Idiopathic pulmonary fibrosis inhibitor and application

Abstract

The invention relates to the technical field of preparation of drugs for inhibiting idiopathic pulmonary fibrosis, and particularly discloses an idiopathic pulmonary fibrosis inhibitor, and a molecular inhibitor comprises a compound HO11553 and / or a compound HO11552. The idiopathic pulmonary fibrosis molecular inhibitor provided by the invention targets a G protein coupled receptor CCR2, the molecular inhibitor is a double-pocket inhibitor capable of being respectively combined with an ortho-binding site and an allotopic binding site of the CCR2, the molecular inhibitor slows down the pulmonary fibrosis process by inhibiting the CCR2, an effective means is provided for treatment of IPF, and the application prospect is broad. Good application prospects are realized.

Description

Technical Field

[0001] The present invention relates to the field of biological medicine technology, and particularly relates to an idiopathic pulmonary fibrosis inhibitor and its application. Background Art

[0002] Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, fibrotic interstitial pneumonia and is the most common idiopathic interstitial pneumonia clinically, with its incidence showing an upward trend. IPF poses a serious threat to human health. At present, IPF cannot be cured, and the treatment aims to delay the disease progression, improve the quality of life, and prolong the survival period. The main methods include anti-fibrotic drug treatment, non-drug treatment, treatment of complications, palliative treatment, disease monitoring, patient education, and self-management, etc. The main drugs currently used for idiopathic pulmonary fibrosis include pirfenidone, nintedanib, and high-dose acetylcysteine, etc. Among them, pirfenidone and nintedanib treatments can slow down the decline of IPF lung function, and N-acetylcysteine has antioxidant and anti-fibrotic effects at high doses (1800 mg / d) and is useful for some IPF patients. These drugs can all slow down the decline of lung function and have good clinical value. However, the problems of poor long-term efficacy and drug tolerance of IPF drugs still exist, and the development of new drugs is extremely urgent. In the prior art, a large amount of research has also been carried out on this.

[0003] The Chinese patent with the publication number CN117902998A discloses an idiopathic pulmonary fibrosis inhibitor and its preparation method. The compound inhibitor mentioned therein can highly selectively target the bromodomain BD1 of the BET protein, and its inhibitory activity against BRD4-BD1 is higher than that against BRD4-BD2, thus providing diverse options for the treatment of IPF. The Chinese patent with the publication number CN111961715B discloses the application of Mincle inhibitor in the treatment of idiopathic pulmonary fibrosis. Using Mincle gene knockout mice as experimental subjects, it studies the function of the Mincle gene in idiopathic pulmonary fibrosis. The results show that the deletion of the Mincle gene can alleviate bleomycin-induced idiopathic pulmonary fibrosis, and thus it is considered that Mincle can be used as a treatment target for idiopathic pulmonary fibrosis. In addition, the patent with the publication number CN113631179A discloses a method for treating idiopathic pulmonary fibrosis, which uses an agent that reduces or eliminates the kinase activity of checkpoint kinase 1 (Chk1) to treat idiopathic pulmonary fibrosis (IPF). Therefore, the development of a large number of idiopathic pulmonary fibrosis treatment drugs with better clinical value remains the difficulty and focus of research.

[0004] Chemokines are small proteins that regulate the migration and activation of immune cells by binding to receptors. They can be divided into CC (CC Chemokines), CXC (CXC Chemokines), CX3C (CX3C Chemokines), C (C Chemokines), etc. The chemokine receptor family includes CC chemokine receptors (CCR), CXC chemokine receptors (CXCR), CX3C chemokine receptors (CX3CR), and C chemokine receptors (XCR). Studies have shown that there is a close relationship between chemokine receptors and idiopathic pulmonary fibrosis. Among them, CCR2 is a G protein-coupled receptor that plays a key role in the recruitment of lung fibroblasts, cell migration, tissue remodeling, and fibrosis, and is extremely important for the treatment and prognosis of idiopathic pulmonary fibrosis. In addition, existing published literature shows that CCR2 has two binding pockets with different characteristics, namely the orthosteric site located on the outer side of the cell membrane and the allosteric site located inside the cell, and thus has good binding activity. However, in the prior art, there is no drug research related to the treatment of idiopathic pulmonary fibrosis by targeting CCR2. Therefore, the present invention aims to develop an inhibitor of idiopathic pulmonary fibrosis to better meet the actual needs. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide an inhibitor of idiopathic pulmonary fibrosis and its application to solve the problems in the above background technology.

[0006] The technical problem to be solved by the present invention is achieved by the following technical solutions:

[0007] An inhibitor of idiopathic pulmonary fibrosis, the molecular inhibitor includes compound HO11553 and / or compound HO11552;

[0008] Among them, the molecular structural formula of compound HO11553 is:

[0009]

[0010]

[0011] The molecular structural formula of compound HO11552 is:

[0012]

[0013] Furthermore, the molecular inhibitor includes compound HO11553-TM and / or compound HO11552; compound HO11553-TM is the hydrochloride salt of compound HO11553;

[0014] The molecular structural formula of compound HO11553-TM is:

[0015]

[0016] Further, the molecular inhibitor targets the G protein-coupled receptor CCR2.

[0017] Further, the molecular inhibitor inhibits the G protein-coupled receptor CCR2 through the PI3K Calss IB pathway.

[0018] Further, the G protein-coupled receptor CCR2 has an orthosteric binding site located on the outer side of the cell membrane and an allosteric binding site located on the inner side of the cell membrane; among the molecular inhibitors, the compound HO11553 and the compound HO11552 bind to the orthosteric binding site and the allosteric binding site of CCR2, respectively.

[0019] Further, it also includes a pharmaceutically acceptable carrier and excipients.

[0020] Use of the idiopathic pulmonary fibrosis inhibitor in the preparation of a medicament for treating idiopathic pulmonary fibrosis.

[0021] Beneficial effects: The idiopathic pulmonary fibrosis molecular inhibitor of the present invention targets the G protein-coupled receptor CCR2, and the molecular inhibitor is a double-pocket inhibitor that can bind to the orthosteric binding site and the allosteric binding site of CCR2, respectively. The molecular inhibitor slows down the process of pulmonary fibrosis by inhibiting CCR2, providing an effective means for the treatment of IPF and having good application prospects. Description of the Drawings

[0022] Figure 1 It is a spectral analysis diagram of the compound HO11553-TM.

[0023] Figure 2 It is a spectral analysis diagram of the compound HO11552.

[0024] Figure 3 It is a result diagram of the establishment of an idiopathic pulmonary fibrosis model. Among them, A is the expression level of the CCR2 gene in the normal control group and the IPF (GSE70866) group; B is a survival analysis diagram showing the survival probability of the high and low CCR2 expression groups over time; C is a representative image of H&E and Masson's trichrome staining of lung tissues in mice four weeks after injection of BLM; D is the pathological score result of the lung tissue by H&E staining at the 4th week; E is the area of collagen in the lung tissue at the 4th week; F is the level of CCR2 expression in the BLM-induced idiopathic pulmonary fibrosis model analyzed by RT-gPCR (*P<0.05); G, H, and I are the expression levels of CCR2 in the lung tissues of each group analyzed by Western blotting.)

[0025] Figure 4It is the optimized three-dimensional result diagram of the CCR2 protein.

[0026] Figure 5 It is the RMSD analysis result diagram of compound HO11553, compound HO11552 and other molecular systems (where black represents molecule 17 and yellow represents molecule 67).

[0027] Figure 6 It is the RMSF analysis result diagram of compound HO11553, compound HO11552 and other molecular systems (where black represents molecule 17 and yellow represents molecule 67).

[0028] Figure 7 It is the Rg and SASA analysis result diagram of compound HO11553, compound HO11552 and other molecular systems (where black represents molecule 17 and yellow represents molecule 67).

[0029] Figure 8 It is the hydrogen bond analysis of compound HO11553, compound HO11552 and other molecular systems (the leftmost represents molecule 17 and the rightmost represents molecule 67).

[0030] Figure 9 It is the free energy distribution of compound HO11553, compound HO11552 and other molecules (the leftmost represents molecule 17 and the rightmost represents molecule 67).

[0031] Figure 10 It is the two-dimensional binding mode diagram of compound HO11553, compound HO11552 and other molecules in the optimal constrained state (the leftmost represents molecule 17 and the rightmost represents molecule 67).

[0032] Figure 11 It is the coupling sensing diagram of mouse CCR2 protein.

[0033] Figure 12 It is the experimental result diagram of the interaction between mouse CCR2 protein and drug 17 (compound HO11553).

[0034] Figure 13 It is the result diagram of the interaction of mouse CCR2 protein alone with drug 17 (compound HO11553), drug 67 (compound HO11552), and the simultaneous interaction with both drugs.

[0035] Figure 14 It is the result diagram of drug 17 (compound HO11553) inhibiting the proliferation of TGF-β-induced pulmonary fibrosis cells.

[0036] Figure 15 It is the result diagram of drug 67 (compound HO11552) inhibiting the proliferation of TGF-β-induced pulmonary fibrosis cells. Detailed implementation manners

[0037] In order to make the technical means, creative features, achieved purposes and functions of the present invention easy to understand, the present invention will be further described below in conjunction with specific embodiments.

[0038] (1) The molecular structural formula of the compound HO11553 described in the present invention is:

[0039]

[0040] The molecular structural formula of the compound HO11552 is:

[0041]

[0042] The compound HO11553 is further converted into the compound HO11553-TM, and the compound HO11553-TM is the hydrochloride form of the compound HO11553. The solubility of the compound HO11553 is limited, while the compound HO11553-TM can significantly improve the solubility in different solvents, and the application effect is better.

[0043] The molecular structural formula of the compound HO11553-TM is:

[0044]

[0045] The solubility of the compound HO11552 itself in different solvents is better and does not require further conversion.

[0046] In the present invention, the spectral analysis diagram of the compound HO11553-TM is as Figure 1 shown, and the spectral analysis diagram and liquid chromatography diagram of the compound HO11552 are respectively as Figure 2 shown.

[0047] The molecular inhibitor described in the present invention targets the G protein-coupled receptor CCR2, and the molecular inhibitor inhibits the G protein-coupled receptor CCR2 through the PI3K CalssIB pathway.

[0048] The G protein-coupled receptor CCR2 has an orthosteric binding site located on the outer side of the cell membrane and an allosteric binding site located on the inner side of the cell membrane; in the molecular inhibitor, the compound HO11553 or HO11553-TM mainly binds to the orthosteric binding site of CCR2, and the compound HO11552 mainly binds to the allosteric binding site of CCR2.

[0049] As an improvement to the present invention, the molecular inhibitor may further include a pharmaceutically acceptable carrier and excipient, and can be prepared into any acceptable pharmaceutical form.

[0050] The idiopathic pulmonary fibrosis inhibitor described in the present invention can be applied to the preparation of drugs for treating idiopathic pulmonary fibrosis.

[0051] (II) Effect verification

[0052] 2.1 Establishment of an idiopathic pulmonary fibrosis model

[0053] This study was approved by the Animal Ethics Committee of Hunan Normal University. The idiopathic pulmonary fibrosis model was established using C57BL / 6J mice (6 - 8 weeks old, 18 - 22 g). Healthy mice were used as experimental subjects. The mice were randomly divided into a control group and an experimental group. The mice in the experimental group were anesthetized with 1% sodium pentobarbital (50 mg / kg), and a single dose of 5 mg / kg bleomycin (BLM) solution was injected intratracheally. The BLM solution was prepared with normal saline (1 mg / ml).

[0054] After 4 weeks of feeding, the mice were sacrificed and lung tissues were extracted. After collection, hematoxylin and eosin (H&E) staining and Masson's trichrome staining (Servicebio, China) were performed to evaluate the establishment effect.

[0055] Histopathological examination was performed using H&E staining. The sections were scored according to the degree of alveolar congestion, hemorrhage, and infiltration (4: extremely severe, 3: severe, 2: moderate, 1: mild, 0: normal). Masson's trichrome staining was used to evaluate the deposition of collagen fibers. Tissue section images were taken at a magnification of 200 times and the Immage-Pro Plus 6.0 software was used as the standard for identifying positive collagen areas.

[0056] The collagen pixel area and the corresponding tissue pixel area of each tissue were measured, and the percentage of collagen area was calculated (collagen pixel area / tissue pixel area x 100).

[0057] 2.2 Detection of CCR2 protein

[0058] A. Detection of CCR2 mRNA by RT-qPCR

[0059] Total RNA was extracted from tissues using Trizo1 reagent (USA), and reverse transcription was performed according to the manufacturer's instructions using an mRNA reverse transcription kit. RT-qPCR was performed using the SYBR Green method for amplification and analysis. GAPDH mRNA was used as an endogenous control. The primer sequences (purchased from Tsingke Biotechnology Co., Ltd., Beijing, China) are as follows:

[0060] M-CCR2: Forward TGTGATGACAAGCACTTAGACC

[0061] Reverse tggagataccttcggaactt

[0062] Forward primer of M-GAPDH: GCGACTTCAACAGCAACTCCC

[0063] Reverse primer: caccctgttgctgtagccgta

[0064] B. Detection of CCR2 protein by Western Blot

[0065] Lyse tissue samples with RIPA lysis buffer, and then analyze the proteins. Measure the protein concentration using a BCA protein assay kit. Incubate with 5% milk at room temperature for 2 hours, and then incubate with CCR2 antibody overnight at 4°C. After washing three times with TBST, incubate the membrane with the secondary antibody at room temperature for 1 hour. Use B as the endogenous control and detect on a shaker. Finally, develop the signal using a chemiluminescent imaging system and perform quantitative analysis.

[0066] 2.3 Data analysis

[0067] All data were analyzed using GraphPad Prism 9 software. Independent sample t-tests were used for comparisons between groups, with a significance level of P < 0.05.

[0068] Reference Figure 3 A - D. Four weeks after administration of BLM, H&E staining of lung tissue showed severe alveolar congestion and exudation, local alveolar wall hyperplasia into connective tissue, accompanied by alveolar bone collapse and loss of alveolar bone structure. Inflammatory cell infiltration was observed in the alveolar space and around. For some bronchi, the total inflammation score was 10 points. In contrast, the control group showed clear alveolar structure and intact alveolar walls, without obvious inflammatory cell infiltration or fibrosis, and the total inflammation score was 2 points.

[0069] Masson's trichrome staining showed prominent collagen fibers, alveolar wall hyperplasia in the BLM group, and fibrous masses formed in some areas, indicating severe alveolar wall fibrosis. The calculated average percentage of collagen area in the BLM group was 21.13%, which was based on the ratio of collagen pixel area to tissue pixel area. In the control group, there was no obvious blue staining. Very few collagen fibers, collagen hyperplasia, or fibrosis were observed, and the average percentage of collagen area was 6.13%, as shown in Figure 3 E. These results confirmed that intratracheal perfusion of BLM successfully induced idiopathic pulmonary fibrosis in mice.

[0070] To clarify the expression of CCR2 in idiopathic pulmonary fibrosis, the inventors detected the mRNA and protein levels of CCR2 in the lung tissues of male and female animals. RT-qPCR and Western blotting were used to detect control and BLM-induced idiopathic pulmonary fibrosis mice, and the results showed that the mRNA and protein of CCR2 in the BLM group were significantly increased compared with the control group.

[0071] (III) Construction of CCR2 membrane protein structure and molecular screening

[0072] 3.1 Preliminary construction of CCR2 membrane protein

[0073] The three-dimensional structure of CCR2 refers to the Protein Data Bank (https: / hwwwrcsb.org / ). The preparation of CCR2 membrane protein includes amino acid residue repair, hydrogenation and dehydration to create conditions for the formation of the receptor drug layer for modeling.

[0074] The extracted CCR2 structure was processed by amino acid repair, hydrogen atom addition and energy minimization. The resulting structure was saved in pdb format using the Charmm-gui tool for further use. This process also includes importing the optimized protein structure, adjusting the phospholipid membrane orientation, and assembling the membrane with DOPC as the membrane component. Na+ and Cl- ions are used to maintain the charge balance of the system. Finally, it is in a format compatible with GROMACS and appropriate force fields are applied, including AMBER19SB for proteins, Lipid17 for phospholipids, and GAFF2 for ligands.

[0075] 3.2 Small molecule data collection

[0076] Download the SMILES strings and corresponding IC50 values from the BindingDB database (https: / / www.bindingdb.org / bind / index.jsp) of molecules targeting CCR2. The molecules are classified according to their activity levels, ensuring that the IC50 values span four concentration levels.

[0077] 3.3 Structure-based pharmacokinetics (SBP) modeling

[0078] The optimized protein structure and reference molecules were used for SBP modeling. According to the IC50 values, the small molecules were divided into active and inactive categories. The drug layer was evaluated according to sensitivity and specificity and used as a test set for drug layer validation. SBP models were created for the internal and external binding pockets of CCR2, named SBPi and SBPo respectively.

[0079] 3.4 Further drug optimization design

[0080] 3D-QSAR Modeling: Feature extraction and evaluation were performed using the collected small molecule data.

[0081] The generation and evaluation of the 3D-OSAR pharmacophore were based on maximum fitness, total cost, effective value, and correlation. The best 3D-OSAR model was selected after comprehensive evaluation.

[0082] Common Feature Pharmacophore (CFP) Modeling: CCR2 inhibitors in clinical phases I, II, and III were collected and their common structural features were determined. These features were used to generate the CFP pharmacophore, and active and inactive molecules were input for validation. The best CFP model was selected based on score, sensitivity, specificity, and quality.

[0083] Pharmacophore-Based Virtual Screening (PBVS): Small molecule compounds were collected, including anti-infective libraries, anti-inflammatory libraries, anti-tumor libraries, anti-tumor libraries, anti-tumor libraries, anti-tumor libraries, anti-tumor libraries, antiviral concentric libraries, antiviral libraries, chemokine receptor targeting libraries, GPCR targeting libraries, immune libraries, and hGPCR libraries, for a total of 152,406 molecules. The generated SBPo, SBPi, 3D-OSAR, and CFP pharmacophores were used for screening. Molecules meeting pharmacokinetics criteria were retained when further performing AMET analysis.

[0084] The specific process is as follows: SBPo screening: Screening was performed using the SBPo pharmacophore, and 1,722 pharmacophore libraries including compound HO11553 and compound HO11552 were selected as the remaining candidate molecules; SBPi screening: The candidate molecules were further screened using the SBPi pharmacophore library, narrowing down to 69 small molecules; 3D-QSAR screening: The 69 small molecules were screened using the three-dimensional-OSAR pharmacophore basis, and all 69 molecules were retained; CFP screening: The 69 molecules were screened using the CFP pharmacophore. The final result of the virtual screening process was the retention of some small molecules. This multi-pharmacophore virtual screening method ensured a comprehensive evaluation of potential candidate drugs, making full use of the advantageous models of each drug source.

[0085] ADMET Screening: Use the ADME and toxicity modules to evaluate 69 small molecule drugs that have undergone virtual screening, and analyze their ADME properties, including absorption level, BBB level, solubility, CYP2D6, hepatotoxicity, PPB, AlogP98, and PSA2D. In addition, their toxicity characteristics are also evaluated, including the probability of NTP in female mice, the probability of NTP in male mice, NTP in female rats, the probability of NTP in male rats, the probability of WOE, the probability of Ames, and the probability of aerobic biodegradability. Among them, molecules with toxicity, carcinogenicity, or other adverse properties are excluded. Among them, small molecule 17 (representative compound HO11553) docks to the orthosteric binding site of CCR2 in the present invention, and 67 (compound HO11552) docks to the allosteric binding site of CCR2 in the present invention. The ADME analysis results of the molecules docking to CCR2 are shown in Table 1, and the toxicity probability analysis of the two is shown in Table 2. It can be seen that compound HO11553 and compound HO11552 do not have toxicity, carcinogenicity, or other adverse properties. The molecules that pass the ADMET verification continue with molecular docking and MM / PBSA scoring.

[0086] Table 1 ADME Analysis Results of Molecules Docking to CCR2

[0087]

[0088] Among them: Solubility grade a : 0 (very low), 1 (very low), 2 (low), 3 (good), 4 (optimal);

[0089] BBB level b : 0 (very high), 1 (high), 2 (medium), 3 (low), 4 (very low);

[0090] Solubility c : The larger the negative value, the lower the solubility;

[0091] CYP2D6 d , Hepatotoxicity e : The larger the negative value (the larger the absolute value), usually the weaker the inhibitory activity.

[0092] PPB f : The higher the value, the stronger the plasma protein binding ability.

[0093] AlogP98 g : The larger the value, the stronger the hydrophobicity.

[0094] PSA_2D h : The larger the value, the larger the polar surface area.

[0095] Table 2 Analysis of Toxicity Probability Results of Molecules Docking to CCR2

[0096]

[0097] Batch molecular docking and MMPBSA scoring: The inventors utilized the platform (https: / / hermite.dp.tech, DP Technology) and, leveraging its GPU-accelerated molecular docking and binding free energy calculation capabilities, performed batch molecular docking and MM / PBSA binding energy calculations for two pockets of CCR2. Among them, the optimized three-dimensional results of CCR2 are as Figure 4 shown. Its binding sites were determined using Hermite software. The broccoli-colored pocket represents the orthosteric binding site (external), while the purple pocket represents the allosteric site (internal). The molecular binding energy analysis results are shown in Table 3. It can be seen that both the orthosteric binding site 17 (representing compound HO11553) and the allosteric binding site 67 (representing compound HO11552) of CCR2 in the present invention exhibit excellent performance in terms of binding energy.

[0098] Table 3 Binding energy analysis of molecules docking to CCR2 (kcal / mol)

[0099]

[0100] (IV) Comprehensive verification and further multi-level analysis

[0101] 4.1 Molecular dynamics (MD) simulation

[0102] The molecules including compound HO11553 and compound HO11552 after the above screening were hydrogenated using UCSF Chimera (https: / / www.cgl.ucsf.edu / chimera / ) and saved in mol2 format. Calculations of single-point energy and molecular surface electrostatic potential were performed at the B97-3c level using ORCA (Neese, Wennmohs, Becker, and Riplinger, 2020), followed by calculations at the B3LYP-D3(BD / def2-TZVP level. RESP2 charges and topology files were generated using Multiwfn (13) and sobtop (Tian Lu, Sobtop, Version 1.0 (dev3.1), http: / / sobereva.com / soft / Sobtop). The CCR2 protein structure was prepared using Charmm-gui, including membrane addition, addition of water molecules, and charge balancing with Na⁺ and Cl⁻, AMBER force field phospholipids, and ligands. The energy minimization, system equilibration, and long-range interaction handling of Gromacs 2022.1 (Bauer, P., B. H. Hess, and E. Lindahl. GROMACS 2022.1 Manual 2022. doi:10.5281 / zenodo.6637571) were used. The minimum distance of the TIP3P water model was 1 Å, with periodic box edges. The steepest descent method was used for energy minimization, with a maximum force of 1000.0 kJ / mol·nm⁻¹. The system was equilibrated through three-step constrained dynamics of 125 ps and 500 ps, with time steps of 1 fs and 2 fs, respectively. The temperature and pressure were set by the velocity-scaling thermostat and the Berendsen barostat, with the temperature set at 298.5 K and the pressure at 1.01325 bar. Long-range interactions were treated using the particle mesh Ewald (PME) method, with a van der Waals cutoff of 10. The ligand and protein were restricted to a temperature-controlled group, and translational and rotational motions of a single group were eliminated. Molecular dynamics simulations were performed with a time step of 2 fs over a time span of 100 ns. Through the results and post hoc analysis, the optimal binding mode was preliminarily determined. Two consecutive 500-ns molecular dynamics simulations were performed according to this method.

[0103] 4.2 Stability and Conformational Analysis

[0104] The stability and conformational turnover rate (Rg) and solvent accessible surface area (SASA) of the CCR2 protein were analyzed using RMSD, RMSF, Radius of RMSD, and RMSF. After simulation, regular calibration and trajectory stability analysis were performed, and the average value and standard deviation of RMSD were used to evaluate the system stability. Rg and SASA were used to evaluate the stability and conformational changes of the enzyme. Principal component analysis (PCA) was used to determine the lowest potential energy and the optimal system conformation. The RMSD and Rg values were fitted and a free energy landscape was plotted to extract the most stable conformation. Hydrogen bond (H-bond) analysis was performed using gromacs with the gmxhbond command. This analysis was used to quantify the protein and ligand during the molecular dynamics (MD) simulation.

[0105] 4.3 Results Statistics:

[0106] ① Root Mean Square Deviation (RMSD)

[0107] RMSD is a key indicator for evaluating the system stability and is also the basis for further analysis of small molecule binding. By analyzing the RMSD over 500 ns, the results are as Figure 5 shown. The results indicate that both compound HO11553 and compound HO11552 exhibit good stability, with average RMSD values between 4 and 4.5 Å. The RMSD values of molecule 17 (compound HO11553) and 67 (compound HO11552) are 0.639 and 0.565 respectively. According to the RMSD analysis, molecule 17 (compound HO11553) has better stability.

[0108] ② Root Mean Square Fluctuation (RMSF)

[0109] RMSF can measure the fluctuations of each atom during the 100 ns simulation time ( Figure 6 ), identify active residues, binding pockets, and detailed interaction relationships. The RMSF analysis shows that the average root mean square values of molecule 17 (compound HO11553) and 67 (compound HO11552) are 0.125 and 0.118 respectively. These regions may indicate conformational changes and suggest potential active pockets.

[0110] Further analysis found and recorded amino acids with a fluctuation value greater than 0.5 nm:

[0111] Molecule 17 (compound HO11553): residues 182 - 185

[0112] Molecule 67 (compound HO11552): residues 9, 19, 233

[0113] These amino acid residues are surrounded by amino acids that play important roles when interacting with drug molecules, and are crucial for drug targeting, safety, drug resistance, etc.

[0114] ③ Analysis of the radius of gyration (Rg) and solvent-accessible surface area (SASA):

[0115] In MD simulations and structural biology, Rg and SASA are very important parameters that reflect the molecular structure and its interaction with the environment. As shown in Figure 7 , Rg is used to represent the compactness of the molecule. The smaller the Rg value, the more compact the molecule. The average Rg values of molecule 17 (compound HO11553) and 67 (compound HO11552) are 2.411 and 2.352 nm, respectively. SASA (surface area) mainly reflects the molecular surface area accessible to the solvent. A larger SASA value is typical of unfolded or partially folded proteins. The results show that both molecule 17 (compound HO11553) and 67 (compound HO11552) show stable SASA fluctuations near 185 mm, and the SASA values of molecule 17 and 67 are 185.135 and 184.744 nm, respectively. 2 .

[0116] ④ Hydrogen bond analysis

[0117] The hbnum.xvg file shows the number of hydrogen bonds over time during the entire simulation. This data reflects the dynamic nature of hydrogen bond formation and breakage. A higher count indicates stronger interaction between the ligand and the protein, while fluctuations indicate transient binding. In addition, the analysis also considers hydrogen bonds formed within a range of 0.35 mm, which reflects the geometric criteria for standard H-bond detection between donor and acceptor atoms. This threshold ensures that classical hydrogen bonds and closely interacting atom pairs are identified. As shown in Figure 8 , the average number of hydrogen bonds for molecule 17 (compound HO11553) and 67 (compound HO11552) are 0.388 and 2.153, respectively. The diameters of molecule 17 (compound HO11553) and 67 (compound HO11552) at 0.35 nm are 0.373 and 1.687, respectively. These results indicate that molecule 17 (compound HO11553) and 67 (compound HO11552) have a relatively close connection with the amino acids in the CCR2 pocket, and molecule 67 (compound HO11552) has a closer relationship with the amino acids in the CCR2 pocket.

[0118] ⑤ Principal component analysis (PCA)

[0119] PCA is a dimensionality reduction technique used to find the lowest energy state of a system. The lowest point on the free energy spectrum represents the most likely stable conformation. During the experiment, the periodic boundary conditions were first removed, and the RMSD and Rg values on the same time scale were extracted, and the Gibbs free energy was obtained. As Figure 9 shown, it shows that molecule 17 (compound HO11553) and 67 (compound HO11552) as well as other molecules all have their lowest potential energy.

[0120] ⑥ Optimal molecular docking

[0121] Combined with the PCA technique to find the complex conformation corresponding to the lowest potential energy, the interaction between the protein and the ligand was analyzed. As shown in Figure 10 shown, the analysis shows that molecule 67 (compound HO11552) interacts with the following amino acids: val63, leu67, leu81, ala141, arg237, glu238, tyr305, lys311, phe312, ARG138, ALA241, VAL244 and TYR315. Molecule 17 (compound HO11553) interacts with the following amino acids: LY38, ALA42, LEU45, Ty49, TRP98, ALA102, Tyr120, HID121, VAL187, PRO192, GLN288, GLU291 and THR292.

[0122] In summary, based on molecular docking, MMPBSA, RMSD, RMSF, Rg, SASA and PCA analysis, it can be seen that in the inhibitor of the present invention, molecule 17 (compound HO11553) is associated with the external pocket of the CCR2 protein, and molecule 67 (compound HO11552) is associated with the internal pocket of the CCR2 protein and is tightly connected. Therefore, the binding of molecule 17 (compound HO11553) and molecule 67 (compound HO11552) to the CCR2 protein is verified at the molecular level.

[0123] (V) Surface plasmon resonance (SPR experiment)

[0124] 5.1 Test principle: Surface plasmon resonance (SPR) can be used to detect molecular interactions based on physical optics principles. This method can detect molecular interactions with high sensitivity and without the need for labeling. SPR uses the resonance wave generated by light and plasma for labeling. The evaporation waves in different media can be used to construct biosensing to analyze the interactions between biomolecules and detect the interactions between ligands and analytes. Biosensing chip. In the experiment, one of the molecules to be measured is fixed on the chip surface, while the other molecule flows through the chip surface. When the analyte interacts with the ligand and the molecules bind and dissociate, the resonance angle changes due to the intermolecular interaction. The mass on the chip surface, and the sensorgram records the signal value under the chip surface. According to this change curve, the intermolecular interaction of the information can be obtained. The interaction test between the simulated mouse CCR2 protein and the substance is detected using surface plasmon resonance technology and the substance is assayed.

[0125] 5.2 Test procedure:

[0126] 5.2.1 Test samples are shown in Table 4.

[0127] Table 4 SPR test samples

[0128]

[0129] 5.2.2 Test method: Use the amino coupling method for protein immobilization, protein coupling: 1.0xPBS-P+ (pH 7.4); interaction: 1.xPBS-P+ (pH 7.4), 5% (v / v) dimethyl sulfoxide.

[0130] a. Protein coupling: (1) Place the running buffer (200 ml of 1xPBS buffer), the water bottle, and the waste bottle in the left tray and the right tray respectively, and then insert the corresponding feeders.

[0131] (2) Hold the CM5 chip with the letter side facing up. Gently push the chip into the slot in the direction of the arrow on the chip, then remove the chip, and finally close the door of the chip chamber.

[0132] (3) The chip channels are activated with 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, GE Healthcare) and N-hydroxysuccinimide (NHS, GE Healthcare) at a rate of 10 μl / min.

[0133] (4) Dilute the ligand protein to 50 pg / ml with sodium acetate and immobilize the protein in 4 channels of the chip at a flow rate of 10 μl / min to generate a coupling diagram.

[0134] (5) Block the channel with ethanolamine at a flow rate of 10 μL / min.

[0135] (6) Repeat steps (3) to (5), with the difference that an acetate buffer without protein is used in step (4).

[0136] b. Interaction test between protein and analyte

[0137] The 5% DMSO concentration calibration curve is configured and calibrated according to Table 5, using the stock solution batches of 4.5% and 5.8%.

[0138] Table 5 Solution calibration solution configuration table

[0139]

[0140] c. Determine the substance to be measured

[0141] (1) Dilute each analyte to several concentrations in a 96-well plate and couple them with the target protein from low to high concentration through a microarray. The flow rate is 30 μL / min and the duration is 150 s.

[0142] (2) After each concentration point has flowed through, the chip is washed with a 10 mM glycine hydrochloride (pH 2.0) solution for 5 minutes, and then this process is repeated until the corresponding concentrations of all analytes have been measured.

[0143] (3) The association constant and dissociation constant are obtained by globally fitting the data and converted into a 1:1 Langmuir binding model using Biacore Insight evaluation software (Cytiva, Marlborough, Massachusetts, USA).

[0144] 5.3 Result analysis

[0145] 5.3.1 Mouse CCR2 protein coupling

[0146] The coupling diagram of mouse CCR2 protein is shown in Figure 11 , and it can be seen that the mouse CCR2 protein reaches a total of 5890 RU.

[0147] 5.3.2 Affinity determination results

[0148] The purpose of this experiment is to determine the affinity of the analyte. A CM5 chip is used to couple the protein to detect the substances that interact with the mouse CCR2 protein. The detection results are shown in Table 6:

[0149] Table 6 Results of detecting mouse CCR2 protein

[0150]

[0151]

[0152] Wherein: KD: dissociation constant, reflecting the affinity of a chemical substance. The smaller the affinity value, the stronger the affinity; Ka: association rate constant, indicating the binding between molecules. The larger the value, the faster the binding; Kd: dissociation rate constant, indicating that the larger the value, the faster the dissociation speed.

[0153] When drug 17 (compound HO11553) was injected alone into mice, the results of the interaction test between mouse CCR2 protein and drug 17 (compound HO11553) were as Figure 12 shown. The results showed that CCR2 had a strong affinity for small molecule 17, and it increased with the increase in concentration. When drug 17 (compound HO11553) was injected alone into mice, drug 67 (compound HO11552) was injected alone, and drugs 17 (compound HO11553) and 67 (compound HO11552) were injected simultaneously, the results showed that the combined injection of drug 17 (compound HO11553) and drug 67 (compound HO11552) had a better affinity than the injection of drug 17 (compound HO11553) or drug 67 (compound HO11552) alone.

[0154] (VI) Cell experiments

[0155] Experimental method: 2000 cells were seeded in a 96-well plate, and lung cancer A549 cells were induced with TGF-β (10 ng / ml) for 48 hours to construct a pulmonary fibrosis cell model; subsequently, drugs 17 (compound HO11553) and 67 (compound HO11552) were added to the pulmonary fibrosis cells; the drugs were dissolved in DMSO and diluted with 1640 medium, and administered at concentration gradients of 0, 1, 1.25, 2.5, 5, 10, 25, 50, 100 μmol). After 48 hours of drug treatment, 10% volume (10 μl) of CCK8 reagent was added to each well, and the 96-well plate was incubated in the dark in an incubator for 3 hours. Finally, the absorbance was measured at a wavelength of 450 nm using an enzyme-linked immunosorbent assay (ELISA) reader to determine cell viability.

[0156] The results were as Figure 14 and Figure 15 shown. Drugs 17 (compound HO11553) and 67 (compound HO11552) could inhibit the proliferation of TGF-β-induced pulmonary fibrosis cells, and with the increase in drug concentration, the cell inhibition rate at 48 hours was higher.

[0157] The above description relates to the idiopathic pulmonary fibrosis molecular inhibitor of the present invention, which targets the G protein-coupled receptor CCR2, and the molecular inhibitor is a double-pocket inhibitor that can bind to the orthosteric binding site and allosteric binding site of CCR2 respectively. The molecular inhibitor can slow down the process of pulmonary fibrosis by inhibiting CCR2.

[0158] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments. The above embodiments and the descriptions in the specification only illustrate the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements fall within the scope of the present invention claimed. The scope of the present invention claimed is defined by the appended claims and their equivalents.

Claims

1. An idiopathic pulmonary fibrosis inhibitor, characterized in that: The molecular inhibitors include compound HO11553 and / or compound HO11552; The molecular structure of compound HO11553 is: The molecular structure of compound HO11552 is:

2. The idiopathic pulmonary fibrosis inhibitor according to claim 1, characterized in that The molecular inhibitor includes compound HO11553-TM and / or compound HO11552; compound HO11553-TM is the hydrochloride salt of compound HO11553; The molecular structure of compound HO11553-TM is:

3. The idiopathic pulmonary fibrosis inhibitor according to claim 1 or 2, characterized in that The molecular inhibitor targets the G protein-coupled receptor CCR2.

4. The idiopathic pulmonary fibrosis inhibitor according to claim 3, characterized in that The molecular inhibitor inhibits the G protein-coupled receptor CCR2 via the PI3KCalss IB pathway.

5. The idiopathic pulmonary fibrosis inhibitor according to claim 3, characterized in that The G protein coupled receptor CCR2 has an orthosteric binding site located on the outside of the membrane cell and an allosteric binding site located on the inside of the membrane cell; among the molecular inhibitors, the compound HO11553 and the compound HO11552 bind to the orthosteric binding site and the allosteric binding site of CCR2 respectively.

6. The idiopathic pulmonary fibrosis inhibitor according to claim 1, characterized in that It also includes pharmaceutically acceptable carriers and excipients.

7. Use of the idiopathic pulmonary fibrosis inhibitor according to claim 1 in the preparation of a drug for treating idiopathic pulmonary fibrosis.

Images