of qRT-PCR (as described above). The results confirmed that the content of hsa-miR-125b-5p in the plasma of the subjects in the ventricular repolarization prolongation group caused by cold exposure was significantly higher than that of the control group, while the content of hsa-miR-125b-5p in the plasma of the subjects in the coronary heart disease, heart valve disease and cardiomyopathy group was not significantly different from that of the control group, further confirming that hsa-miR-125b-5p is an effective biomarker for ventricular repolarization prolongation caused by cold exposure. As ​ As shown, the results of the ROC curve further confirmed that hsa-miR-125b-5p has good diagnostic efficiency for ventricular repolarization prolongation caused by cold exposure.

[0095] The above implementation results show that hsa-miR-125b-5p is significantly related to ventricular repolarization prolongation caused by cold exposure. QTc is positively correlated with the expression amount of hsa-miR-125b-5p; the ROC curve shows that hsa-miR-125b-5p has good diagnostic ability for ventricular repolarization prolongation caused by cold exposure. The expression of mmu-miR-125b-5p in the animal model of cold exposure is up-regulated; animal mmu-miR-125b-5p knockdown significantly reduces QTc. At the same time, the clinical data verification set further confirms the foregoing conclusion.

[0096] In summary, hsa-miR-125b-5p is expected to become a new biomarker and therapeutic target for ventricular repolarization prolongation caused by cold exposure.

[0097]

[0098] The nucleotide sequence of the marker hsa-miR-125b-5p for ventricular repolarization prolongation caused by cold exposure provided by the application is shown in SEQ ID No. 1, which is derived from the miRBase database, and the sequence number is MIMAT0000423.

[0099] SEQ ID No. 1: TCCCTGAGACCCTAACTTGTGA

[0100] The primer pair for specifically recognizing hsa-miR-125b-5p provided by the application includes an upstream primer shown in SEQ ID No. 2 and a downstream primer shown in SEQ ID No. 3:

[0101] SEQ ID No. 2: TCCCTGAGACCCTAACTTGTGA

[0102] SEQ ID No. 3: GTGCAGGGTCCGAGGT

[0103] The kit provided by the present application comprises:

[0104] Prime Script buffer (5x), Prime Script Prime Script reverse transcription enzyme I, Random 6mers, nuclease-free H2O, SYBR Premix Ex Taq II (Tli RNaseH Plus) (2x), PCR primer (F+R) (10 uM), ROX control dye (50x).

Claims

1. Use of a substance for detecting a miRNA marker, characterized in that One or more of the following applications: A1) use in the manufacture of a product for diagnosing cold exposure-induced ventricular repolarization prolongation; A2) use in the manufacture of a product for screening cold exposure-induced ventricular repolarization prolongation; A3) use in the manufacture of a product for evaluating cold exposure-induced ventricular repolarization prolongation; wherein the miRNA marker is hsa-miR-125b-5p, the nucleotide sequence of which is shown in SEQ ID No. 1; and the substance is a reagent for detecting the expression level of hsa-miR-125b-5p.

2. The use according to claim 1, wherein: the product is a product for diagnosing cold exposure-induced ventricular repolarization prolongation by detecting the expression level of hsa-miR-125b-5p through RT-PCR, real-time quantitative PCR, in situ hybridization, a chip or a high-throughput sequencing platform.

3. The use according to claim 1, wherein the substance is a substance for detecting hsa-miR-125b-5p, which is a), b) or c) below a) a primer for detecting or specifically recognizing hsa-miR-125b-5p; b) a reagent set containing the a); c) a kit containing the a) or the b).

Citation Information

Patent Citations

  • MiRNA marker kit for evaluating myocardial injury caused by cold exposure and application of miRNA marker kit

    CN119193585A