A mutant of f protein of respiratory syncytial virus, combinations thereof and uses thereof

Abstract

The application discloses a F protein mutant of respiratory syncytial virus, a combination thereof and application thereof. The amino acid sequence of the F protein mutant comprises one or more mutations selected from disulfide bond mutation, cavity filling mutation, electrostatic mutation, proline mutation and N-linked glycosylation mutation, relative to the amino acid sequence of wild type F protein of respiratory syncytial virus. The application also discloses nucleic acid comprising the F protein mutant or the combination containing the same, and application thereof in preparing a medicine (such as mRNA vaccine) for preventing diseases caused by respiratory syncytial virus. The application effectively improves the stability of the pre-fusion conformation of the F protein, and improves the protection efficacy of the RSV vaccine.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of mRNA vaccines, and particularly relates to a F protein mutant of respiratory syncytial virus, a combination thereof and application thereof. BACKGROUND

[0002] Respiratory syncytial virus (RSV) is one of the important respiratory viral infections worldwide, which is the most important cause of acute lower respiratory tract infections (ALRIs) in early infants and children. From the development of formalin-inactivated whole-virus RSV preparation (FI-RSV) in the 1960s to the first RSV vaccine Arexvy (preF / monovalent / single immunization) developed by GSK in 2023, which is used for preventing lower respiratory tract diseases caused by RSV in people aged 60 years and older, RSV vaccine has undergone a long development process. In the same year, the FDA approved the Pfizer RSV bivalent vaccine Abrysvo (preF / bivalent / single immunization) for marketing. The RSV vaccines of GSK and Pfizer are both subunit vaccines targeting the pre-fusion conformation of RSV F protein antigen. At present, the mature technology of RSV vaccine is mostly recombinant protein vaccine technology route, and the fastest progress of RSV mRNA vaccine is Moderna mRNA-1345 (mRNA preF / monovalent / single immunization), but its efficacy is worse than that of GSK's Arexvy (efficacy of 2 or more symptoms: 83.7%<94.1%).

[0003] At present, the RSV vaccine of the prior art still has the following defects:

[0004] (1) The protection efficacy of the RSV monovalent vaccine can be insufficient

[0005] The RSV F protein is relatively conserved among RSV strains. The amino acid homology of the F protein in serum subtype A is 96.1%–100%, while that in serum subtype B is 97.9%–100%. The amino acid homology between serum subtypes A and B is 88.3%–90.9%. The F gene nucleic acid exhibits numerous substitution mutations, most of which are nonsense mutations. Therefore, the F protein can induce cross-protective immunity and is most effective in inducing neutralizing antibodies. The GSK Arexvy and Moderna mRNA-1345 vaccines, which are already on the market or under development, are both monovalent RSV F protein vaccines (A2 strain). Although they provide protective immunity against the B subtype, a study found (Michelle C. Crank et al., A proof of concept for structure-based vaccine design targeting RSV in humans. Science 365, 505-509 (2019). DOI:10.1126 / science.aav9033) that their protective immunity is about 4 to 5 times lower than that against the A subtype.

[0006] (2) There is still room for improvement in the pre-fusion conformational stabilization technology of F protein.

[0007] The F protein exists in two conformations—pre-F and post-F. Pre-F is a metastable structure; it transforms into the stable Post-F after viral fusion with a cell. This transformation can also occur spontaneously, triggered by various factors such as temperature and osmotic pressure. Studies have identified six antigenic sites (Ø and I to V) in the pre- and / or post-fusion F proteins. Epitopes II and IV are present in both pre- and post-fusion F proteins, while V and Ø are specific antigenic sites in the pre-fusion F protein, which are absent in the post-fusion F protein. Most RSV neutralizing activities in serum target only the pre-fusion F protein antigenic sites. Therefore, to enhance the stimulation of potent antibodies, vaccine sequences are designed with soluble variants of RSV F that stably expose the antigenic site Ø. Common stabilization techniques include introducing novel disulfide bond mutations and cavity-filling mutations, such as DS-Cav1 (manufacturer: NIAID, subunit vaccine).

[0008] In 2016, researchers Zhang L, Flynn JA, and others (Flynn JA, Durr E, Swoyer R, Cejas PJ, Horton MS, Galli JD, Cosmi SA, Espeseth AS, Bett AJ, Zhang L. Stability Characterization of a Vaccine Antigen Based on the Respiratory Syncytial Virus Fusion Glycoprotein. PLoS One. 2016 Oct 20;11(10):e0164789. doi:10.1371 / journal.pone.0164789.) evaluated the stability of DS-Cav1 using D25 and 4D7 antibody detection methods. The results showed that after long-term storage at 4°C (after 14 or 102 days), DS-Cav1 underwent a conformational change, adopting a substitute structure, losing the Ø epitope, and gaining the ability to bind 4D7. This indicates that the structural integrity of DS-Cav1 is compromised when stored at 4°C. Therefore, to enhance the stability of the F protein structure, further iterative structural optimization and improvement are needed. Summary of the Invention

[0009] To address the technical problems of insufficient protective efficacy and conformational instability of the F protein before fusion in existing RSV vaccines, this invention provides a mutant of the F protein of respiratory syncytial virus, its combination, and its application.

[0010] This invention effectively improves the stability of the F protein's pre-fusion conformation by using one or more combinations of disulfide bond mutations, cavity-filling mutations, electrostatic mutations, proline mutations, and N-linked glycosylation mutations, as well as artificial modification techniques such as sequence truncation or sequence deletion.

[0011] The respiratory syncytial virus (RSV) mRNA vaccine provided by the present invention contains RNA encoding the RSV F glycoprotein or a variant thereof, and the vaccine can prevent RSV infection and its complications.

[0012] The present invention also provides a composition of RSV F protein or its encoding mRNA, comprising or encoding two RSV F protein variants expressing two stable pre-fusion conformations, which can efficiently induce neutralizing antibody responses against RSV subtypes A and B. The two F proteins are derived from major globally circulating strains, strains A23, B6, or other A and B subtype strains.

[0013] To solve the above-mentioned technical problems, the present invention provides the following technical solutions:

[0014] One of the technical solutions of the present invention is a mutant F protein of respiratory syncytial virus, wherein the amino acid sequence of the mutant F protein contains one or more mutations selected from disulfide bond mutation, cavity filling mutation, electrostatic mutation, proline mutation and N-linked glycosylation mutation relative to the amino acid sequence of wild-type F protein of respiratory syncytial virus.

[0015] The mutants used in this article refer to sequences that contain one or more of the following mutations relative to the wild-type F protein of respiratory syncytial virus: sequence truncation, site mutation; site mutation refers to a mutation that can carry one or more amino acid mutations, such as deletion, insertion or substitution, replacement or substitution. Preferably, the mutation is a substitution.

[0016] In a specific embodiment of the present invention, the mutation is selected from:

[0017] a) Disulfide bond mutation;

[0018] b) Abrupt change in cavity filling;

[0019] c) Electrostatic sudden change;

[0020] d) Proline mutation;

[0021] e) N-linked glycosylation mutations;

[0022] f) A combination of at least one disulfide bond mutation, at least one cavity-filling mutation, and at least one electrostatic mutation;

[0023] g) A combination of at least one disulfide bond mutation, at least one cavity-filling mutation, and at least one proline mutation;

[0024] h) a combination of at least one disulfide bond mutation, at least one cavity-filling mutation, at least one electrostatic mutation, and at least one proline mutation; and,

[0025] i) A combination of at least one disulfide bond mutation, at least one cavity-filling mutation, at least one electrostatic mutation, at least one proline mutation, and at least one N-linked glycosylation mutation.

[0026] In a specific embodiment of the present invention, the mutation satisfies one or more of the following conditions:

[0027] (1) The disulfide bond mutation includes one or more amino acid residues selected from the 102nd, 243rd, 490th, 494th and 495th amino acid residues being mutated to C;

[0028] (2) The cavity-filling mutation includes one or more selected from the mutation of amino acid residue I at position 179, mutation of amino acid residue Y at position 213, and mutation of amino acid residue L at position 301;

[0029] (3) The electrostatic mutation includes the mutation of the 238th amino acid residue to H, and / or the 54th amino acid residue to E;

[0030] (4) The proline mutation comprises one or more amino acid residues selected from 213, 215, and 217 being mutated to P; and,

[0031] (5) The N-linked glycosylation mutation includes one or more amino acid residues selected from 172, 180, 398, 253, 372, 402 and 491 that are mutated to N.

[0032] It is known in the art that the amino acid homology of the F protein within the RSV AB subtype is >95%, and the amino acid homology between the A and B subtypes is 88.3%–90.9%, which is relatively conserved. Specifically, the nucleotide (amino acid) homology of the RSV F protein within the A and B subtypes is high, at 95.9%–100% (98.3%–100%) and 97.5%–100% (98.7%–100%), respectively, with inter-subtype homology of 83.2%–84.9% (93.1%–95.1%) (Reference: DOI: 10.3760 / cma.j.issn.1003-9279.2015.05.006). Furthermore, the full-length F protein sequence of both RSV A and B subtypes is 574 aa, thus ensuring that the mutant site corresponds to the same position in different strains. In published preclinical and clinical articles, although Pre-F mutants are mostly mutated using the A2 strain, the results show cross-protective efficacy across different subtypes. This invention investigated the design of the same mutation site in the F protein of four strains: A2, B18537, A23 (GenBank: MZ221197.1, OR666571.1), and B6 (GenBank: MW587044.1, OR666608.1). Experimental results showed that all mutations induced comparable immune responses and antibody levels. Therefore, those skilled in the art can reasonably expect that the aforementioned mutation method of this invention can be suitable for the F protein of all respiratory syncytial viruses.

[0033] The amino acid and nucleotide sequences of the wild-type F protein of respiratory syncytial virus can be retrieved in a manner well known to those skilled in the art, such as from the National Center for Biotechnology Information (NCBI).

[0034] In a specific embodiment of the present invention, the amino acid sequence of the F protein mutant contains a disulfide bond mutation relative to the amino acid sequence of the wild-type F protein of respiratory syncytial virus, wherein the disulfide bond mutation comprises a C mutation at amino acid residues at positions 102 and 243, 490 and 494, or 490 and 495.

[0035] In a specific embodiment of the present invention, the amino acid sequence of the F protein mutant includes disulfide bond mutations, cavity filling mutations, and electrostatic mutations relative to the amino acid sequence of the wild-type F protein of respiratory syncytial virus.

[0036] In a specific embodiment of the present invention, the mutation satisfies one or more of the following conditions:

[0037] (1) The disulfide bond mutations include mutations of amino acid residues at positions 102, 243, 490 and 495 to C;

[0038] (2) The cavity-filling mutation includes a mutation of amino acid residue 179 to I, amino acid residue 213 to Y, and amino acid residue 301 to L; and,

[0039] (3) The electrostatic mutation includes the mutation of amino acid residue 238 to H.

[0040] In a specific embodiment of the present invention, the amino acid sequence of the F protein mutant, relative to the amino acid sequence of the wild-type F protein of respiratory syncytial virus, includes the following mutations: amino acid residues at positions 102, 243, 490, and 495 are mutated to C; amino acid residue at position 179 is mutated to I; amino acid residue at position 213 is mutated to Y; amino acid residue at position 301 is mutated to L; and amino acid residue at position 238 is mutated to H.

[0041] In a specific embodiment of the present invention, the respiratory syncytial virus is an RSV A subtype strain or an RSV B subtype strain; and / or, the F protein mutant lacks the carboxyl-terminal tail domain of the wild-type F protein.

[0042] In this invention, the naming standard for RSV subtype genotypes follows academic conventions (classical names), such as strains Long, A2, B18537, RSN2, A23, ON1, BA9, etc. The RSV genotypes in this invention are named according to the RSV genotype classification and naming standards published by Ramaekers et al. 2020. doi: 10.1093 / ve / veaa052 (see Figure 3 in that literature). Some RSV strains still use classic names, such as subtype A strain A2. The RSV subtype strains are selected from A1, A2, A3, A4, A5, A6, A7, A8, A9, A10, A11, A12, A13, A14, A15, A16, A17, A18, A19, A20, A21, A22, and A23. In some embodiments, strain A2 is selected, and the globally prevalent strain A23 (or strain ON1) is preferred. The RSV B subtype strains are selected from B1, B2, B3, B4, B5, and B6. In some embodiments, strain B18537 is selected, and the globally prevalent strain B6 (or strain BA9) is preferred. The RSV F protein of this invention mainly comes from globally prevalent strains, subtype A strains ON1 and A23, and subtype B strains BA9 and B6, with subtype A strain A23 and subtype B strain B6 being particularly preferred.

[0043] In a specific embodiment of the present invention, the F protein mutant satisfies one or more of the following conditions:

[0044] (i) The RSV A subtype strain is selected from A1, A2, A3, A4, A5, A6, A7, A8, A9, A10, A11, A12, A13, A14, A15, A16, A17, A18, A19, A20, A21, A22 and A23, preferably A2 or A23;

[0045] (ii) The RSV B subtype strain is selected from B1, B2, B3, B4, B5, B6 and B18537, preferably B6 or B18537; and,

[0046] (iii) The carboxyl-terminal tail domain is the cytoplasmic tail region CT.

[0047] In this invention, the carboxyl-terminal tail domain comprises the native transmembrane region TM and cytoplasmic tail region CT of the wild-type F protein's C-terminus. In some embodiments, the cytoplasmic tail region CT comprises 25, 20, 15, or 10 amino acids from the C-terminus of the wild-type F protein, specifically some or all of the amino acids at positions 550-574 of the wild-type F protein. In some embodiments, the F protein mutant retains the native transmembrane region TM and cytoplasmic tail region CT of the wild-type F protein's F1 subunit C-terminus, or retains only the native transmembrane region TM.

[0048] In a specific embodiment of the present invention, the cytoplasmic tail region CT contains some or all of the amino acids at positions 550 to 574 of the wild-type F protein.

[0049] In a specific embodiment of the present invention, the F protein mutant comprises an amino acid sequence as shown in any of SEQ ID NO: 4~25.

[0050] In a specific embodiment of the present invention, the amino acid sequence of the F protein mutant is shown in any of SEQ ID NO: 4~25.

[0051] The second technical solution of the present invention is a combination of F proteins of respiratory syncytial virus, wherein the combination comprises one or more F proteins from the F protein mutants as described in the first technical solution, and one or more other F proteins of respiratory syncytial virus; or, the combination comprises two or more F proteins from the F protein mutants as described in the first technical solution.

[0052] In this invention, the "other respiratory syncytial virus F protein" refers to the respiratory syncytial virus F protein described in the F protein mutants not described in one of the technical solutions of this invention, including but not limited to the wild-type F protein of respiratory syncytial virus and the F protein mutants of respiratory syncytial virus disclosed in the prior art, such as the F protein mutant encoded by Moderna mRNA-1345 or DS-Cav1 of Zhang L et al. (2016).

[0053] In a specific embodiment of the present invention, the F protein of the other respiratory syncytial virus comprises any of the amino acid sequences shown in SEQ ID NO: 1-3 and SEQ ID NO: 26-28.

[0054] In a specific embodiment of the present invention, the amino acid sequence of the F protein of the other respiratory syncytial virus is as shown in any one of SEQ ID NO: 1~3 and SEQ ID NO: 26~28.

[0055] In a specific embodiment of the present invention, the combination comprises at least one F protein derived from an RSV A subtype strain and at least one F protein derived from an RSV B subtype strain.

[0056] In a specific embodiment of the present invention, the combination comprises an F protein derived from the A23 strain and an F protein derived from the B6 strain; or, the combination comprises an F protein derived from the A2 strain and an F protein derived from the B18537 strain.

[0057] In this invention, "F protein derived from..." refers to an F protein whose sequence is directly derived from the wild-type sequence of the subtype (or strain), or obtained by modification (e.g., mutation) based on the wild-type sequence of the subtype (or strain). That is, the "F protein" can be a wild-type F protein or an F protein mutant.

[0058] In a specific embodiment of the present invention, the combination comprises: an F protein mutant comprising the amino acid sequence shown in SEQ ID NO: 23 and an F protein mutant comprising the amino acid sequence shown in SEQ ID NO: 25; or, the combination comprises: an F protein mutant comprising the amino acid sequence shown in SEQ ID NO: 22 and an F protein mutant comprising the amino acid sequence shown in SEQ ID NO: 24.

[0059] In a specific embodiment of the present invention, the combination comprises an F protein mutant with an amino acid sequence as shown in SEQ ID NO: 23 and an F protein mutant with an amino acid sequence as shown in SEQ ID NO: 25; or, the combination comprises an F protein mutant with an amino acid sequence as shown in SEQ ID NO: 22 and an F protein mutant with an amino acid sequence as shown in SEQ ID NO: 24.

[0060] In a specific embodiment of the present invention, the F protein mutant is tandemly linked by a 2A peptide.

[0061] In this invention, the 2A peptide, namely the self-cleaving polypeptide 2A, is derived from short viral peptides (~18-25 amino acids). These are commonly referred to as "self-cleaving" peptides, capable of producing multiple proteins from a single transcript. The earliest self-cleaving 2A peptide identified was derived from foot-and-mouth disease virus (FMDV). 2A peptides are widely used for the simultaneous expression of multiple genes on a single vector, often serving as polypeptide cleavage signals. In some embodiments, the 2A peptide is a viral self-cleaving polypeptide selected from the group consisting of: foot-and-mouth disease virus (FMDV) (F2A) peptide, equine rhinitis virus type A (ERAV) (E2A) peptide, those of the tussock moth β tetrasomal virus (TaV) (T2A) peptide, porcine tympany virus-1 (PTV-1) (P2A) peptide, Theile virus 2A peptide, and encephalomyocarditis virus 2A peptide. Preferred 2A peptides are P2A and T2A. The sequences of P2A, T2A, E2A, and F2A are shown in Table I below:

[0062] Table I. Sequence of peptide 2A

[0063]

[0064] Note that adding a GSG sequence to the N-terminus of the 2A peptide can improve cleavage efficiency.

[0065] In a specific embodiment of the present invention, the 2A peptide is selected from one or more of F2A peptide, E2A peptide, T2A peptide, P2A peptide, Theylvirus 2A peptide, and encephalomyocarditis virus 2A peptide; and / or, the N-terminus of the 2A peptide further comprises a GSG sequence.

[0066] In a specific embodiment of the present invention, the amino acid sequence of the T2A peptide is shown in SEQ ID NO: 57, the amino acid sequence of the P2A peptide is shown in SEQ ID NO: 58, the amino acid sequence of the E2A peptide is shown in SEQ ID NO: 59, or the amino acid sequence of the F2A peptide is shown in SEQ ID NO: 60.

[0067] The third technical solution of the present invention is a respiratory syncytial virus antigen combination, wherein the antigen combination comprises the F protein mutant as described in the first technical solution or the combination of the F protein of respiratory syncytial virus as described in the second technical solution, and other RSV antigen fragments.

[0068] In this invention, "other RSV antigen fragments" refers to other RSV antigen fragments that are not RSV F proteins.

[0069] In a specific embodiment of the present invention, the other RSV antigen fragments comprise one or more selected from attachment protein G, small hydrophobic protein SH, nucleocapsid protein N, and matrix protein M2-1.

[0070] The fourth technical solution of the present invention: an isolated nucleic acid, said nucleic acid comprising a nucleotide sequence encoding a combination of the F protein mutant as described in the first technical solution, the F protein of the respiratory syncytial virus as described in the second technical solution, or an antigen combination as described in the third technical solution.

[0071] In this invention, after the RSV F protein is engineered, the nucleic acid sequence can be optimized using publicly available or independently developed coding gene codon optimization programs and mRNA sequence optimization programs, thereby improving the stability of the mRNA sequence, extending the half-life of the mRNA sequence, increasing the protein expression level in vitro and in vivo, and thus enhancing the immunogenicity and neutralizing protective efficacy of the antigen.

[0072] In a specific embodiment of the present invention, the nucleic acid further comprises a 5'UTR and / or a 3'UTR, preferably the 5'UTR and / or 3'UTR are derived from the Pfizer bivalent expression vector BNT162b2 (whose RNA sequence may be as shown in SEQ ID NO: 61 and SEQ ID NO: 62, respectively); and / or, the nucleic acid further comprises a polyA tail, preferably the polyA tail being 50-150 or longer.

[0073] In a specific embodiment of the present invention, the nucleic acid is DNA.

[0074] In a specific embodiment of the present invention, the DNA can be transcribed into RNA containing one or more nucleotide sequences as shown in SEQ ID NO: 32-53.

[0075] In a specific embodiment of the present invention, the DNA can be transcribed into RNA with nucleotide sequences such as one or more of the sequences shown in SEQ ID NO: 32-53.

[0076] In a specific embodiment of the present invention, the nucleic acid further includes a promoter; for example, the T7 promoter.

[0077] In a specific embodiment of the present invention, the nucleic acid is RNA, preferably mRNA.

[0078] In a specific embodiment of the present invention, the nucleic acid encoding the F protein mutant comprises a nucleotide sequence as shown in any of SEQ ID NO: 32-53.

[0079] In a specific embodiment of the present invention, the nucleotide sequence of the nucleic acid encoding the F protein mutant is shown in any one of SEQ ID NO: 32-53.

[0080] In a specific embodiment of the present invention, the nucleic acid encoding the F protein of the other respiratory syncytial virus comprises a nucleotide sequence as shown in any of SEQ ID NO: 29-31 and SEQ ID NO: 54-56.

[0081] In a specific embodiment of the present invention, the nucleotide sequence of the nucleic acid encoding the F protein of the other respiratory syncytial virus is shown in any one of SEQ ID NO: 29~31 and SEQ ID NO: 54~56.

[0082] In a specific embodiment of the present invention, the nucleic acid further comprises a 5' cap structure, such as 7mG(5')ppp(5')N1mpNp cap.

[0083] In a specific embodiment of the present invention, the nucleic acid further includes modifications, such as pseudouridine (Ψ) and / or N1-methylpseudouridine (m1Ψ) modifications.

[0084] In some embodiments, the nucleic acid is a messenger ribonucleic acid (mRNA) or a combination thereof, comprising a heterologous 5' untranslated region (5'-UTR) and / or a heterologous 3' untranslated region (3'-UTR); and one or two coding sequences operatively linked to the 3'-UTR and / or 5'-UTR, encoding at least one antigenic peptide or protein derived from an RSV fusion (F) protein or a fragment or variant thereof.

[0085] In some embodiments, the 3' end of the 3' untranslated region (3'-UTR) of the RNA or its composition is attached to a poly-A tail, which is 50-150 or longer.

[0086] In some implementations, the 5' end of the 5' untranslated region (5'-UTR) of DNA capable of being transcribed into RNA or a combination thereof is linked to an RNA polymerase promoter sequence, such as the T7 promoter.

[0087] In some implementations, the RNA also contains a 7mG(5')ppp(5')N1mpNp cap.

[0088] Fifth technical solution of the present invention: a recombinant expression vector, wherein the recombinant expression vector comprises the nucleic acid as described in fourth technical solution.

[0089] The sixth technical solution of the present invention: a transformant comprising the nucleic acid as described in the fourth technical solution or the recombinant expression vector as described in the fifth technical solution; the transformant is a non-animal or non-plant variety.

[0090] In a specific embodiment of the present invention, the host cell of the transformant is a eukaryotic cell or a prokaryotic cell.

[0091] In a specific embodiment of the present invention, the prokaryotic cell is a bacterium, such as Escherichia coli.

[0092] The seventh technical solution of the present invention: a lipid nanoparticle (LNP), wherein the lipid nanoparticle contains nucleic acid as described in the fourth technical solution.

[0093] The RNA of the present invention may also comprise a lipid mixture comprising PEG-modified lipids, non-cationic lipids, sterols, ionizable cationic lipids, or any combination thereof. The lipid mixture encapsulates the RNA to form lipid nanoparticles (e.g., mRNA-LNP formulations).

[0094] In some embodiments, the RNA comprises an RNA polynucleotide having an open reading frame encoding at least one antigenic protein with at least one modification, at least one 5' cap, and is formulated within a lipid mixture. The lipid nanoparticles typically comprise ionizable cationic lipids, non-cationic lipids, sterols, and PEG lipid components, as well as the target nucleic acid molecule.

[0095] The lipid nanoparticles described herein can stably express RSV F protein in its pre-fusion conformation in animal models and in the human body. After expression, F protein can form monomers, polymers, trimers, etc., and induce neutralizing antibody responses against RSV in subjects.

[0096] The eighth technical solution of the present invention: a pharmaceutical composition comprising one or more selected from the F protein mutants described in the first technical solution, the combination of F proteins of respiratory syncytial virus described in the second technical solution, the antigen combination described in the third technical solution, the nucleic acid described in the fourth technical solution, and the lipid nanoparticles described in the seventh technical solution, as well as a pharmaceutically acceptable carrier.

[0097] The pharmaceutical compositions of the present invention can be solutions with or without a buffer solution or compositions containing a pharmaceutically acceptable carrier. In this invention, the pharmaceutical compositions can be administered in a solution. This can be done in a non-buffered solution, such as in physiological saline or in water. Alternatively, they can be administered in a suitable buffered solution. This buffer solution may include acetate, citrate, alcohol-soluble gluten, carbonate, or phosphate, or any combination thereof. In a preferred embodiment, the buffer solution is phosphate-buffered saline (PBS). The pH and volumetric molar osmotic pressure concentration of the buffer solution of the pharmaceutical composition can be adjusted to make it suitable for administration to a subject.

[0098] In some embodiments, the buffer solution further comprises a reagent for controlling the molar osmotic pressure concentration of the solution, such that the molar osmotic pressure concentration is maintained at a desired value, such as the physiological value in human plasma. Solutes that can be added to the buffer solution to control the molar osmotic pressure concentration include (but are not limited to) proteins, peptides, amino acids, non-metabolitic polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the reagent for controlling the molar osmotic pressure concentration of the solution is a salt. In some embodiments, the reagent for controlling the molar osmotic pressure concentration of the solution is sodium chloride or potassium chloride.

[0099] The ninth technical solution of the present invention is the use of one or more of the following in the preparation of a medicament for preventing diseases caused by respiratory syncytial virus: the F protein mutant as described in technical solution one, the combination of F proteins of respiratory syncytial virus as described in technical solution two, the antigen combination as described in technical solution three, the nucleic acid as described in technical solution four, the lipid nanoparticles as described in technical solution seven, and the pharmaceutical composition as described in technical solution eight.

[0100] In a specific embodiment of the present invention, the drug is a vaccine, such as an mRNA vaccine.

[0101] As used herein, “illness caused by respiratory syncytial virus” is intended to include any illness associated with respiratory syncytial virus infection. Exemplary illnesses caused by respiratory syncytial virus include upper respiratory tract infections, lower respiratory tract infections (such as bronchiolitis or pneumonia), viral otitis media, asthma or wheezing-related illnesses, chronic lung disease, or other possible complications.

[0102] This invention discloses the use of the aforementioned product as a vaccine for the defense against RSV infection. In some embodiments, an mRNA-LNP vaccine is prepared by mixing mRNA compositions encoding the F proteins of two RSV subtypes, or by inserting the coding sequence (CDS) of the F protein genes encoding subtypes A and B into a complete mRNA sequence. This mRNA-LNP vaccine can effectively defend against infection by RSV subtypes A and B, exhibiting neutralizing antibody potency comparable to or better than that against subtype A against subtype B.

[0103] In some implementations, an mRNA-LNP formulation vaccine is prepared by mixing mRNA compositions encoding two subtypes of RSV fusion pre-F protein.

[0104] In some embodiments, the RSV bivalent mRNA vaccine of the present invention comprises coding region sequences encoding F proteins from two RSV subtype strains, the subtype strains being selected from classic strains (or genotypes) or from RSV epidemic strains (or genotypes) at a certain period, preferably the globally prevalent subtype A strain A23 and subtype B6.

[0105] In some implementations, the mRNA sequence of the RSV bivalent mRNA vaccine may contain only the coding region of one F protein, or it may be two coding regions of F proteins tandemly through a self-cleaving polypeptide 2A sequence (2A peptide). The mRNA of a single F protein from different subtypes is encapsulated using an LNP encapsulation process of "encapsulation before mixing" or "mixing before encapsulation" to form the mRNA-LNP formulation of the RSV bivalent vaccine.

[0106] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0107] The reagents and raw materials used in this invention are all commercially available.

[0108] The positive and progressive effects of this invention are as follows:

[0109] (1) To enhance the stability of the pre-fusion conformation of the stable F protein, this invention encodes an RSV F protein variant that stabilizes the pre-fusion conformation. This variant effectively improves the stability of the pre-fusion conformation of the F protein through one or more combinations of disulfide bond mutations, cavity-filling mutations, electrostatic mutations, proline mutations, and N-linked glycosylation mutations, as well as artificial modification techniques such as sequence truncation or deletion. Furthermore, codon optimization of the mRNA nucleic acid sequence increases the protein expression level of the sequence.

[0110] (2) In order to enhance the immunoprotective efficacy of RSV vaccine against RSV A and B serotypes, the present invention novelly combines the F protein of subtypes A and B to form a bivalent vaccine, which not only efficiently expresses the pre-fusion F protein that can induce the production of neutralizing antibodies against RSV A subtype strains, but also efficiently expresses the pre-fusion F protein that can induce the production of neutralizing antibodies against RSV B subtype strains, thus overcoming the problem of insufficient neutralizing antibody titer in subtype B of monovalent vaccines. In particular, the neutralizing antibody response of subtype B is equal to or equivalent to that of subtype A.

[0111] (3) As a preventive vaccine, the RSV F protein bivalent mRNA vaccine overcomes the disadvantages of recombinant protein subunit vaccines, such as low immunoprotective efficacy, high side effects, and dependence on adjuvants to enhance immunoprotective efficacy. Attached Figure Description

[0112] Figure 1 This diagram illustrates RSV F glycoprotein variants and wild-type RSV F glycoprotein; where arrows indicate furin cleavage; SP represents the signal peptide; p27 indicates the removal of the 27aa peptide after cleavage; FP represents the fusion peptide; HRA and HRB represent heptapeptide repeat sequences A and B; TM represents the transmembrane region; and CT represents the cytoplasmic tail region.

[0113] Figure 2 The positive rates of pre-F and post-F sequences of F protein mutant mRNA were determined by FCM.

[0114] Figure 3 The positive rate of total-F in F protein mutant mRNA sequence was determined by FCM.

[0115] Figure 4 MFI values ​​of pre-F and post-F of F protein mutant mRNA sequences were determined using FCM.

[0116] Figure 5 The MFI value of total-F of the F protein mutant mRNA sequence was detected by FCM.

[0117] Figure 6 To detect the positive rate of pre-F and post-F of F protein multi-site mutant mRNA sequences in FCM.

[0118] Figure 7 The positive rate of total-F in the F protein multi-site mutant mRNA sequence was determined by FCM.

[0119] Figure 8 MFI of pre-F and post-F mRNA sequences of multi-site mutant F protein was detected by FCM.

[0120] Figure 9MFI of total-F mRNA sequence for F protein multi-site mutants was detected by FCM.

[0121] Figure 10 The FRNT50 method was used to detect the IU / mL value of serum neutralizing antibodies against RSV-A1 and RSV-B1 / 18537. Detailed Implementation

[0122] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0123] Example 1: RSV pre-F protein design

[0124] The RSV F protein, encoded by the F gene, is initially synthesized as a single polypeptide precursor of approximately 574 amino acids, called F0. This protein contains a signal peptide (SP, aa 1-20), a signal peptide cleavage site (aa 21-25), a p27 peptide (p27), a fusion peptide (FP), heptapeptide repeat A (HRA), heptapeptide repeat B (HRB), a transmembrane peptide (TM), and a CT domain. The F protein exists in two conformations—pre-F and post-F. Pre-F is a metastable structure; it transforms into the stable Post-F after viral fusion with a cell. This transformation can also occur spontaneously, triggered by various factors such as temperature and osmotic pressure. Studies have found that Pre-F possesses more antibody-binding epitopes and is more effective in inducing neutralizing antibodies (NAb), accounting for over 90% of the specific neutralizing activity of human F, making it the preferred antigen for vaccine development. However, Pre-F is an unstable structure, so protein modification or alteration is required to make it more stable in the Pre-F conformation.

[0125] Therefore, based on the important structural domains and functions of the F protein, this invention designs a series of mRNA antigens targeting mutations in key structural and functional domains and truncated forms of the F protein. For example... Figure 1 As shown.

[0126] Using the wild-type F gene sequence of RSV virus (reference NCBI virus strain MZ221197.1) as a reference, a series of 25 different F mutant mRNA sequences were designed:

[0127] Table 1 summarizes the amino acid sequences and nucleotide sequences of mRNA encoding variant F antigens with different mutations. In the table, mRNA-RSV-1345 and mRNA-RSV-ds-cav1 correspond to the corresponding mutations or combinations of mutations in the published patents (CN115103682A and CN105473604B), respectively.

[0128] Table 1 RSV mRNA vaccine F protein antigen

[0129]

[0130]

[0131]

[0132] Example 2: Preparation of RSV F antigen mRNA vaccine formulation

[0133] Construction of the cloning plasmid: The target plasmid was constructed using an enzyme digestion and ligation method. Enzyme restriction sites were introduced at both ends of the target fragment using primers and PCR amplification. Both the target fragment and the vector (Thermo Fisher Scientific) were digested with the same restriction endonuclease (Yisheng). The digestion products of the target fragment and the vector were ligated in vitro using DNA ligase (Yisheng). The ligation product containing the newly inserted gene and the vector was transformed into *E. coli* (Thermo Fisher Scientific). The transformed bacterial culture was plated on a plate containing antibiotics (Sangon Biotech) for selection, and recombinant clones were obtained through screening and identification.

[0134] mRNA preparation: In vitro synthesis (IVT) of mRNA was performed on linearized plasmids using T7 RNA polymerase (Yisheng). The mRNA encodes a codon-optimized RSV F protein, and the transcribed mRNA contains two untranslated regions and a poly(A) tail. The 5' and 3' UTRs of the untranslated regions and the poly(A) tail sequence used the same sequences as those from the Biotech / Pfizer mRNA COVID-19 vaccine BNT162b2. mRNA containing modified nucleosides was generated by replacing uridine triphosphate (UTP) with 1-methylpseudouridine-5'-triphosphate (Yisheng). The prepared mRNA was purified and analyzed by agarose gel electrophoresis.

[0135] 5'UTR (SEQ ID NO: 61):

[0136] GAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC

[0137] 3'UTR (SEQ ID NO: 62):

[0138] CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGC ACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC

[0139] Preparation of mRNA-LNP formulation: mRNA was encapsulated in LNPs in a self-assembled form using a microfluidic device (Pengzan, LNP-S1-L). Four lipid components—ionizable cationic lipids, cholesterol, DSPC, and PEGylated lipids (Avitol)—were dissolved in ethanol at a molar ratio of 50:38.5:10:5. The mRNA was dissolved in citrate (Sangon Biotech) buffer. The mRNA aqueous solution and lipid ethanol solution were rapidly mixed using a microfluidic chip. The prepared LNPs were then exchanged and concentrated using phosphate-buffered saline (PBS, Sangon Biotech).

[0140] Example 3: Determination of F protein expression levels in cells

[0141] To verify whether the designed antigen mRNA sequence can be expressed in cells and the efficiency of expression of different antigen sequences, the mRNA sequence was first transfected into cells, and flow cytometry (FCM) was used to detect the expression of antigen mRNA in cells.

[0142] Experimental Principle: The RSV virus fusion protein (F) exhibits a pre-to-post conformational transition, resulting in three conformations: pre-F (pre-fusion), intermediate, post-F (post-fusion), and pre-F trimer. To identify these different conformations, the structure of the F protein and its antibodies were investigated. At least seven completely different antigenic epitopes were discovered on the protein surface, and antibodies binding to these epitopes were successfully screened: φsite_D25 / 5C4 / AM22, I site_131-2A / 2F, II site_Motavizumab / Palivizumab, III site_MPE8, IV site_101F / mAb19, and V site_hRSV90. Among them, the 101F antibody recognizing epitope IV, the Palivizumab antibody recognizing epitope II, and the 131-2A antibody recognizing epitope I can simultaneously recognize both the pre- and post-conformations of the F protein and can be used as antibodies for detecting total F protein / Total-F. The D25 antibody recognizing epitope φ or the hRSV90 antibody recognizing epitope V binds only to the pre-conformation of the F protein and can be used as antibodies for detecting pre-F. The MPE8 antibody recognizing epitope III prefers to recognize the pre-conformation and has weaker binding activity to the post-conformation. The monoclonal antibody AM14 recognizes an antigenic epitope located in the near-equatorial region of the F-pre protein, spanning two monomers, and can specifically recognize the Trimer structure. The 4D7 monoclonal antibody can simultaneously recognize post-F or the intermediate conformation of the F protein and can be used as an antibody for detecting non-pre-F. In this experiment, Palivizumab, D25, and 4D7 were selected to detect Total-F, pre-F, and post-F, respectively, providing a basis for in vitro screening of mRNA sequences encoding F protein antigens.

[0143] Experimental materials:

[0144] Table 2. Main experimental materials, instruments and their sources

[0145]

[0146] (a) Cell transfection

[0147] Cell plating: Collect 1×10⁻⁶ cells one day in advance. 5 100,000 cells in the logarithmic growth phase were seeded into 24-well cell culture plates, and DMEM medium containing antibiotics + 10% FBS was added to 0.5 mL. The cells were mixed and incubated overnight in a cell culture incubator at 37°C and 5% CO2.

[0148] On the second day, mRNA-LNP Mixture was prepared according to Example 2. 50 μL of mRNA-LNP Mixture was evenly dropped into each cell well according to the prescribed transfection dose. At the same time, the untransfected group was set as the negative control group. The mixture was shaken evenly using the cross-shaking method.

[0149] The cell culture plates were incubated in a cell culture incubator at 37°C and 5% CO2.

[0150] (ii) Flow cytometry (FCM) method

[0151] (1) Cell collection: After 24 h of transfection incubation, the cells were washed with 5 mL of PBS and 80 μL of trypsin was added to each well to digest the cells. An equal volume of complete culture medium was added to stop the digestion, and the cells were collected into 96-well plates.

[0152] (2) Cell separation: Use a pipette to evenly separate the cells in each well of the plate into two other clean 96-well plates;

[0153] (3) Cell washing: Add 250 μL PBS to each tube of the 96-well plate and centrifuge at 4 ℃ and 600g for 5 min in a plate centrifuge; carefully remove the 96-well plate after centrifugation and use the aspiration mode of the 96-well plate washer to aspirate the liquid in the wells.

[0154] (4) Preparation of primary antibody working solution: Prepare primary antibody working solution by mixing Palivizumab / D25 / 4D7 antibody and Cell Staining Buffer at a ratio of 2 μL antibody + 100 μL per tube;

[0155] (5) Primary antibody incubation: Add different primary antibody working solutions at 100 μL / well to the corresponding 96-well plates using a pipette, gently resuspend and mix the cells by vortexing, and incubate at 4℃ for 30 min.

[0156] (6) Cell washing: Add 200 μL / well of PBS using a pipette, centrifuge at 600g and 4ºC for 5 min; carefully remove the 96-well plate after centrifugation and use a 96-well plate washer in aspiration mode to aspirate the liquid from the wells.

[0157] (7) Preparation of secondary antibody working solution: Prepare Palivizumab / D25 secondary antibody working solution by mixing Goat Anti-Human IgG-FITC antibody and Cell Staining Buffer at a ratio of 1 μL + 100 μL; Prepare 4D7 secondary antibody working solution by mixing Goat Anti-Mouse IgG-Elab Fluor® 488 antibody and Cell Staining Buffer at a ratio of 4 μL + 100 μL per tube;

[0158] (8) Secondary antibody incubation: Add different secondary antibody working solutions at 100 μL / well to the corresponding 96-well plates using a pipette, gently resuspend and mix the cells by vortexing, and incubate at room temperature in the dark for 60 min.

[0159] (9) Cell washing: Add 200 μL / well of PBS using a pipette, centrifuge at 600g and 4ºC for 5 min; carefully remove the 96-well plate after centrifugation and use a 96-well plate washer in aspiration mode to aspirate the liquid from the wells.

[0160] (10) Detection on flow cytometer: Add 200 μL / well of PBS to the pipette, gently resuspend the cells by vortexing, and then use a flow cytometer to detect the content of Palivizumab+ / D25+ / 4D7+ cells and the corresponding evaluation fluorescence intensity (MFI) in the FITC channel. Determine the expression level of the mRNA sequence encoding the F protein in the cell line Total-F and the proportion of the pre-F and nonpre-F conformations of the F protein.

[0161] Example 4: Immunogenicity study of RSV mRNA vaccine in mice

[0162] Immunization and sampling of mice (Beijing Vital River Laboratory Animal Technology Co., Ltd. Hubei Branch). 6-8 week old BALB / c mice (n=6) were intramuscularly immunized with RSV F variant mRNA-LNP at days 0 and 14. Serum titers of neutralizing antibodies and IgG antibodies were collected at days 14 and 28.

[0163] Serum F protein-specific IgG antibody titers were determined by ELISA. An ELISA kit (Sino Bioscience) was used. RSV F protein solution was added to ELISA plates and incubated at 4°C for 12 hours. The next morning, the plates were washed three times with Wash Buffer, then blocked with blocking buffer at 37°C for 2 hours. After 2 hours, the plates were washed three times with Wash Buffer, then a series of diluted serum samples or controls were added and incubated at 37°C for 2 hours. After incubation, the plates were washed three times with Wash Buffer, then enzyme-labeled secondary antibody was added and incubated at 37°C for 2 hours. After 2 hours, the plates were washed three times with Wash Buffer, then substrate solution was added for color development, and incubated at room temperature. Finally, stop solution was added to terminate the color development reaction, and the absorbance at 450 nm was read (BioTek, Synergy H1).

[0164] RSV true virus neutralizing antibody titer determination. Neutralizing antibody detection was performed using the microcytopathic effect (CPE) assay. Cells were seeded in 96-well plates one day in advance for use the following day. Serum inactivation was performed by serially diluting the serum in the 96-well plates, with replicates for each sample. RSV virus (Wuhan Institute of Virology) was diluted to an appropriate concentration. The diluted virus solution was mixed with the diluted serum and incubated at 37°C for 1 hour. After 1 hour, the virus antibody incubation solution was transferred to a new 96-well cell culture plate, and cells were added. Negative cell wells and positive virus wells were also prepared. The plates were incubated at 37°C, and cytopathic effects were observed daily under a microscope. The CPE inhibition rate and IC50 were calculated based on the serum dilution that produced no cytopathic effects in 50% of the wells.

[0165] ELISPOT assay was performed to determine the secretion of cytokines by spleen cells. A commercially available ELISPOT kit (Daktech) was used for the assay. Mouse spleen cells were isolated and added to 96-well plates pre-coated with anti-cytokine antibodies. A peptide library was added for stimulation for 40 h. After 40 h, cells were lysed and the plates were washed six times. Diluted biotin-labeled antibody was then added to each well, and the plates were incubated at 37°C for 1 h. Afterward, the plates were washed again, and diluted enzyme-labeled avidin working solution was added to each well, and the plates were incubated at 37°C for 1 h. Afterward, the plates were washed again, and freshly prepared AEC chromogenic solution was added to each well. The plates were incubated at room temperature in the dark for 30 minutes. Finally, the chromogenic process was stopped, and the number of spots in each well was recorded (Mabtech, IRIS 2).

[0166] Comparison settings

[0167] The settings of this invention are as follows:

[0168] NC: Untransfected group;

[0169] Empty LNP: Blank LNP that does not carry an mRNA vaccine;

[0170] Comparative Example 1: Based on the RSV mRNA vaccine antigen sequence (mRNA-1345) reported in the literature (Wilson E, et al. 2023) and Moderna patent (CN115103682A), its antigen was found to be the F protein (1-549aa). Amino acids at positions 104-144 were replaced with GS, and mutations S155C-S290C, A149C-Y458C, S190F, V207L, and L373R were introduced to stabilize the pre-fusion conformation of the F protein. Based on this, this project designed mRNA-RSV-1345 (SEQ ID NO: 1), which maintains the same mutation sites and truncated length as the RSV mRNA vaccine antigen sequence (mRNA-1345) reported in Moderna patent (CN115103682A).

[0171] Comparative Example 2: Based on the RSV pre-F sequence mutant (DS-Cav1) reported in the literature (McLellan et al. 2013) and NIAID patent (CN105473604B), its antigen is found to be the F protein (1-513aa) with a T4 fibritin trimerization motif (foldon) added to the C-terminus. Mutations S155C-S290C, S190F, and V207L ​​are introduced to stabilize the pre-fusion conformation of the F protein. Based on this, this project designed mRNA-RSV-ds-cav1 (SEQ ID NO: 2), which maintains the same mutation sites and truncation length as the RSV pre-F sequence mutant (DS-Cav1) reported in NIAID patent (CN105473604B). Since mRNA-1345 is a membrane-type F protein sequence containing a transmembrane region (TM), while DS-Cav1 is a secretory F protein sequence with a foldon at its C-terminus, in order to ensure that the comparative properties are the same, this invention removes the foldon from DS-Cav1 while retaining its transmembrane region (TM), ultimately forming the sequence mRNA-RSV-ds-cav1 (SEQ ID NO: 2).

[0172] Comparative Example 3: Referring to Comparative Example 1, the F gene sequence from RSV subtype A strain A23 (refer to NCBI virus strain sequence number OR666571.1) was used to design mRNA-RSV-1345-A23 (SEQ ID NO: 26), which maintains the same mutation site and truncated length as the RSV mRNA vaccine antigen sequence (mRNA-1345) reported in Moderna patent (CN115103682A).

[0173] Comparative Example 4: Referring to Comparative Example 1, the F protein sequence from RSV subtype strain B18537 (refer to NCBI virus strain sequence number P13843) was used to design mRNA-RSV-1345-B18537 (SEQ ID NO: 27), which maintains the same mutation site and truncated length as the RSV mRNA vaccine antigen sequence (mRNA-1345) reported in Moderna patent (CN115103682A).

[0174] Comparative Example 5: Referring to Comparative Example 1, the F gene sequence from RSV subtype B strain B6 (refer to NCBI virus strain sequence number OR666608.1) was used to design mRNA-RSV-1345-B6 (SEQ ID NO: 28), which maintains the same mutation site and truncated length as the RSV mRNA vaccine antigen sequence (mRNA-1345) reported in Moderna patent (CN115103682A).

[0175] Results Summary and Analysis

[0176] In vitro expression results of RSV F antigen variant

[0177] As shown in Example 3, the positive rates of Total-F, pre-F, and post-F, as well as the MFI value, of the mRNA sequence encoding the F protein in HeLa cells were detected using the FCM method. The detection results are shown in Tables 3 and 4 below. Figures 2-5 As shown:

[0178] Table 3. Positive rates of pre-F, post-F, and Total-F in FCM detection of mRNA sequences.

[0179]

[0180]

[0181] Table 4. MFI values ​​of pre-F, post-F, and Total-F of mRNA sequences detected by FCM.

[0182]

[0183]

[0184] FCM analysis was performed on 19 designed RSV F protein mutants (SEQ ID NO: 3~21), and the results showed:

[0185] 1. The wild-type sequence (HY-RSV-A23-F-delCT) showed low expression levels in the pre-F conformation and high expression levels in the post-F conformation, indicating that the pre-F conformation of the F protein is unstable under natural conditions and cannot be used as a candidate antigen for RSV mRNA vaccines, therefore it was excluded.

[0186] 2. At the pre-F conformation expression level, compared to the wild-type sequence (HY-RSV-A23-F-delCT), HY-RSV-A23-F-delCT-A102C, HY-RSV-A23-F-delCT-Q494C, HY-RSV-A23-F-delCT-V495C, HY-RSV-A23-F-delCT-V179I, and HY-RSV-A23-F-delCT... -S213Y, HY-RSV-A23-F-delCT-V301L, HY-RSV-A23-F-delCT-S238H, HY-RSV-A23-F-delCT-S215P, and HY-RSV-A23-F-delCT-I217P all showed at least a 2-fold increase in expression level, while HY-RSV-A23-F-delCT-T54E showed a slightly lower increase, but still nearly a 1.5-fold increase.

[0187] 3. At the Total-F conformation expression level, the observed results were similar to those of the pre-F conformation.

[0188] 4. At the post-F conformation expression level, the expression levels of most F protein mutants were increased or similar to those of the wild type, indicating that a single site mutation is insufficient to maintain a sufficiently stable pre-F conformation.

[0189] Conclusion: Disulfide bond mutations A102C, V243C and A490C, V495C, cavity-filling mutations V301L, S213Y, V179I, and electrostatic mutation S238H can stabilize the pre-F conformation of the F protein. At the same time, compared with the wild-type sequence, the site mutations increased the in vitro expression level of the sequence. Although a single site mutation may not be able to maximize the stability of the pre-F structure, the combination of multiple site mutations can achieve the goal, as DS-Cav1 and mRNA-1345 are examples.

[0190] Therefore, this invention innovatively combines multiple site mutations, including disulfide bond mutations, cavity filling mutations, and electrostatic mutations, to form a new stable F protein mutant sequence, as shown in sequences SEQ ID NO: 22~SEQ ID NO: 25.

[0191] The expression levels of multi-site mutant sequences were detected by FCM. The results are shown in Tables 5 and 6. Figures 6-9 .

[0192] Table 5. Positive rates of pre-F, post-F, and Total-F in FCM detection of mRNA sequences.

[0193]

[0194] Table 6. MFI values ​​of pre-F, post-F, and Total-F of mRNA sequences detected by FCM.

[0195]

[0196] As shown in the table above, the expression levels of HY-RSV-F-delCT-mut-A2, HY-RSV-F-delCT-mut-A23, HY-RSV-F-delCT-mut-B18537, and HY-RSV-F-delCT-mut-B6 were significantly increased, approximately twice that of the control sequence (mRNA-RSV-1345). Therefore, these can serve as effective candidate antigens for further immunogenicity screening and evaluation. The titers of F protein-specific antibody IgG and RSV true virus neutralizing antibodies against these antigens were then determined.

[0197] RSV true virus neutralizing antibody titer assay results

[0198] This invention detects serum neutralizing antibody levels against two RSV strains, A2 and B1, using SEQ ID NO: 22-28 sequences (including monovalent (single isotype sequence) and bivalent (combination of A and B isotype sequences) mRNA-LNP formulations) via GFP fluorescence assay (i.e., FRNT50 assay). Results show... Figure 10 :

[0199] 1. FRNT50 test results show that HY-RSV-F-delCT-mut-A23 & HY-RSV-F-delCT-mut-B6 is the optimal bivalent combination, while HY-RSV-F-delCT-mut-A2 & HY-RSV-F-delCT-mut-B18537 is the second-best bivalent combination. This means that bivalent vaccines for circulating RSV strains are superior to bivalent vaccines for classic strains.

[0200] 2. Compared with the same dose of mRNA-RSV-1345, the bivalent preferred antigen sequence combination HY-RSV-F-delCT-mut-A23 & HY-RSV-F-delCT-mut-B6 increased the neutralizing antibody levels against classical and epidemic RSV A / B subtypes by approximately 10-fold at the 2μg dose and approximately 30-fold at the 10μg dose.

[0201] The results of neutralizing antibody titer assays showed that HY-RSV-F-delCT-mut-A23 and HY-RSV-F-delCT-mut-B6 were antigen sequences that were at least more effective than mRNA-RSV-1345 (Comparative Example 1) and mRNA-RSV-ds-cav1 (Comparative Example 2).

[0202] Sequence information:

[0203] Table 7. Amino acid sequence of F antigen

[0204]

[0205]

[0206]

[0207]

[0208]

[0209]

[0210]

[0211]

[0212]

[0213]

[0214] Table 8. Nucleotide sequence of mRNA

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240]

[0241]

[0242]

[0243] Note: "T" in Table 8 should be "U".

Claims

1. A mutant of the F protein of respiratory syncytial virus, characterized in that, The amino acid sequence of the F protein mutant is shown in any one of SEQ ID NOs: 22~25.

2. A composition of F protein of respiratory syncytial virus, characterized in that, The composition consists of the F protein mutant with the amino acid sequence shown in SEQ ID NO: 23 and the F protein mutant with the amino acid sequence shown in SEQ ID NO: 25; or, the composition consists of the F protein mutant with the amino acid sequence shown in SEQ ID NO: 22 and the F protein mutant with the amino acid sequence shown in SEQ ID NO:

24.

3. An isolated nucleic acid, comprising, The nucleic acid comprises a nucleotide sequence encoding the composition of the F protein mutant according to claim 1 or the F protein of the respiratory syncytial virus according to claim 2.

4. The nucleic acid of claim 3, wherein The nucleic acid further comprises a 5' UTR and / or a 3' UTR; and / or, the nucleic acid further comprises a polyA tail.

5. The nucleic acid of claim 4, wherein The 5' UTR and / or the 3' UTR is from the Pfizer bivalent expression vector BNT162b2; and / or, the polyA tail has a length of 50~150 or above.

6. The nucleic acid of any one of claims 3 to 4, wherein The nucleic acid is DNA.

7. The nucleic acid of claim 6, wherein The nucleic acid further comprises a promoter.

8. The nucleic acid of claim 7, wherein The promoter is a T7 promoter.

9. The nucleic acid of any one of claims 3-4, wherein The nucleic acid is RNA.

10. The nucleic acid of claim 9, wherein The nucleic acid is mRNA.

11. The nucleic acid of claim 9, wherein The nucleic acid satisfies one or more conditions selected from: (1) the nucleotide sequence of the nucleic acid encoding the F protein mutant is shown in any one of SEQ ID NOs: 50~53; (2) the nucleic acid further comprises a 5' cap structure; and, (3) the nucleic acid further comprises a modification.

12. The nucleic acid of claim 11, wherein The 5' cap structure is a 7mG(5')ppp(5')N1mpNp cap; and / or, the modification is a pseudouridine (Ψ) and / or N1-methylpseudouridine (m1Ψ) modification.

13. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the nucleic acid according to any one of claims 3~8.

14. A transformant characterized in that, The transformant comprises the nucleic acid according to any one of claims 3~12 or the recombinant expression vector according to claim 13; the transformant is a non-animal or plant variety.

15. The transformant of claim 14, wherein, The host cell of the transformant is a eukaryotic cell or a prokaryotic cell.

16. The transformant of claim 15, wherein, The prokaryotic cell is a bacterium.

17. The transformant of claim 16, wherein The bacterium is Escherichia coli.

18. A lipid nanoparticle, characterized in that, The lipid nanoparticle comprises the nucleic acid according to any one of claims 9~12.

19. A pharmaceutical composition comprising, The pharmaceutical composition comprises one or more selected from the F protein mutant according to claim 1, the composition of the F protein of the respiratory syncytial virus according to claim 2, the nucleic acid according to any one of claims 3~12 and the lipid nanoparticle according to claim 18, and a pharmaceutically acceptable carrier.

20. Use of one or more selected from the F protein mutant according to claim 1, the composition of the F protein of the respiratory syncytial virus according to claim 2, the nucleic acid according to any one of claims 3~12, the lipid nanoparticle according to claim 18 and the pharmaceutical composition according to claim 19 in the preparation of a medicament for preventing a disease caused by the respiratory syncytial virus.

21. The use of claim 20, wherein, The medicament is a vaccine.

22. The use of claim 21, wherein, The medicament is an mRNA vaccine.

Images