Application of Ras related protein Rab-3B in treatment of neuroblastoma

Abstract

The invention provides application of Ras related protein Rab-3B in treatment of neuroblastoma, and relates to the field of medical diagnosis. The application of the Ras related protein Rab-3B in treating neuroblastoma comprises the following steps: cell culture, which comprises cell recovery, cell passage and cell cryopreservation; cell recovery: starting ventilation equipment of the super-clean bench, and disinfecting the table top of the super-clean bench with 75% alcohol to ensure that the table top is clean and tidy so as to prevent pollution; taking out the centrifugal tube from the high-pressure sterilizer, placing the centrifugal tube on a test tube rack, and marking the name of the cell on the centrifugal tube for identification; 2 ml of preheated culture medium is added into each centrifugal tube, and the centrifugal tube is kept at a proper temperature; a proper protective device is used, and cells needing to be recovered are carefully taken out from the liquid nitrogen tank. The treatment method or medicine developed on the basis of Rab-3B is designed aiming at a specific analysis mechanism and can act on tumor cells more accurately theoretically, damage to normal cells is reduced, and toxic and side effects in the treatment process are reduced.

Description

Technical Field

[0001] The present invention relates to the field of medical diagnosis technologies, and particularly to the application of Ras-related protein Rab-3B in the treatment of neuroblastoma. Background Art

[0002] Childhood neuroblastoma (NB) is one of the most common solid tumors in children, especially in infants. It originates from the neural crest of the sympathetic nervous system and is highly heterogeneous, showing behaviors ranging from spontaneous regression to rapid growth and being difficult to treat. Despite the progress made in the treatment of neuroblastoma, the prognosis of high-risk pediatric patients remains poor. MYCN is located on human chromosome 2 and encodes the n-MYC protein, which is a transcription factor with a basic helix-loop-helix domain and is closely related to cell proliferation, growth, and metabolism. In approximately 20% of neuroblastoma patients, the MYCN gene is amplified, which is a strong adverse prognostic factor. The amplification of MYCN is closely related to the onset and prognosis of neuroblastoma, so it is an ideal target for treatment. However, MYCN is a disordered protein and it is difficult to intervene with traditional small molecule drugs. Disordered proteins lack a stable tertiary structure, and thus their "undruggable" nature poses a great challenge in drug design. Although current research focuses on developing therapeutic strategies that can target MYCN, such as interfering with the binding of MYCN to its co-factors with small molecule drugs, due to the difficulties in directly targeting MYCN itself, researchers have started to look for new druggable therapeutic targets. This may include signal pathways downstream of MYCN, interacting proteins involved in the stability and function of the MYCN protein, or regulators involved in the process of MYCN gene amplification.

[0003] RAB3B is a member of the RAB protein family, which is a class of small GTPases related to the regulation of vesicle transport. These proteins have important functions in processes such as the material transport of cells, vesicle transport, and the fusion with cell membranes. In particular, RAB3B is related to processes such as the release of neurotransmitters and the recycling of vesicles. RAB3B is located in the cytoplasm and the perinuclear region of vesicles and is a monomeric GTPase that can enable GDP-binding activities, thus playing a key role in various metabolic activities such as membrane transport and cell movement. With the continuous in-depth research on RAB3B at home and abroad in recent years, its functions have been continuously explored by many scholars.

[0004] Some studies have found that RAB3B can regulate multiple processes such as synaptic transmission and dopamine uptake. It is highly enriched in synaptic vesicles, assisting in the transport of synaptic vesicles to the synaptic terminal and synaptic transmission. At the same time, RAB3B is active in dopaminergic synapses, playing a role in protecting dopaminergic neurons. Intriguingly, overexpression of RAB3B in vivo DA neurons affects the number, size, and cycle of synaptic vesicles. When the number of synaptic vesicles changes, the ability of synaptic terminals to process and store dopamine also changes accordingly. Currently, it has been found that the interference of RAB3B with dopamine is involved in several neurodegenerative diseases, such as Parkinson's syndrome, etc. The correlation between RAB3B and dopamine may be one of the causes of dopamine dysfunction in patients.

[0005] Moreover, foreign research reports also show that: RAB3B can regulate signal transduction in neuroendocrine cells and upregulate its activity of binding to actin, playing an important role in the cytoskeleton reorganization of cells and cell-cell connections in organisms. When RAB3B is stably expressed in neuroendocrine cells, it can enhance the calcium-dependent secretion of norepinephrine, greatly reorganizing the actin cytoskeleton and redistributing tight junction proteins. RAB3A is similar in structure to RAB3B, but its expression in neuroendocrine cells does not show such an effect, indicating that the expression of RAB3B in neuroendocrine cells is specific. As a member of the RAB family, the diversity of the expression induction pathway of RAB3B, on the one hand, prompts people to explore whether other members of the GTPase also have diverse characteristics, and on the other hand, greatly increases the possibility of GTPase affecting cell signal transduction pathways. RAB3B can also participate in regulating the secretion of pituitary hormones. The process of hormone synthesis and secretion is a complex multi-step process. Although many studies are exploring the potential mechanisms of hormone release, the specific details are still unclear. It has been found that RAB3B shows immunoreactivity in all growth hormone adenomas, clinically non-functional adenomas, as well as prolactin, adrenocorticotropic hormone, and thyroid-stimulating hormone, presumably because RAB3B cooperates with other factors to jointly regulate hormone release.

[0006] Recently, more and more evidence has shown that RAB3B plays an important role in the chemoresistance and metastasis of cancer stem cell-like cells. RAB3B is a small GTP-binding protein involved in autophagy and drug resistance. Although the specific mechanism of action of RAB3B in cancer is largely unknown, we speculate that as a central regulator of vesicle transport, the enhanced expression of RAB3B may be related to the transport of proteins such as breast cancer resistance protein, apolipoprotein E, leptin receptor, latex protein, and tetraspanin 13, which have also been found in urine exosome samples of prostate cancer patients.

[0007] Traditional drug discovery strategies often rely on screening for active molecules from natural products that inhibit disease-related proteins, and this approach has successfully developed a variety of therapeutic drugs. However, this method has its limitations, especially when faced with "stubborn" proteins that are difficult to disrupt structurally or are not easily directly targeted by small molecule drugs. In addition, many natural product inhibitors may not have a high degree of selectivity and may therefore act on multiple proteins, causing side effects and suboptimal efficacy. Although these inhibitors show certain efficacy, they may be limited in clinical applications due to problems such as low bioavailability, high metabolic rate, high toxicity, and possible drug resistance. Based on the above results, those skilled in the art have provided the application of Ras-related protein Rab-3B in the treatment of neuroblastoma to solve the problems raised in the above background art. Summary of the Invention

[0008] (1) Technical problems to be solved

[0009] In view of the deficiencies of the prior art, the present invention provides the application of Ras-related protein Rab-3B in the treatment of neuroblastoma, and solves the problems of poor treatment effect and certain toxic and side effects in the existing treatment of neuroblastoma.

[0010] (2) Technical solutions

[0011] To achieve the above objectives, the present invention is achieved through the following technical solutions: The application of Ras-related protein Rab-3B in the treatment of neuroblastoma includes:

[0012] Cell culture, wherein cell culture includes cell resuscitation, cell passage, and cell cryopreservation;

[0013] Cell Resuscitation: Turn on the ventilation equipment of the laminar flow hood. Disinfect the surface of the laminar flow hood with 75% alcohol to ensure the surface is clean and tidy to prevent contamination. Take out the centrifuge tubes from the autoclave, place them on the test tube rack, and mark the names of the cells on the centrifuge tubes for identification. Add 2 ml of pre-warmed medium to each centrifuge tube to keep it at an appropriate temperature. Use appropriate protective equipment and carefully take out the cells to be resuscitated from the liquid nitrogen tank. Ensure that the operation is kept at a low temperature to prevent cell damage. Quickly put the taken-out cells into a 37°C water bath and gently stir to rapidly thaw the cells. Wipe the outside of the cryopreservation tube with a clean alcohol swab to remove possible contamination. Carefully transfer the thawed cell suspension into the centrifuge tube, trying to avoid the generation of bubbles. Put the centrifuge tube into the centrifuge, set the centrifugation speed to 1000 rmp, and the centrifugation time to 5 minutes. Use a pipette to carefully aspirate the supernatant, taking care not to touch the cell pellet. Add 4 ml of pre-warmed medium to the centrifuge tube and gently pipette or stir to evenly disperse the cells in the medium. Aspirate the resuspended cell suspension into a 6-cm culture dish, label information such as the name of the cells, date, and treatment method. Then, slowly draw an "8" shape in the culture dish with a pipette to evenly distribute the cells. Place the culture dish in a 37°C cell culture incubator and provide appropriate culture conditions. Regularly observe the growth of the cells and check the cell morphology, density, and viability.

[0014] Cell Passage: Disinfect the surface of the laminar flow hood, place the required equipment such as pipettes, close the plexiglass plate, and irradiate with ultraviolet light for 30 minutes. Aspirate and discard the old medium in the culture dish to ensure the cell surface is clean. Add an appropriate amount of PBS, gently shake the culture dish, and wash the cells twice to remove residual medium and impurities. After aspirating and discarding the PBS, add 1 mL of trypsin. Use a pipette to slowly and thoroughly pipette the bottom of the culture dish to completely detach the adherent cells and ensure the cell suspension is uniform. Transfer the cell suspension into a centrifuge tube and centrifuge at a speed of 1000 rmp for 5 minutes using a low-speed normal-temperature centrifuge. Carefully aspirate and discard the supernatant, taking care not to touch the cell pellet. Add 4 mL of medium and gently pipette or stir to evenly disperse the cells in the medium. Aspirate the resuspended cell suspension into a 6-cm culture dish and label the relevant information. Place the culture dish in a 37°C cell culture incubator and provide appropriate culture conditions.

[0015] Cell cryopreservation: Prepare dimethyl sulfoxide, serum and serum-free medium in advance; disinfect the surface of the laminar flow hood, place the required equipment such as pipettes, close the plexiglass plate, and irradiate with ultraviolet light for 30 minutes; when the cell growth fusion reaches about 85% - 90% and the cell state is good under the microscope, proceed to the next step; aspirate and discard the old medium in the culture dish; add an appropriate amount of PBS, gently shake the culture dish, and wash the cells 2 times; after aspirating and discarding the PBS, add 1 mL of trypsin; observe the cell morphology under the microscope. When the cell boundaries are obvious and round, it indicates that the digestion is complete; immediately add 2 mL of medium to terminate the digestion process; use a pipette to slowly and thoroughly pipette the bottom of the culture dish to make the adherent cells completely detached; transfer the cell suspension into a centrifuge tube and centrifuge at a speed of 1000 rmp for 5 minutes using a low-speed normal temperature centrifuge; prepare the cryopreservation solution in the laminar flow hood and mix well; aspirate the supernatant in the centrifuge tube, add the cryopreservation solution, and gently pipette or stir to evenly disperse the cells in the cryopreservation solution; aliquot the cell suspension into cryopreservation tubes and label detailed information such as cell type and cryopreservation time; place the cryopreservation tubes in a cryopreservation box and temporarily store them in an ultra-low temperature refrigerator; the next day, transfer the cryopreservation box into a liquid nitrogen tank for long-term storage;

[0016] Perform Transwell invasion assay, cell scratch assay, CCK-8 cell proliferation-toxicity assay and cell cloning assay on cell culture respectively.

[0017] Preferably, the Transwell invasion assay includes the following steps:

[0018] Matrix gel plating: Take out the Matrigel from the -20°C refrigerator and place it in the 4°C refrigerator overnight for thawing; dilute the Matrigel with the original H-DMEM medium at a ratio of 1:6; aspirate 60 uL of the diluted Matrigel and evenly spread it on the bottom surface of the upper chamber of the Transwell insert; place the Transwell insert with the Matrigel on the bottom surface in a 37°C incubator for 1 hour to polymerize the Matrigel into a gel;

[0019] Prepare cell suspension: Keep the cells in a serum-free culture environment 12 hours in advance to remove the influence of serum on the experimental results; digest the cells, centrifuge to remove the old culture medium after terminating the digestion; wash 1 - 2 times with PBS, and then resuspend the cells with serum-free medium; adjust the cell density to 5×105 / mL;

[0020] Inoculate cells: Aspirate 100 uL of the cell suspension and add it to the Transwell insert, that is, add 5×104 cells to each insert; add 600 uL of medium containing 20% FBS to the lower chamber of the 24-well plate;

[0021] Cell culture: Place the Transwell insert and 24-well plate in an incubator at 37°C for 48 hours;

[0022] Result statistics: Use the direct counting method to count the "adherent" cells that have passed through the membrane; First, carefully aspirate the culture medium in the Transwell insert; Wash twice with PBS immersion, 5 minutes each time; Then, fix the cells with 4% paraformaldehyde fixative for 20 minutes; Next, wash twice with PBS immersion, 5 minutes each time; Stain the cells with 0.1% crystal violet staining solution for 15 minutes; Gently wipe the cells that have not invaded on the upper surface with a cotton swab moistened with PBS; Finally, place the Transwell insert under a 400-fold microscope and randomly select five fields of view to observe and count the cells.

[0023] Preferably, the cell scratch assay includes the following steps:

[0024] Use a marker pen to draw horizontal lines on the bottom surface of the 6-well plate, with a spacing of 0.5 cm between each line and 5 lines drawn in each well, and the horizontal lines need to pass through the well;

[0025] Add approximately 5×105 cells to each well, and the specific number may vary depending on the cell type, and it is advisable to cover the entire well after overnight incubation;

[0026] After waiting for the cells in the well plate to grow full the next day, use a 10 μL pipette tip to scratch perpendicular to the horizontal lines on the bottom surface of the well plate;

[0027] Gently shake the well plate with PBS to rinse the cells 3 times to remove the scratched cells;

[0028] Add DMEM / F12 medium stock solution;

[0029] Place the well plate in a cell culture incubator at 37°C and 5% CO2 for culture;

[0030] At 0, 6, 12, 24, and 48 hours, take pictures and measure the scratch width at fixed positions.

[0031] Preferably, the CCK-8 cell proliferation-cytotoxicity assay includes the following steps:

[0032] Inoculate the cells of the experimental group and the control group into a 96-well plate at a density of 2000 cells per well. For the blank group, do not add cells and only add DMEM / F12 medium; Place all the well plates in a cell culture incubator at 37°C for 24 hours;

[0033] The next day, after the cells are firmly adherent, add different concentrations of Fatostatin to the experimental group according to the serial dilution method, and add H-DMEM medium to the control group and the blank group. Place the well plate back into the cell culture incubator at 37°C and continue to culture for 48 hours;

[0034] After 48 hours, aspirate the original culture medium and add CCK-8 solution with a final concentration of 10% in the form of medium replacement; continue to place the well plate in an incubator at 37°C for 30 minutes;

[0035] After 30 minutes, take out the well plate and use an enzyme-linked immunosorbent assay detector to detect the absorbance value of each well at a wavelength of 450 nm;

[0036] Calculate the cell proliferation inhibition rate (%): Cell proliferation inhibition rate (%) = 1 - [(OD of experimental group - OD of blank group) / (OD of control group - OD of blank group)] × 100%.

[0037] Preferably, the cell cloning experiment includes the following steps:

[0038] Cell culture: Culture the cells to be tested in an appropriate culture medium until the cells reach an appropriate density;

[0039] Cell counting: Count the cultured cells to determine the number of cells to be inoculated;

[0040] Dilute the cell suspension: Dilute the cell suspension to an appropriate concentration, usually 10 to 100 cells per milliliter;

[0041] Inoculate cells: Uniformly inoculate the diluted cell suspension into a culture dish or well plate, and inoculate an appropriate amount of cells into each culture well or each culture dish;

[0042] Culture cells: Place the culture dish or well plate inoculated with cells in an incubator and provide appropriate culture conditions, such as temperature, humidity, and gas environment;

[0043] Observation and counting: During the culture process, regularly observe the culture dish or well plate to determine the growth of the cells; when visible clones are formed by the cells, count the clones;

[0044] Analyze data: Analyze the colony formation ability of the cells based on the number and size of the clones; the colony formation of cells under different conditions or in different treatment groups can be compared.

[0045] Preferably, the cell protein extraction includes the following steps:

[0046] Remove the cell culture medium and wash the cells with PBS. Note that aseptic operation should be maintained during cell culture and scraping to avoid cell contamination;

[0047] Scrape off the cells and centrifuge to collect the cells;

[0048] Cool PBS and lysis buffer and add protease inhibitor to prevent protein degradation;

[0049] Add a specific ratio of lysis buffer, RIPA + 10% SDS + protease inhibitor, to the cell pellet, lyse the cells on ice, and vortex every 10 minutes;

[0050] Use an ultrasonic disruptor to further disrupt the cells. The time and conditions for vortexing and ultrasonic disruption should be appropriate to avoid unnecessary damage to the protein.

[0051] The cell lysate was centrifuged and the supernatant was dispensed into new EP tubes.

[0052] (III) Beneficial effects

[0053] The present invention provides the use of Ras-related protein Rab-3B in treating neuroblastoma, which has the following beneficial effects:

[0054] 1. In the present invention, the previous treatment of neuroblastoma mainly focused on traditional methods and targeted treatment of common signal pathways, while this patent uses the Ras-related protein Rab-3B as a therapeutic target for the first time, opening up a new direction for the treatment of neuroblastoma and is expected to break through the limitations of existing treatment methods.

[0055] 2. In the present invention, traditional treatment methods such as chemotherapy and radiotherapy are often accompanied by serious toxic side effects, which affect the quality of life and long-term health of children. The treatment methods or drugs developed based on Rab-3B are designed for specific analytical mechanisms and can theoretically act more accurately on tumor cells, reduce damage to normal cells, and reduce toxic side effects during treatment.

[0056] 3. In the present invention, by deeply studying the mechanism of action of Rab-3B in the occurrence and development of neuroblastoma, a more targeted treatment strategy can be developed, which will help improve the treatment effect of neuroblastoma, especially for high-risk neuroblastoma patients, and is expected to improve their 5-year survival rate. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 A schematic diagram of experimental data of screening MYCN-related characteristic genes by various machine learning algorithms in the present invention;

[0058] Figure 2 This is a schematic diagram of the single-cell analysis data of RAB3B and neuroblastoma in the present invention;

[0059] Figure 3 This is a schematic diagram of experimental data after RAB3B gene knockdown operation was performed on 7 types of neuroblastoma (NB) cells in the present invention;

[0060] Figure 4 Schematic diagram of bioinformatics analysis of RNA-seq results of knocking down RAB3B in the present invention;

[0061] Figure 5 Schematic diagram of the effects of overexpression and knockdown of Ras-related protein Rab-3B on the viability of different neuroblastoma cell lines and related indicators in the present invention;

[0062] Figure 6 Schematic diagram of the prediction and optimization evaluation of the protein structure of MYCN in the present invention;

[0063] Figure 7 Schematic diagram of the interaction between MYCN and RAB3B by protein-protein docking and molecular dynamics simulation in the present invention;

[0064] Figure 8 Schematic diagram of the interaction between MYCN and RAB3B verified by steered molecular dynamics, umbrella sampling simulation and co-immunoprecipitation in the present invention;

[0065] Figure 9 Schematic diagram of the biological exploration of MYCN-related characteristic neuroblastoma targets in the present invention;

[0066] Figure 10 Schematic diagram of the regulatory mechanism of RAB3B on the treatment of MYCN-amplified neuroblastoma in the present invention;

[0067] Figure 11 Schematic diagram of the protein interaction analysis between RAB3B and MYCN in the present invention. Detailed implementation manners

[0068] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0069] Example 1:

[0070] As Figures 1-11 shown, the embodiments of the present invention provide the application of Ras-related protein Rab-3B in the treatment of neuroblastoma, including:

[0071] Cell culture, where cell culture includes cell resuscitation, cell passage and cell cryopreservation;

[0072] Cell Resuscitation: Turn on the ventilation equipment of the laminar flow hood. Disinfect the laminar flow hood workbench with 75% alcohol to ensure the workbench is clean and tidy to prevent contamination. Take out the centrifuge tubes from the autoclave, place them on the test tube rack, and label the name of the cells on the centrifuge tubes for identification. Add 2 ml of pre-warmed medium to each centrifuge tube and keep it at an appropriate temperature. Using appropriate protective equipment, carefully take out the cells to be resuscitated from the liquid nitrogen tank. Ensure that the low temperature is maintained during the operation to prevent cell damage. Quickly place the taken-out cells into a 37°C water bath and gently stir to rapidly thaw the cells. Wipe the outside of the cryopreservation tube with a clean alcohol swab to remove possible contamination. Carefully transfer the thawed cell suspension into the centrifuge tube, trying to avoid the generation of air bubbles. Place the centrifuge tube into the centrifuge, set the centrifugation speed to 1000 rmp, and the centrifugation time to 5 minutes. Use a pipette to carefully aspirate the supernatant, taking care not to touch the cell pellet. Add 4 ml of pre-warmed medium to the centrifuge tube and gently pipette or stir to evenly disperse the cells in the medium. Aspirate the resuspended cell suspension into a 6-cm culture dish, label information such as the name of the cells, date, and treatment method. Then, slowly draw an "8" shape in the culture dish with a pipette to evenly distribute the cells. Place the culture dish into a 37°C cell culture incubator and provide appropriate culture conditions. Regularly observe the growth of the cells and check the cell morphology, density, and viability.

[0073] Cell Passage: Disinfect the laminar flow hood workbench, place the required equipment such as pipettes, close the plexiglass plate, and irradiate with ultraviolet light for 30 minutes. Aspirate and discard the old medium in the culture dish to ensure the cell surface is clean. Add an appropriate amount of PBS, gently shake the culture dish, and wash the cells 2 times to remove residual medium and impurities. After aspirating and discarding the PBS, add 1 mL of trypsin. Slowly and thoroughly pipette the bottom of the culture dish with a pipette to completely detach the adherent cells and ensure the cell suspension is uniform. Transfer the cell suspension into a centrifuge tube and centrifuge at a speed of 1000 rmp for 5 minutes using a low-speed normal-temperature centrifuge. Carefully aspirate and discard the supernatant, taking care not to touch the cell pellet. Add 4 mL of medium and gently pipette or stir to evenly disperse the cells in the medium. Aspirate the resuspended cell suspension into a 6-cm culture dish and label the relevant information. Place the culture dish into a 37°C cell culture incubator and provide appropriate culture conditions.

[0074] Cell cryopreservation: Prepare dimethyl sulfoxide, serum, and serum-free medium in advance; disinfect the surface of the laminar flow hood, place the required equipment such as pipettes, close the plexiglass plate, and irradiate with ultraviolet light for 30 minutes; when the cell growth fusion reaches about 85% - 90% and the cell state is good under the microscope, proceed to the next step; aspirate and discard the old medium in the culture dish; add an appropriate amount of PBS, gently shake the culture dish, and wash the cells 2 times; after aspirating and discarding the PBS, add 1 mL of trypsin; observe the cell morphology under the microscope. When the cell boundaries are obvious and round, it indicates that the digestion is complete; immediately add 2 mL of medium to terminate the digestion process; use a pipette to slowly and thoroughly pipette the bottom of the culture dish to make the adherent cells completely detached; transfer the cell suspension into a centrifuge tube, and centrifuge at a speed of 1000 rmp for 5 minutes using a low-speed normal temperature centrifuge; prepare the cryopreservation solution in the laminar flow hood and mix well; aspirate the supernatant in the centrifuge tube, add the cryopreservation solution, and gently pipette or stir to evenly disperse the cells in the cryopreservation solution; aliquot the cell suspension into cryopreservation tubes, label detailed information such as cell type and cryopreservation time; place the cryopreservation tubes in a cryopreservation box and temporarily store them in an ultra-low temperature refrigerator; the next day, transfer the cryopreservation box into a liquid nitrogen tank for long-term storage;

[0075] Perform Transwell invasion assay, cell scratch assay, CCK-8 cell proliferation-toxicity assay, and cell cloning assay on cell culture respectively.

[0076] The Transwell invasion assay includes the following steps:

[0077] Matrix gel plating: Take out the Matrigel from the -20°C refrigerator and place it in the 4°C refrigerator overnight to thaw; dilute the Matrigel with the original H-DMEM medium at a ratio of 1:6; aspirate 60 μL of the diluted Matrigel and evenly spread it on the bottom surface of the upper chamber of the Transwell insert; place the Transwell insert with the Matrigel on the bottom in a 37°C incubator for 1 hour to polymerize the Matrigel into a gel;

[0078] Prepare cell suspension: Keep the cells in a serum-free culture environment 12 hours in advance to remove the influence of serum on the experimental results; digest the cells, centrifuge to remove the old culture medium after terminating the digestion; wash with PBS 1 - 2 times, and then resuspend the cells with serum-free medium; adjust the cell density to 5×105 / mL;

[0079] Inoculate cells: Aspirate 100 μL of the cell suspension and add it to the Transwell insert, that is, add 5×104 cells to each insert; add 600 μL of medium containing 20% FBS to the lower chamber of the 24-well plate;

[0080] Cell culture: Place the Transwell chamber and 24-well plate in an incubator at 37°C for 48 hours;

[0081] Result statistics: Use the direct counting method to count the "adherent" cells that have passed through the membrane; First, carefully aspirate the culture medium in the Transwell chamber; Wash it twice with PBS for 5 minutes each time; Then, fix the cells with 4% paraformaldehyde fixative for 20 minutes; Next, wash it twice with PBS for 5 minutes each time; Stain the cells with 0.1% crystal violet staining solution for 15 minutes; Gently wipe the non-invasive cells on the upper surface with a cotton swab moistened with PBS; Finally, place the Transwell chamber under a 400-fold microscope and randomly select five fields of view to observe and count the cells.

[0082] The cell scratch assay includes the following steps:

[0083] Use a marker pen to draw horizontal lines on the bottom surface of the 6-well plate, with a spacing of 0.5 cm between each line and 5 lines drawn in each well, and the horizontal lines need to pass through the well;

[0084] Add approximately 5×105 cells to each well, and the specific number may vary depending on the cell type, and it is advisable to cover the entire well after overnight incubation;

[0085] After waiting for the cells in the well plate to grow full the next day, use a 10 μL pipette tip to scratch perpendicular to the horizontal lines on the bottom surface of the well plate;

[0086] Gently shake the well plate with PBS to wash the cells 3 times to remove the scratched cells;

[0087] Add DMEM / F12 medium stock solution;

[0088] Place the well plate in a cell culture incubator at 37°C and 5% CO2 for culture;

[0089] At 0, 6, 12, 24, and 48 hours, take pictures and measure the scratch width at fixed positions.

[0090] The CCK-8 cell proliferation-cytotoxicity assay includes the following steps:

[0091] Seed the cells of the experimental group and the control group in a 96-well plate at a density of 2000 cells per well. Do not add cells to the blank group and only add DMEM / F12 medium; Place all the well plates in a cell culture incubator at 37°C for 24 hours;

[0092] The next day, after the cells are firmly adhered, add different concentrations of Fatostatin to the experimental group according to the serial dilution method, and add H-DMEM medium to the control group and the blank group. Place the well plate back in the cell culture incubator at 37°C and continue to culture for 48 hours;

[0093] After 48 hours, aspirate the original culture medium and add CCK-8 solution with a final concentration of 10% in the form of medium replacement; continue to place the well plate in an incubator at 37°C and incubate for 30 minutes;

[0094] After 30 minutes, take out the well plate and use an enzyme-linked immunosorbent assay detector to detect the absorbance value of each well at a wavelength of 450 nm;

[0095] Calculate the cell proliferation inhibition rate (%): Cell proliferation inhibition rate (%) = 1 - [(OD of experimental group - OD of blank group) / (OD of control group - OD of blank group)] × 100%.

[0096] The cell cloning experiment includes the following steps:

[0097] Cell culture: Culture the cells to be tested in an appropriate culture medium until the cells reach an appropriate density;

[0098] Cell counting: Count the cultured cells to determine the number of cells to be inoculated;

[0099] Dilute the cell suspension: Dilute the cell suspension to an appropriate concentration, usually 10 to 100 cells per milliliter;

[0100] Inoculate cells: Uniformly inoculate the diluted cell suspension into a culture dish or well plate, and inoculate an appropriate amount of cells into each culture well or each culture dish;

[0101] Culture cells: Place the culture dish or well plate inoculated with cells in an incubator and provide appropriate culture conditions, such as temperature, humidity, and gas environment;

[0102] Observation and counting: During the culture process, regularly observe the culture dish or well plate to determine the growth of the cells; when the cells form visible clones, count the clones;

[0103] Analyze data: Analyze the colony formation ability of the cells based on the number and size of the clones; the colony formation of cells under different conditions or different treatment groups can be compared.

[0104] Cell protein extraction includes the following steps:

[0105] Remove the cell culture medium and wash the cells with PBS. Note that aseptic operation should be maintained during cell culture and scraping to avoid cell contamination;

[0106] Scrape off the cells and centrifuge to collect the cells;

[0107] Cool PBS and lysis buffer, and add protease inhibitors to prevent protein degradation;

[0108] Add a specific proportion of lysis buffer, RIPA + 10% SDS + protease inhibitor, to the cell pellet, and lyse the cells on ice, vortexing once every 10 minutes;

[0109] Use an ultrasonic cell disruptor to further break the cells. The time and conditions of vortexing and ultrasonic disruption should be appropriate to avoid unnecessary damage to the proteins;

[0110] Centrifuge the cell lysate and aliquot the supernatant into new EP tubes.

[0111] Protein quantification by BCA method:

[0112] Ensure that all the reagents and equipment required for the experiment are complete, and prepare the protein samples to be measured; prepare the BCA working solution according to the kit instructions;

[0113] Take a series of standard protein solutions with known concentrations, usually in the range of 0 - 2000 μg / mL. Add different concentrations of standard protein solutions to the microplate, with each concentration repeated at least twice. Operate according to the kit instructions, usually by adding the BCA working solution and incubating for a period of time;

[0114] Dilute the protein samples to be measured to an appropriate concentration range, determined according to the standard curve range. Take an appropriate amount of the diluted sample and add it to the microplate, with each sample repeated at least twice. Follow the same steps as the standard curve, add the BCA working solution and incubate;

[0115] Use a microplate reader or spectrophotometer to measure the absorbance of each microplate well at the specified wavelength, and calculate the concentration of the protein samples to be measured according to the standard curve;

[0116] Analyze the measurement results and calculate the concentration of the protein samples to be measured. Record the experimental data, including the standard curve and the sample measurement results.

[0117] SDS - polyacrylamide gel electrophoresis

[0118] Reagent and material preparation: 30% acrylamide stock solution: 29 g of acrylamide, 1 g of bis - acrylamide, add water to 100 ml, store in a brown bottle at 4°C; 1.5 mol / L Tris - HCl, pH 8.8 buffer: 18.17 g of Tris base, 48 ml of 1 mol / L HCl, add water to 100 ml; 10% SDS solution: 10 g of SDS, add water to 100 ml; 10% ammonium persulfate solution: prepare fresh before use; electrophoresis buffer Tris - glycine buffer: 3 g of Tris base, 14.4 g of glycine, 1 g of SDS, add water to 1 L.

[0119] Gel preparation: Select an appropriate gel concentration according to needs, usually 8% - 12%; prepare the separating gel and stacking gel solutions in proportion, add APS and TEMED, shake well quickly and pour the gel; add a layer of distilled water on the surface of the gel to isolate air and make the gel surface flat.

[0120] Sample treatment: Mix the protein sample with the loading buffer, usually 5X SDS loading buffer, in an appropriate proportion, heat to 95°C - 100°C to denature the protein; after cooling to room temperature, an appropriate amount of bromophenol blue indicator dye can be added.

[0121] Electrophoresis: Place the gel device in the electrophoresis tank, add the electrophoresis buffer, and ensure there are no bubbles in the electrophoresis tank; carefully load the sample into the sample wells of the gel; connect the power supply, set the appropriate voltage and electrophoresis time; generally, start electrophoresis at a lower voltage of 70V, and when the bromophenol blue dye migrates to the interface of the separating gel, increase the voltage to 110V and continue electrophoresis until the bromophenol blue dye migrates to the bottom of the gel.

[0122] Blotting: Wet transfer method:

[0123] Prepare the blotting device: Immerse the gel glass plate in a container filled with blotting buffer for a few minutes to make it fully wet.

[0124] PVDF membrane treatment: Select a PVDF membrane of appropriate size according to the size of the gel; activate the membrane in methanol for 15 seconds to increase the hydrophilicity of the membrane.

[0125] Assemble the blotting sandwich: Place the "sponge - filter paper - gel - PVDF membrane - filter paper - sponge" layer by layer in the order from bottom to top, from negative electrode to positive electrode, and ensure there are no bubbles between each layer.

[0126] Blotting: Place the assembled blotting sandwich into the blotting tank, add an ice box to reduce the high temperature generated during blotting; connect the electrodes, set an appropriate current, usually about 200mA, and the blotting time is generally 1 hour.

[0127] Membrane treatment: After blotting, wash the PVDF membrane with ddH2O to remove residual buffer and impurities; cut off a small corner from the lower right corner of the membrane as a mark; place the washed membrane in PBS containing 5% skim milk powder to block the non - specific binding sites on the membrane; incubate the membrane overnight at 4°C to reduce non - specific protein binding.

[0128] Antibody reaction and color development reaction

[0129] Antibody incubation: Use the primary antibody, 1:100, rabbit polyclonal antibody and GAPDH antibody, 1:200, and incubate overnight at 4°C.

[0130] Washing the membrane: Wash the membrane three times with TBS-T buffer to remove unbound primary antibody.

[0131] Secondary antibody incubation: Incubate the membrane with infrared fluorescence-labeled secondary antibody, AlexaFluor800 or AlexaFluor700, diluted 1:10000 in the dark at room temperature for 1 hour.

[0132] Protein detection: Detect the proteins on the membrane using an Odyssey infrared fluorescence scanning imaging system.

[0133] Total cellular RNA extraction

[0134] Collect the cell culture supernatant and place it in a centrifuge tube. Wash the cells twice with PBS to remove impurities.

[0135] Digest the cells with an appropriate amount of trypsin for 1 - 2 minutes and observe the morphological changes of the cells through an inverted microscope. When the cells change from spindle-shaped to round, immediately terminate the digestion reaction with the culture supernatant.

[0136] Put the collected cell pellet back into the same centrifuge tube, centrifuge for 10 minutes, and then remove the supernatant.

[0137] Transfer the cell pellet to a centrifuge tube containing Trizol reagent at a ratio of 1 mL of Trizol per 10^7 cells; ensure thorough mixing by pipetting the cells repeatedly.

[0138] Transfer the cell mixture to a 1.5 mL RNase-free EP tube, vortex vigorously for 15 seconds, and then let it stand at room temperature for 5 minutes.

[0139] Add chloroform: 0.2 mL of chloroform corresponds to 1 mL of Trizol, and mix well.

[0140] Centrifuge the mixture at 4°C: 13500 rpm / min for 15 minutes to separate the upper aqueous phase.

[0141] Transfer the upper aqueous phase to a new centrifuge tube, then add 0.5 mL of isopropanol to every 1 mL of Trizol solution; let it stand at room temperature for 10 minutes and centrifuge again: 13500 rpm / min for 10 minutes to form the RNA precipitate.

[0142] Discard the supernatant, then add 1 mL of 75% ethanol to the centrifuge tube with the RNA precipitate and gently mix using an oscillator.

[0143] Centrifuge at 4°C at 10600 rpm / min for 5 minutes and carefully discard the supernatant.

[0144] Dry the RNA precipitate at room temperature for 5 - 10 minutes, and then dissolve it in 20 μL of DEPC water.

[0145] Finally, store the RNA at -80 °C to maintain its stability.

[0146] Real-time PCR reaction

[0147] Prepare the reaction system: In a 96-well plate, sequentially add 10 μL of SYBR mixing reagent, 1 μL of forward primer, 1 μL of reverse primer, 1 μL of cDNA, and 7 μL of Nuclease-Free Water.

[0148] Adjust the total volume: Add enough water to the reaction system to make the total volume reach 20 μL.

[0149] Perform the PCR reaction: Perform the PCR reaction according to the set program.

[0150] Detect the PCR product: Generate a melting curve by establishing an internal reference targeting of GAPDH to detect the PCR product.

[0151] RAB3B primers: Forward primer: GGGCATCGACTTCAAGGTGA;

[0152] Reverse primer: CATGGCCCCACGGTAATAGG; Tm: 60 degrees.

[0153] Flow cytometry for cell apoptosis determination

[0154] Prepare experimental equipment and reagents; Flow cytometer: An instrument for detecting cell apoptosis; Cell apoptosis detection reagent: Annexin V dye or other suitable apoptosis detection reagents; Culture medium and buffer: For cell culture and washing steps; Centrifuge tubes and micropipettes: For cell handling and sample preparation.

[0155] Cell culture and treatment; Culture neuroblastoma cells to an appropriate density; According to experimental requirements, cells can be treated with apoptosis-inducing treatment factors.

[0156] Stain with cell apoptosis detection reagent; Mix the cell suspension with an appropriate amount of Annexin V dye and perform the staining operation according to the reagent instructions; Usually, it needs to be incubated in the dark for a period of time to allow the dye to bind to apoptotic cells.

[0157] Flow cytometry detection; Load the stained cell sample onto the flow cytometer, set appropriate parameters and thresholds; Perform flow cytometry detection and record the number and percentage of apoptotic cells.

[0158] Flow cytometry for cell cycle determination

[0159] Preparation of experimental equipment and reagents: Flow cytometer: An instrument used for cell cycle detection; Cell cycle detection reagents: such as propidium iodide dye or other suitable cell cycle detection reagents; Culture medium and buffer: Used for cell culture and washing steps; Centrifuge tubes and micropipettes: Used for cell handling and sample preparation.

[0160] Cell culture and treatment: Culture cells to an appropriate density; According to experimental requirements, synchronization treatment methods can be used to synchronize cells at specific cell cycle stages.

[0161] Staining with cell cycle detection reagents: Mix the cell suspension with an appropriate amount of PI dye and perform the staining operation according to the reagent instructions; Usually, it is necessary to incubate in the dark for a period of time to allow the dye to bind to the cells.

[0162] Flow cytometer detection: Load the stained cell sample onto the flow cytometer, set appropriate parameters and thresholds; Perform flow cytometer detection and record the number and percentage of cells in each cell cycle stage.

[0163] Synthesis of RAB3B knockdown plasmid

[0164] Design of shRNA sequence: Design an effective short hairpin RNA sequence targeting the RAB3B gene.

[0165] Selection of plasmid vector: Select a suitable plasmid vector that should contain appropriate regulatory elements and markers.

[0166] Cloning of shRNA sequence: Clone the designed shRNA sequence into the selected plasmid vector.

[0167] Plasmid construction: Use molecular biology techniques such as restriction digestion and ligation to construct a plasmid containing RAB3B knockdown shRNA.

[0168] Plasmid transformation: Transform the constructed plasmid into competent cells.

[0169] Colony screening: Screen the transformed colonies on a medium containing appropriate antibiotics.

[0170] Plasmid extraction: Extract the plasmid from the screened colonies.

[0171] Plasmid identification: Confirm whether the plasmid construction is successful by methods such as restriction digestion analysis and PCR identification.

[0172] Quality detection: Perform quality detection on the extracted plasmid, including concentration, purity, etc.

[0173] Preserve the plasmid: Preserve the qualified plasmid for future use.

[0174] Virus packaging of RAB3B knockdown plasmid

[0175] Prepare the plasmid: Ensure that you have the correct RAB3B knockdown plasmid.

[0176] Cell culture: Culture the cell line used for virus packaging, such as 293T cells.

[0177] Transfect the plasmid: Transfect the RAB3B knockdown plasmid and other necessary packaging plasmids into the cells.

[0178] Culture the cells: Culture the transfected cells under appropriate conditions to allow virus packaging and production; When conducting virus packaging experiments, the following points need to be noted: Strict aseptic operation to avoid contamination; Select appropriate cell lines and plasmids for packaging; Control transfection conditions to obtain high-efficiency virus packaging; Conduct strict detection and identification of the virus to ensure its quality and safety; Follow relevant laboratory safety operating procedures.

[0179] Collect the virus supernatant: Collect the supernatant containing the virus at the appropriate time point.

[0180] Concentrate and purify the virus: According to need, virus concentration and purification steps can be carried out.

[0181] Virus titer determination: Determine the virus titer to determine the virus infection efficiency.

[0182] Infect target cells: Use the concentrated or purified virus supernatant to infect target cells.

[0183] Detect the knockdown effect: Use appropriate methods, such as Western blot or qPCR, to detect the expression level of RAB3B to determine the knockdown effect.

[0184] RAB3B gene knockdown experiment

[0185] Prepare cells: Inoculate neuroblastoma cells into a culture dish and culture to an appropriate cell density.

[0186] Infect with virus: Add the virus supernatant to the cell culture dish, then place the culture dish in an incubator and culture for a period of time to allow the virus to infect the cells.

[0187] Change the culture medium: After infecting with the virus, pour out the virus supernatant in the cell culture dish, then add fresh culture medium and continue to culture the cells.

[0188] Detect the expression level of the RAB3B gene: After infecting with the virus, use methods such as qPCR and Western blot to detect the expression level of the RAB3B gene.

[0189] Transcriptome sequencing technology

[0190] Experimental material preparation: Select appropriate cells, tissues, or organisms as the research objects; collect samples and ensure that the quality and quantity of the samples meet the experimental requirements.

[0191] RNA extraction and quality control: Use appropriate methods to extract RNA and ensure the integrity and purity of RNA; conduct RNA quality assessment, including the detection of concentration, integrity, and purity.

[0192] Library construction: Fragment RNA, usually using enzymatic digestion or mechanical fragmentation methods; use reverse transcriptase to reverse transcribe RNA into cDNA; perform end repair and adapter ligation on cDNA to construct a library suitable for sequencing.

[0193] Sequencing platform selection: Select a suitable sequencing platform, such as Illumina, PacBio, or Oxford Nanopore, etc.; load the constructed library onto the sequencing chip or flow cell according to the requirements of the sequencing platform.

[0194] Sequencing run and data collection: Start the sequencer for sequencing runs, which usually generates a large amount of short read sequence data; monitor the sequencing process to ensure the quality and yield of data collection.

[0195] Data analysis: Perform quality control and preprocessing on the sequencing data, including removing low-quality reads, adapter sequence trimming, etc.; use bioinformatics tools and algorithms to align the reads to the reference genome or transcriptome; analyze transcript expression levels, differential expression, gene annotation, transcript structure, etc.

[0196] Subsequent analysis and verification: Further analyze the functions, pathway enrichments, regulatory networks, etc. of differentially expressed genes; optionally conduct experimental verifications, such as qPCR verification or protein expression analysis.

[0197] Tumorigenicity assay in nude mice

[0198] Prepare nude mice: Select appropriate nude mice, usually female, with suitable body weight.

[0199] Cell culture: Ensure that N-SH-BE2 cells are in good growth condition.

[0200] Cell inoculation: Suspend an appropriate amount of N-SH-BE2 cells in a suitable medium.

[0201] Anesthetize nude mice: Anesthetize nude mice using appropriate anesthesia methods.

[0202] Inoculate cells: Inject the cells into nude mice through subcutaneous injection or other appropriate methods.

[0203] Observation and recording: Regularly observe the tumor formation in nude mice, including the size, shape, color, etc. of the tumor.

[0204] Measuring tumor size: Regularly measure the size of the tumor using measuring tools.

[0205] Experimental period: Determine the observation time period according to the experimental design.

[0206] Data analysis: Conduct statistical analysis on the tumor size to evaluate the growth of the tumor.

[0207] Tissue sampling: At an appropriate time, tumor tissues can be collected for further analysis.

[0208] Immunohistochemistry

[0209] Tissue preparation: Obtain tumor tissue specimens and fix them in an appropriate fixative, such as formalin. Embed the tissue specimens in paraffin to make tissue sections.

[0210] Section processing: Attach the tissue sections to glass slides, and perform dewaxing and rehydration of the sections to enable antibodies to enter the tissue.

[0211] Antigen retrieval, optional: For some antigens, an antigen retrieval step may be required to expose antigen epitopes, which can be achieved by heat induction, enzyme digestion, or other methods.

[0212] Immunostaining: Select an appropriate primary antibody, an antibody specific to the target antigen, and dilute it to an appropriate concentration. Incubate the sections with the primary antibody to allow the primary antibody to bind to the target antigen. Remove the unbound primary antibody, usually using a washing step.

[0213] Secondary antibody binding: Select a secondary antibody that is species-matched to the primary antibody and dilute it to an appropriate concentration. Incubate the secondary antibody on the sections to allow it to bind to the primary antibody. Remove the unbound secondary antibody, usually using a washing step.

[0214] Color development reaction, optional: According to the immunohistochemistry method used, select an appropriate color development system, such as DAB or other color developers; incubate the color developer on the sections to allow it to bind to the antibody and produce a visible color reaction.

[0215] Counterstaining, optional: For better visualization of cell structure, nuclear counterstaining can be performed, usually using hematoxylin.

[0216] Cover slipping: Seal the sections with an appropriate cover slipping agent to prevent the sections from drying and being contaminated.

[0217] Microscopic observation: Place the sections under a microscope to observe and evaluate the results of immunostaining.

[0218] Tissue protein extraction

[0219] Prepare tissue sample: Select a suitable tissue sample and cut it into small pieces.

[0220] Lyse tissue: Add the tissue sample to an appropriate amount of lysis buffer and break the tissue by homogenization or sonication to release proteins.

[0221] Centrifuge: Centrifuge the lysed tissue mixture to remove cell debris and other impurities.

[0222] Collect supernatant: Collect the supernatant after centrifugation, which contains the extracted proteins.

[0223] Protein purification: If needed, various methods can be used to purify and enrich the extracted proteins.

[0224] Store protein: Store the purified protein in an appropriate buffer or storage conditions to maintain its stability and activity.

[0225] Total RNA extraction from tissue

[0226] Prepare tissue sample: Select a suitable tissue sample, cut it into small pieces and place them in a cryotube.

[0227] Add lysis buffer: Add an appropriate amount of lysis buffer to the tissue sample, usually a solution containing denaturants.

[0228] Homogenize: Use a homogenizer or tissue disruptor to homogenize the tissue sample to release intracellular RNA.

[0229] Incubate: Incubate the homogenized tissue sample in the lysis buffer for a period of time, usually 5 - 10 minutes, to ensure sufficient release of RNA.

[0230] Centrifuge: Centrifuge the incubated sample to remove cell debris and other impurities.

[0231] Transfer supernatant: Carefully transfer the supernatant to a new centrifuge tube.

[0232] RNA precipitation: Add an equal volume of isopropanol to the supernatant and mix gently. Let the mixture stand at room temperature for a period of time to precipitate RNA.

[0233] Centrifuge: Perform centrifugation to precipitate RNA. Discard the supernatant.

[0234] RNA washing: Wash the RNA precipitate with 75% ethanol to remove residual impurities.

[0235] Dry: Dry the washed RNA precipitate at room temperature for a moment.

[0236] Dissolution: Dissolve the dried RNA precipitate in an appropriate buffer or water.

[0237] Storage: Store the dissolved RNA in a refrigerator at -80 °C or lower to maintain its stability.

[0238] Prediction, evaluation, and optimization of the MYCN protein structure

[0239] Prediction of the MYCN protein structure: First, obtain the amino acid sequence of MYCN from NCBI. Use the monomer_casp14 model in Alphafold v2.3.2 to predict the structure of the MYCN protein. All parameters used are default parameters. The database versions used are as follows: uniport and uniref90 are from March 1, 2023, pdb_mmcif and pdb_seqres are from March 3, 2023, and the remaining database versions are default versions.

[0240] Evaluation of the MYCN protein structure: Use the SWISS-MODEL online tool to evaluate the predicted protein structure. This tool generates a Ramachandran plot through MolProbity version 4.4 and calculates the Ramachandran preference value; Ramachandran plots are a commonly used tool for analyzing whether the secondary structure of a protein is abnormal; in the Ramachandran plot, each point represents the φ and ψ angles of an amino acid residue, and different amino acid residues are located in different positions in this plot; generally, a reasonable distribution of amino acid dihedral angles is in a specific region of the plot, which is called the allowed region; points falling outside the field represent abnormal dihedral angles of the amino acid residue.

[0241] Optimization of the MYCN protein structure: In this study, the method of GROMACS molecular dynamics simulation was used to place the MYCN protein structure predicted by Alphafold into a water box with a simulated 1.2 nm3 CHARMM36 force field; 0.15 M of Na+ and Cl- were added to the simulation space to make the entire simulation system in an electrical equilibrium state, as similar as possible to the real environment of MYCN in the cell; through the thermal motion of MYCN in the simulated system, the predicted structure of MYCN gradually folds into a more stable and realistic spatial conformation under the influence of water, ions, and the force field; the optimized structure was evaluated through MolProbity 4.4.

[0242] Protein docking analysis of RAB3B and MYCN

[0243] This study used The software is used to implement protein docking. First, the proteins are preprocessed. Operations such as assigning bond orders, adding hydrogen, assigning zero-order bonds to metal atoms, and creating disulfide bonds are performed on the two proteins respectively. Then, the hydrogen bond network is optimized. Finally, the operation of protein energy minimization is carried out using the OPLS_4 force field. Then, the Protein-Protein docking module in is used for molecular docking. The standard mode is used for docking. The number of rotatable probes of the ligand is defined as 70000, so that sufficient conformational sampling of the ligand protein can be carried out. The number of generated conformations is defined as 30. For proteins with multiple chains, only one chain is used for docking. Finally, among all the generated conformations, Piper clusters the first 1000 rotational conformations based on the RMSD between each atom. The representative conformation in each class is selected from the conformation with the most neighbors in this class. Piper ranks the generated conformations based on the number of clusters in each class. The one ranked first is the conformation with the most number of clusters, which is the optimal binding mode for predicting the interaction between RAB3B and MYCN proteins.

[0244] Molecular dynamics simulation of the binding of RAB3B and MYCN

[0245] Construction of the topological structure model of the protein-ligand system: MD simulation is carried out using GROMACS 31, 32 on the Ubuntu 20.04.01 platform, equipped with an Intel Core i9-13900k CPU, a GeForce RTX 4070 Ti Super GPU, and 32 GB of RAM. First, the heavy atoms of the protein and small molecules are modified using the SPDBV 4.10 software. Then, the CHARMM36 force field is used to calculate the topological structure of the protein.

[0246] Setting of simulation system parameters: The complex is placed in the TIP3P water model and immersed in a cubic box that extends at least 1 nm in all solved directions. The system is neutralized by adding Na+ and Cl- ions, and then further supplemented with 0.145 M NaCl to make the system reach an approximate physiological state.

[0247] Energy minimization: Subsequently, the steepest descent algorithm is applied for 5000 steps of energy minimization to make the maximum force lower than 1000 kJ / mol / nm.

[0248] NVT and NPT equilibration: The system then undergoes restricted NVT: number of particles, volume, temperature, and NPT: number of particles, pressure, temperature equilibration for 100 ps to ensure that the system reaches a good equilibrium and stable state at 310 K and 1 bar.

[0249] MD simulation: A 100-ns MD simulation was performed on the complex with a total of 100,000,000 steps. During the simulation, the Verlet cut-off scheme and the Leap-frog integrator were used, with a time step of 1 fs, and the trajectory data was saved every 10 ps.

[0250] The MM / PBSA method is a commonly used method for estimating the stability of protein-ligand complexes. This method uses MD simulation trajectories to calculate the free energy change of the complex, which usually includes electrostatic potential energy, van der Waals forces, and solvation free energy contributions. In this study, gmx-MM / PBSA 1.6.1 was used. 33,34 Calculate the MM / PBSA binding free energy of the protein-ligand complex. We analyzed the energy contributions from factors such as Δ Eelec , ΔE vdw , ΔG solv to evaluate the affinity between the target and the compound. The MD simulation trajectories from 50 to 100 ns were used to calculate the binding free energy of the complex. The binding free energy between the protein and the ligand is calculated as follows:

[0251] ΔG bind = G complex - G receptor - G ligand

[0252] RMSD reflects the subtle changes in the spatial conformational fluctuations of the protein-ligand complex at different time points. It is generally believed that when the magnitude of RMSD is below , the stability of the protein-ligand binding is the best. In addition, the shorter the time required to reach equilibrium, the smaller the magnitude of RMSD at equilibrium, and the higher the stability of the protein-ligand complex binding. Therefore, in our study, we used the "gmxrms" command to calculate RMSD. The gmxrms module was used to calculate RMSD. During the calculation, least-squares superposition was performed using the backbone, and the backbone was selected as the output group for RMSD calculation. RMSD was calculated according to the following formula:

[0253]

[0254] where r i (t) is the position of atom i at time t.

[0255] The RMSF is a key parameter for evaluating the structural stability and flexibility of proteins; specifically, the RMSF represents the standard deviation of the atomic coordinates of each amino acid residue in a protein during simulation; as the RMSF value decreases, the protein structure becomes increasingly stable; this value is quantified based on the distance between each atom and its average position over time; in this study, unless otherwise explicitly stated, the RMSF calculation is only for the protein backbone.

[0256] The radius of gyration Rg is crucial for evaluating protein structure and conformational changes; upon binding to a small molecule, the Rg of a protein typically contracts due to ligand-induced binding leading to a more compact folding of the protein molecule; thus, changes in the radius of gyration can serve as a reliable indicator for assessing the binding stability of protein-ligand complexes; the formula for calculating Rg is as follows:

[0257]

[0258] where, m i is the mass of atom i, and r i is the position of atom i relative to the molecular center of mass;

[0259] The solvent-accessible surface area SASA provides insights into the surface area, hydrophobic interactions, and stability of protein-ligand complexes, helping us understand their binding and stability; the SASA of the protein-ligand complex was estimated using GROMACS commands.

[0260] The free energy landscape FEL of the receptor-ligand complex provides a vivid and informative two-dimensional or three-dimensional depiction of the free energy changes occurring during the binding process; the study of FEL has important value in various interdisciplinary fields; this study aims to evaluate the affinity and binding stability of the receptor-ligand complex by analyzing the FEL of the receptor-ligand complex; the translational and rotational motions of the MD simulation trajectory were corrected using the gmxtrjconv command; within the time range of 30 - 60 ns, the FEL of the protein-ligand complex stability was calculated using the gmxsham command; after analyzing the energy wells using the gmxtrjconv command, the conformation of the energy minimum point was extracted; using the 2DSketcher module in the 2023 - 1 software to analyze the binding mode of the lowest energy conformation in the energy well and creating a 3DFEL graph using ORIGIN2021; the Gibbs free energy is calculated using the following formula:

[0261]

[0262] In the formula, KB is the Boltzmann constant, T is the absolute temperature, N i is the probability density in the molecular dynamics data, N maxRepresents the maximum probability density in the molecular dynamics data.

[0263] Specific experimental procedures and precautions:

[0264] Select a suitable cell line: Endogenous experiment: Select a suitable cell line according to research needs; Exogenous experiment: Overexpress the protein to be studied in 293T cells. Note: All operations need to be carried out on ice.

[0265] Lyse cells: Take an appropriate amount of pre - cold lysis buffer and determine the usage according to the cell quantity; For exogenous experiments, a 35 mm Dish is usually used, and for endogenous experiments, a Dish of 60 mm or above is generally required, and the cell confluence should reach more than 80% to ensure sufficient protein is obtained.

[0266] Cell scraping and sonication: Use a cell scraper to scrape the cells into a 1.5 ml EP tube; Control the power of sonication at 30% and the time between 10 - 20 seconds.

[0267] Centrifuge to precipitate cell debris: Centrifuge at 13000 rpm for 15 minutes.

[0268] Prepare IP tubes: Add 5 μl of washed and mixed A + G beads; Wash with lysis buffer, centrifuge at 3000 rpm for 1 minute, and wash three times to replace the storage buffer of the beads with lysis buffer.

[0269] Add antibodies: Add approximately 5 μl of the antibody of the protein to be IP'd to each tube; Use the corresponding IgG antibody as a control for each group of experiments.

[0270] Sample preparation for input: Prepare another batch of EP tubes and add the buffer for sample preparation for direct sampling as input.

[0271] Sample treatment: Take a small part of the centrifuged supernatant for direct sampling; Add the remaining supernatant to the IP tubes.

[0272] Mix and incubate: Use a vertical mixer to rotate overnight at 4 °C; 3 - 4 hours is sufficient for exogenous experiments.

[0273] Wash and sample preparation: Wash the rotated beads with lysis buffer, then discard the supernatant and prepare the sample; Use 1X SDS buffer for sample preparation.

[0274] Result detection: Detect the results by Western blot.

[0275] During the experiment, the following points should be noted: Keep all operations at low temperature to prevent protein denaturation; strictly follow the operation steps to avoid errors; pay attention to the handling and storage of samples to ensure the accuracy of experimental results; conduct reasonable analysis and interpretation of experimental results.

[0276] Although the embodiments of the present invention have been shown and described, for those of ordinary skill in the art, it can be understood that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Application of Ras-related protein Rab-3B in the treatment of neuroblastoma, characterized in that: include: Cell culture, including cell recovery, cell passaging and cell cryopreservation; Cell recovery: Turn on the ventilation equipment of the clean bench, disinfect the clean bench surface with 75% alcohol, and ensure that the surface is clean and tidy to prevent contamination; remove the centrifuge tube from the autoclave, place it on the test tube rack, and mark the name of the cell on the centrifuge tube for identification; add 2 ml of preheated culture medium to each centrifuge tube and keep it at the appropriate temperature; use appropriate protective equipment to carefully remove the cells that need to be revived from the liquid nitrogen tank; ensure that the temperature is kept low during the operation to prevent the cells from being damaged, quickly place the removed cells in a 37°C water bath, and stir gently to thaw the cells quickly; wipe the outside of the cryopreserved tube with clean alcohol cotton to remove possible contamination; carefully place the thawed cell suspension in a 4% vaccinia cerevisiae container. Place the tube in a centrifuge and set the centrifugal speed to 1000 rpm for 5 minutes. Carefully aspirate the supernatant with a pipette, taking care not to touch the cell pellet. Add 4 ml of preheated culture medium to the tube and gently blow or stir to evenly disperse the cells in the culture medium. Aspirate the resuspended cell suspension into a 6-cm culture dish and label the cell name, date, treatment method, etc. Then, use a pipette to slowly draw an "8" in the culture dish to evenly distribute the cells. Place the culture dish in a 37°C cell culture incubator to provide appropriate culture conditions. Regularly observe the growth of cells and check the cell morphology, density, and viability. Cell passaging: disinfect the clean bench, place the necessary equipment such as pipettes, close the plexiglass plate, and use ultraviolet irradiation for 30 minutes; aspirate and discard the old culture medium in the culture dish to ensure that the cell surface is clean; add an appropriate amount of PBS, gently shake the culture dish, and wash the cells twice to remove the residual culture medium and impurities; after aspirating and discarding PBS, add 1mL of trypsin; use a pipette to slowly and fully blow the bottom of the culture dish to completely fall off the cells growing on the wall to ensure that the cell suspension is uniform; transfer the cell suspension into a centrifuge tube and use a low-speed normal temperature centrifuge to centrifuge at a speed of 1000rmp for 5 minutes; carefully aspirate and discard the supernatant, taking care not to touch the cell pellet; add 4mL of culture medium, gently blow or stir to evenly disperse the cells in the culture medium; aspirate the resuspended cell suspension into a 6-cm culture dish and mark the relevant information; place the culture dish in a 37°C cell culture incubator to provide appropriate culture conditions; Cell freezing: prepare dimethyl sulfoxide, serum and serum-free culture medium in advance; disinfect the clean bench surface, place the necessary equipment such as pipettes, close the plexiglass plate, and use ultraviolet irradiation for 30 minutes; when the cell growth fusion reaches about 85% to 90%, and the cells are in good condition under the microscope, proceed to the next step; aspirate and discard the old culture medium in the culture dish; add an appropriate amount of PBS, gently shake the culture dish, and wash the cells twice; after aspirating and discarding PBS, add 1mL of trypsin; observe the cell morphology under a microscope. When the cell boundaries are obvious and round, it means that the digestion is complete; immediately add 2mL of culture The digestion process is terminated by blowing the bottom of the culture dish slowly and fully with a pipette to completely remove the cells that grow on the wall; the cell suspension is transferred into a centrifuge tube and centrifuged at 1000 rpm for 5 minutes using a low-speed normal temperature centrifuge; the freezing solution is prepared in an ultra-clean bench and fully mixed; the supernatant in the centrifuge tube is aspirated, the freezing solution is added, and the cells are evenly dispersed in the freezing solution by blowing or stirring gently; the cell suspension is dispensed into freezing tubes and detailed information such as cell types and freezing time are marked; the freezing tubes are placed in a freezing box and temporarily stored in an ultra-low temperature refrigerator; the next day, the freezing box is moved into a liquid nitrogen tank for long-term storage; The cell cultures were subjected to Transwell invasion assay, cell scratch assay, CCK-8 cell proliferation-toxicity assay and cell cloning assay.

2. The use of the Ras-related protein Rab-3B in the treatment of neuroblastoma according to claim 1, characterized in that: The Transwell invasion assay includes the following steps: Matrigel plating: Take Matrigel out of the -20℃ refrigerator and place it in a 4℃ refrigerator to thaw overnight; dilute Matrigel with H-DMEM culture medium at a ratio of 1:6; aspirate 60uL of the diluted Matrigel and spread it evenly on the bottom of the upper chamber of the Transwell chamber; place the Transwell chamber with Matrigel in a 37℃ incubator and incubate for 1 hour to allow the Matrigel to polymerize into a gel; Prepare cell suspension: Keep cells in serum-free culture environment for 12 hours in advance to eliminate the influence of serum on experimental results; digest cells, centrifuge to remove old culture medium after terminating digestion; wash with PBS 1-2 times, and then resuspend cells in serum-free culture medium; adjust cell density to 5×10 5 / mL; Inoculate cells: Pipette 100uL of cell suspension and add it to the Transwell chamber, i.e., add 5×104 cells to each chamber; add 600uL of culture medium containing 20% ​​FBS to the lower chamber of the 24-well plate; Cell culture: Transwell chambers and 24-well plates were placed in a 37°C incubator for 48 hours; Results: Direct counting method was used to count the "adherent" cells that passed through the membrane. First, the culture medium in the Transwell chamber was carefully aspirated. The cells were washed twice with PBS for 5 minutes each time. Then, the cells were fixed with 4% paraformaldehyde fixative for 20 minutes. Next, the cells were washed twice with PBS for 5 minutes each time. The cells were stained with 0.1% crystal violet stain for 15 minutes. The cells that had not been invaded were gently wiped with a cotton swab soaked in PBS. Finally, the Transwell chamber was placed under a 400x microscope, and five fields of view were randomly selected to observe and count the cells.

3. The use of the Ras-related protein Rab-3B in the treatment of neuroblastoma according to claim 1, characterized in that: The cell scratch assay includes the following steps: Use a marker pen to draw horizontal lines on the bottom of the 6-well plate, with each line spaced 0.5 cm apart. Draw 5 lines in each well, and the horizontal lines must pass through the wells. Add approximately 5 × 10 5 The specific number of cells may vary depending on the cell type, and it is best to cover the entire well after overnight. Wait until the cells in the well plate are fully grown the next day, and then use a 10 μL pipette tip to scratch the bottom of the well plate perpendicularly. Rinse the cells three times with PBS by gently shaking the plate to remove the scratched cells; Add DMEM / F12 culture medium stock solution; Place the plate in a 37°C, 5% CO 2 The cells were cultured in a cell culture incubator. At 0, 6, 12, 24 and 48 hours, photographs were taken at fixed positions and the scratch width was measured.

4. The use of the Ras-related protein Rab-3B in the treatment of neuroblastoma according to claim 1, characterized in that: The CCK-8 cell proliferation-toxicity experiment comprises the following steps: The cells of the experimental group and the control group were seeded in a 96-well plate at a density of 2000 cells per well. No cells were added to the blank group, and only DMEMF12 medium was added. All wells were placed in a cell culture incubator at 37°C and incubated for 24 hours. The next day, after the cells were firmly attached to the wall, different concentrations of Fatostatin were added to the experimental group according to the doubling dilution method, and H-DMEM medium was added to the control group and the blank group. The well plate was returned to the 37°C cell culture incubator and cultured for 48 hours; After 48 hours, the original culture medium was aspirated and a CCK-8 solution with a final concentration of 10% was added as a replacement medium; the well plate was placed in a 37°C incubator and incubated for 30 minutes; After 30 minutes, the well plate was taken out and the absorbance value of each well at a wavelength of 450 nm was detected using an enzyme label detector; The cell proliferation inhibition rate (%) was calculated as follows: cell proliferation inhibition rate (%) = 1 - [(OD of experimental group - OD of blank group) / (OD of control group - OD of blank group)] × 100%.

5. The use of the Ras-related protein Rab-3B in the treatment of neuroblastoma according to claim 1, characterized in that: The cell cloning experiment includes the following steps: Cell culture: Grow the cells to be tested in appropriate culture medium until the cells reach a suitable density; Cell counting: Count the cultured cells to determine the number of cells required for inoculation; Dilute the cell suspension: Dilute the cell suspension to an appropriate concentration, usually 10 to 100 cells per ml; Inoculating cells: Evenly inoculate the diluted cell suspension into the culture dish or culture plate, and inoculate an appropriate amount of cells into each culture well or each culture dish; Cultivate cells: Place the culture dish or plate seeded with cells in an incubator and provide appropriate culture conditions, such as temperature, humidity, and gas environment; Observation and counting: During the culture process, observe the culture dish or plate regularly to determine the growth of cells; when the cells form visible colonies, count the colonies; Analyze data: Analyze the clonogenic capacity of cells based on the number and size of colonies; compare cell clonogenicity under different conditions or in different treatment groups.

6. The use of the Ras-related protein Rab-3B in the treatment of neuroblastoma according to claim 1, characterized in that: The cell protein extraction comprises the following steps: Remove the cell culture medium and wash the cells with PBS. Note that sterile operation must be maintained when culturing and scraping cells to avoid cell contamination; The cells were scraped and collected by centrifugation; Cool PBS and lysis buffer and add protease inhibitors to prevent protein degradation; Add a specific ratio of lysis buffer, RIPA + 10% SDS + protease inhibitor, to the cell pellet, lyse the cells on ice, and vortex every 10 minutes; Use an ultrasonic disruptor to further disrupt the cells. The time and conditions for vortexing and ultrasonic disruption should be appropriate to avoid unnecessary damage to the protein. The cell lysate was centrifuged and the supernatant was dispensed into new EP tubes.

Images