A method for detecting W2027C mutation in the ACCase gene of *Echinopsis thunbergii*

Abstract

This invention discloses a method for detecting the W2027C mutation in the ACCase gene of *Echinochloa crus-galli*. This method, based on recombinase-mediated isothermal amplification and CRISPR / Cas12a technology, rapidly detects the W2027C mutation in the acetyl-CoA carboxylase (ACCase) gene in *Echinochloa crus-galli*. The method includes: extracting genomic DNA from a *Echinochloa crus-galli* sample; designing specific RAA primers to amplify the ACCase gene fragment containing the W2027C mutation site; forming a complex with Cas12a protein using specific crRNA designed for the W2027C mutation, and co-incubating the complex with the amplification product and a fluorescent reporter probe; and observing the fluorescence signal at an excitation wavelength of 492 nm to determine the presence of the W2027C mutation in the sample. This method is simple, rapid, efficient, and requires no complex equipment, making it suitable for field resistance monitoring and weed management.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a method for rapid and accurate detection of the Trp-2027-Cys(W2027C) mutation in the ACCase gene of Leptochloa chinensis (L.) Nees based on recombinase-mediated isothermal amplification (RAA) and CRISPR / Cas12a technology, which is suitable for field resistance monitoring and weed management. Background Technology

[0002] Echinochloa crus-galli is one of the most common and difficult-to-control weeds in rice paddies, especially widespread in Asia. This weed has high biomass and high reproductive capacity, allowing it to spread rapidly in the field, competing with rice for sunlight, water, and nutrients, leading to a significant decrease in rice yield. Studies have shown that when the Echinochloa crus-galli density reaches 40-80 plants / m², the yield drops significantly. 2 At times, this can lead to a decrease in rice yield of up to 86%, posing a serious threat to agricultural production and food security.

[0003] In recent years, acetyl-CoA carboxylase (ACCase) inhibitor herbicides have been widely used for the control of *Echinochloa crus-galli* in paddy fields, with cyhalofop-butyl being the most widely used. ACCase is a key enzyme in fatty acid biosynthesis; its inhibition leads to impaired fatty acid synthesis, affecting metabolic function and causing weed death. The long-term and extensive use of ACCase inhibitor herbicides has resulted in significant herbicide resistance evolution in *Echinochloa crus-galli* populations. The main resistance mechanism is target resistance caused by point mutations in the carboxyltransferase (CT) domain of the ACCase gene. At least 12 target resistance mutations have been identified, among which the Trp-2027-Cys (W2027C) mutation is relatively common in *Echinochloa crus-galli*.

[0004] Traditional methods for detecting antibiotic resistance, such as whole-plant bioassays (generally requiring 1-2 months), traditional PCR + sequencing (approximately 3 days), real-time quantitative PCR (approximately 1 day), and pyrosequencing (approximately 1 week), while offering high accuracy, are cumbersome to operate, require sophisticated equipment, and have long testing cycles, making them unsuitable for rapid on-site testing. Therefore, there is an urgent need to develop new, accurate, and rapid detection methods. Summary of the Invention

[0005] The purpose of this invention is to provide a rapid detection method based on RAA and CRISPR / Cas12a technologies, which can accurately determine the W2027C mutation of the ACCase gene in *Echinochloa crus-galli* without the need for complex instruments, thereby providing technical support for field weed resistance monitoring and precision weed control. To achieve the above objective, this invention adopts the following technical solution:

[0006] A method for detecting the W2027C mutation in the ACCase gene of *Echinochloa crus-galli* is proposed, which is based on recombinase-mediated isothermal amplification technology and CRISPR / Cas12a technology to detect the W2027C mutation in the ACCase gene of *Echinochloa crus-galli*.

[0007] Specifically, the following steps are included:

[0008] Step 1: Extract DNA samples from *Euphorbia lathyris*.

[0009] Step 2: Design specific RAA primers and amplify the ACCase gene fragment containing the W2027C mutation site;

[0010] Step 3: Use specific crRNA to bind to Cas12a protein and co-incubate with amplification products and fluorescent reporter probe;

[0011] Step 4: Detect changes in fluorescence signal to determine whether the W2027C mutation exists in the sample.

[0012] Furthermore,

[0013] The RAA primer sequences mentioned in step 2 are as follows:

[0014] F: CAACCGTGAAGGATTGCCTCTGTTCATCCTTTC

[0015] R: GTAGACAAATGCTGGCTGATTATATGTCCTAAG.

[0016] In step 2, the RAA reaction is carried out at 37°C for 10-15 minutes.

[0017] The crRNA nucleotide sequence described in step 3 is as follows:

[0018] 5'-UAAUUUCUACUAAGUGUAGAUUAACUGUAGAGGCUUCUCUGG-3'.

[0019] The fluorescent reporter probe mentioned in step 3 is a single-stranded DNA probe with the sequence 5'-FAM-TTTATTT-BHQ1-3'.

[0020] In step 3, the incubation reaction is carried out at 37°C for 15-20 minutes.

[0021] The fluorescence signal detection method in step 4 is as follows: detect the presence or absence of fluorescence signal at an excitation wavelength of 492nm. If a fluorescence signal is observed, it is determined that the W2027C mutation exists in the sample; if no fluorescence signal appears, it is determined that the W2027C mutation does not exist in the sample.

[0022] This invention is the first to combine recombinase-mediated isothermal amplification (RAA) technology with the CRISPR / Cas12a system for the detection of the Trp-2027-Cys(W2027C) mutation in the *Echinochloa crus-galli* ACCase gene. This approach fully leverages the advantages of both technologies: isothermal amplification enriches the target sequence rapidly, improving detection sensitivity, while Cas12a-mediated specific cleavage effectively reduces interference from non-specific amplification, enhancing detection specificity. The combined application of RAA and CRISPR / Cas12 technologies to detect herbicide resistance target mutations in weeds enables rapid detection of mutation sites in low-concentration DNA samples within 1-2 hours, demonstrating broad prospects for field applications. Attached Figure Description

[0023] Figure 1 These are the electrophoresis results of the RAA amplification products.

[0024] In the figure, S1-S5 are the amplification bands of DNA samples from 5 plants that were confirmed to be susceptible by sequencing, and R1-R5 are the amplification bands of DNA samples from 5 plants that were confirmed to be resistant to the W2027 mutant by sequencing.

[0025] Figure 2 This is the fluorescence detection result of the CRISPR / Cas12a reaction.

[0026] In the figure, S represents the test results of 5 samples that were confirmed as sensitive plants by sequencing, with no fluorescence signal; R represents the test results of 5 samples that were confirmed as W2027C mutant resistant plants by sequencing, with obvious green fluorescence signal. Detailed Implementation

[0027] The following examples are for illustrative purposes only and are not intended to limit the scope of the invention. Unless otherwise specified, all chemical reagents and materials used in the following examples are commercially available. Furthermore, unless otherwise specified, all examples were conducted under standard experimental conditions, such as those described in J. Sambrook et al.'s Molecular Cloning Handbook (New York: Gold Spring Harbor Laboratory Press, 1989).

[0028] Example 1: Sample preparation and DNA extraction

[0029] The rapid DNA extraction kit from Tiangen Biotech Co., Ltd. was used.

[0030] (1) Collect samples of *Euphorbia lathyris* and place them in a 1.5 mL centrifuge tube;

[0031] (2) Add 100 μL of buffer B1 and crush the sample with a pestle;

[0032] (3) Add 100 μL of buffer B2, vortex to mix, and centrifuge at 12000 rpm for 2 min;

[0033] (4) Absorb the supernatant DNA extract.

[0034] Example 2: RAA reaction

[0035] The RAA nucleic acid amplification kit from Jiangsu Qitian Gene Biotechnology Co., Ltd. was used.

[0036] (1) Prepare the following reaction system:

[0037]

[0038] Primer sequences:

[0039] F: CAACCGTGAAGGATTGCCTCTGTTCATCCTTTC

[0040] R: GTAGACAAATGCTGGCTGATTATATGTCCTAAG.

[0041] Add the above reaction system to the lyophilized enzyme powder, mix thoroughly, and then centrifuge briefly.

[0042] (2) Add 5 μL of magnesium acetate I to the cap of the reaction tube, and then add 1 μL of DNA template to the reaction solution. Immediately tighten the cap.

[0043] (3) Mix thoroughly, centrifuge, and react at 37°C for 10-15 minutes to amplify the ACCase gene fragment containing the W2027C mutation site;

[0044] (4) A small amount of the reaction product can be aspirated for 2% agarose gel electrophoresis to detect the RAA amplification effect. See partial sample results below. Figure 1 .

[0045] Example 3: CRISPR / Cas12a reaction

[0046] The reaction was performed using LbCas12a(Cpf1) from New England Biolabs and reaction buffer.

[0047] (1) Configure the following reaction system:

[0048]

[0049] The crRNA nucleotide sequence is as follows:

[0050] 5'-UAAUUUCUACUAAGUGUAGAUUAACUGUAGAGGCUUCUCUGG-3'.

[0051] The fluorescent reporter probe is a single-stranded DNA probe, and its sequence is as follows:

[0052] 5'-FAM-TTTATTT-BHQ1-3'.

[0053] (2) After thorough mixing, react at 37°C for 15-20 minutes to activate the Cas12a complex with the amplification product, which then cleaves the fluorescent probe.

[0054] Example 4: Fluorescence signal detection and result determination

[0055] (1) Observe the fluorescence signal in the reaction system at an excitation wavelength of 492 nm;

[0056] (2) If a significant fluorescence signal is detected, the W2027C mutation is determined to exist in the sample; if no significant fluorescence signal is observed, the mutation is determined to be absent in the sample. See partial sample results below. Figure 2 .

[0057] This invention tested 100 samples. Of these, 72 samples, confirmed by sequencing as susceptible plants, showed no fluorescence signal; the remaining 28 samples, confirmed by sequencing as W2027C mutant resistant plants, showed a clear green fluorescence signal. The accuracy of the detection method in this invention can reach 100%.

[0058] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for detecting the W2027C mutation in the ACCase gene of *Euphorbia lathyris*, characterized in that, The W2027C mutation in the ACCase gene of *Euphorbia lathyris* was detected using recombinase-mediated isothermal amplification and CRISPR / Cas12a technology. The recombinase-mediated isothermal amplification (RAA) technique is described below: F: CAACCGTGAAGGATTGCCTCTGTTCATCCTTTC R: GTAGACAAATGCTGGCTGATTATATGTCCTAAG; The crRNA nucleotide sequence in CRISPR / Cas12a technology is as follows: 5'-UAAUUUCUACUAAGUGUAGAUUAACUGUAGAGGCUUCUCUGG-3'.

2. The method according to claim 1, characterized in that, Includes the following steps: Step 1: Extract DNA samples from *Euphorbia lathyris*. Step 2: Design specific RAA primers and amplify the ACCase gene fragment containing the W2027C mutation site; Step 3: Use specific crRNA to bind to Cas12a protein and co-incubate with amplification products and fluorescent reporter probe; Step 4: Detect changes in fluorescence signal to determine whether the W2027C mutation exists in the sample.

3. The method according to claim 2, characterized in that: In step 2, the RAA reaction is carried out at 37°C for 10-15 minutes.

4. The method according to claim 2, characterized in that: The fluorescent reporter probe mentioned in step 3 is a single-stranded DNA probe with the sequence 5'-FAM-TTTATTT-BHQ1-3'.

5. The method according to claim 2, characterized in that: In step 3, the incubation reaction is carried out at 37°C for 15-20 minutes.

6. The method according to claim 2, characterized in that: The fluorescence signal detection method in step 4 is as follows: detect the presence or absence of fluorescence signal at an excitation wavelength of 492 nm. If a fluorescence signal is observed, it is determined that the W2027C mutation exists in the sample; if no fluorescence signal appears, it is determined that the W2027C mutation does not exist in the sample.

Images