Simmonsia claviceps and use thereof

Abstract

The application discloses a kind of Gliocephalotrichum simmonsii and application thereof, the strain number of the Gliocephalotrichum simmonsii (Gliocephalotrichum simmonsii) is JSAFC 2056, and is preserved in China Microorganism Culture Collection Center on September 23, 2024, and the preservation number is CGMCC No.41562.The biocontrol agent of the application provided can significantly inhibit the survival activity of Anomala cuprea, and the survival activity of Anomala cuprea can be reduced to 0 after 28 days of treatment, and the biocontrol agent is environmentally friendly, non-toxic and harmless.The preparation method of the biocontrol agent of the application provided is simple, the culture requirement is low, and has good application prospect.

Description

Technical Field

[0001] This invention belongs to the field of microbial technology and relates to a type of spirochete bacterium called Simmons and its applications. Background Technology

[0002] The green scarab beetle (Anomala corpulenta) is a significant underground pest in agricultural areas and one of the three dominant scarab beetle species. The main characteristics of the green scarab beetle larvae are their activity in the soil, feeding on germinating seeds, leading to uneven germination and even large-scale seedling loss. They also bite off the roots and stems of plants, preventing the plants from absorbing water and nutrients, ultimately causing them to wither and die. Furthermore, the wounds caused by the larvae's bites easily become entry points for pathogens, triggering other diseases and further exacerbating the damage to crops. Therefore, the green scarab beetle larvae cause serious damage to crops, necessitating effective control measures to reduce their harm.

[0003] In recent years, the development of highly specific, environmentally friendly, and highly toxic pesticides, especially biopesticides, and the development of new strains and genes have become research hotspots. Therefore, pest control has shifted towards its ecological relationship with microorganisms. For a specific group of underground pests such as the green scarab beetle, targeting the larval stage has become a wise choice, and infecting larvae with microbial agents that have relatively good environmental safety and compatibility is undoubtedly the main method. Biocontrol fungi are characterized by a wide range of parasitic species, strong adaptability, short pathogenicity cycles, high specificity, non-toxicity to humans and livestock, and environmental friendliness. Although the application range of mucilaginous fungi is not as wide as that of Beauveria bassiana and Metarhizium anisopliae, they can still grow stably at lower temperatures and maintain high infectivity, giving them a natural advantage in controlling overwintering pest populations. Therefore, screening for highly pathogenic biocontrol strains is particularly crucial. However, there are currently no reports on the use of mucilaginous fungi to control the green scarab beetle. Summary of the Invention

[0004] Purpose of the invention: The purpose of this invention is to provide a bacterium called Gliocephalotrichum simmonsii and its application in the control of green scarab beetles.

[0005] Technical solution: This invention provides a strain of Gliocephalotrichum simmonsii, strain number JSAFC2056, which was deposited on September 23, 2024 at the China General Microbiological Culture Collection Center, with accession number CGMCC No.41562.

[0006] Furthermore, the nucleotide sequence of the ITS gene of the *Symplocos simiens* is shown in SEQ ID NO.1, and the nucleotide sequence of the His gene is shown in SEQ ID NO.2.

[0007] The present invention also provides a biocontrol agent, wherein the active ingredient of the biocontrol agent is the aforementioned *Gliocephalotrichum simmonsii*.

[0008] This invention also provides the application of the above-mentioned Gliocephalotrichum simmonsii and biocontrol agent in the control of green beetles.

[0009] Furthermore, the application specifically involves spraying a spore suspension of Gliocephalotrichum simmonsii JSAFC 2056 onto the larvae of the green scarab beetle.

[0010] Further, the preparation method of the spore suspension is as follows: (1) the biocontrol bacterium Simons colloid head JSAFC2056 is inoculated on PDA medium and cultured to prepare a culture; (2) the culture obtained in step (1) is placed in Tween-80 solution, shaken well and then filtered to extract the spores.

[0011] Furthermore, the culture conditions described in step (1) are 25°C, 75% humidity, and dark culture.

[0012] Furthermore, the concentration of the spore suspension is 10. 8 / ml.

[0013] Furthermore, the spore suspension is applied every 2 days for 28 days.

[0014] Beneficial Effects: Compared with the prior art, the present invention has the following significant advantages: This application obtained a strain of *Gliocephalotrichum simmonsii* through isolation and purification of soil from Hangzhou, Zhejiang. This strain can be used as a biocontrol strain with a high mortality rate against *Gliocephalotrichum simmonsii*, and is environmentally friendly and non-toxic. It exhibits strong pathogenicity against *Gliocephalotrichum simmonsii* larvae and is a biocontrol strain with potential value in the control of *Gliocephalotrichum simmonsii*, which is of positive significance in preventing the spread of *Gliocephalotrichum simmonsii*. Attached Figure Description

[0015] Figure 1 Colony morphology of Gliocephalotrichum simmonsii JSAFC 2056.

[0016] Figure 2 Phylogenetic tree of Gliocephalotrichum simmonsii JSAFC 2056.

[0017] Figure 3 Effects of Gliocephalotrichum simmonsii JSAFC 2056 on the growth of green scarab beetle larvae.

[0018] Figure 4 The figure shown is a graph showing the relationship between the number of days of inoculation with the biocontrol strain Gliocephalotrichum simmonsii JSAFC 2056 of the present invention and the survival activity of the larvae of the green scarab beetle. Detailed Implementation

[0019] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0020] In this invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can prevent and control plant diseases, mainly including bacteria, fungi, and actinomycetes.

[0021] Example 1: Isolation and identification of Gliocephalotrichum simmonsii JSAFC 2056

[0022] 1. Separation of Gliocephalotrichum simmonsii JSAFC 2056

[0023] JSAFC 2056 was isolated from soil samples taken from Hangzhou, Zhejiang Province. Its colony characteristics are as follows: when cultured on PDA plates, the colonies grow rapidly, adhering closely to the substrate, and their surface color ranges from gray to brown. Figure 1 ).

[0024] 2. Molecular biological identification of Gliocephalotrichum simmonsii JSAFC 2056

[0025] (1) Genomic DNA of strain JSAFC 2056 was extracted using a kit from TIANGEN.

[0026] (2) Amplify the ITS and His genes of genomic DNA respectively. DNA amplification was performed using a 30 μL reaction volume, containing 15 μL of 2×EasyTaq PCR SuperMix (+dye), 1 μL (10 μM) each of primer pairs ITS1 (SEQ ID NO.3: 5'-CTTGGTCATTTAGAGGAAGTAA-3') & ITS4 (SEQ ID NO.4: 5'-TCCTCCGCTTATTGATATGC-3') or CYLH3F (SEQ ID NO.5: 5'-AGGTCCACTGGTGGCAAG-3') & CYLH3R (SEQ ID NO.6: 5'-AGCTGGATGTCCTTGGACTG-3'), 2 μL of template DNA, and 11 μL of ddH2O. The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 54℃ annealing for 45 s (52℃ for His gene), 72℃ extension for 60 s, for a total of 35 cycles; and a final extension at 72℃ for 10 min.

[0027] (3) After 1% agarose gel electrophoresis, the amplified PCR products were observed under UV light. PCR products with the target band were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: The ITS gene sequence of strain JSAFC 2056 was SEQ ID NO.1 (CTCCCAAACCCATGTGAATCTTACCTTTACGTTCCCTCGGCGGCGTTCCCCTCGG GGTTCCCGCCAGAGGACCAACAAACCCTTTGAATTTATTAGTATTATTCTGAGTGATTTAATCAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGC GGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGCTTGGTGTTGGAGGTCGGCACAAGCGTCCCTCGGGTCGCCGCCGTCTCCCAAATATAGTGGCGGTCTCGCTGTAGCCTCCTCTGCGTAGTAACTCACCTCGCACTGGAACGCGGCGCGGCCAAGCCGTTAAACCCCCCACTTCTGAAGG), the His gene sequence is SEQ ID NO.2(AGGTCCACCGGGGGCAAGGCCCCCCGTAAGCAGCTTGCTTCCAAGGCTGGTAA GTTTAATCGCATCCATCGTCGCCATCGCTGCGACCTCCATCACCATCAACATCGCTAACTTCCTCACCACCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACTGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACATCCGCTACTC GACGCGTCTAACGCGACTAGCACTTTACGCGCTCTCAAAACAATACTAACTCTTCACCAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT). .

[0028] (4) Compare the sequences SEQ ID NO.1 and SEQ ID NO.2 on the NCBI database website and construct a phylogenetic tree. See [link to citation]. Figure 2 The comparison results are shown in Table 1. Based on the results in Table 1, the biocontrol bacterium JSAFC 2056 of the present invention can be identified as Gliocephalotrichum simmonsii, named Gliocephalotrichum simmonsii JSAFC 2056. This strain was deposited on September 23, 2024, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 41562, classified as Gliocephalotrichum simmonsii JSAFC 2056, and the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen No. 1 Courtyard, Chaoyang District, Beijing.

[0029] Table 1. Sequence alignment results of SEQ ID NO.1 and SEQ ID NO.2

[0030]

[0031] Example 2: Determination of the pathogenicity of Gliocephalotrichum simmonsii JSAFC 2056 to the larvae of the green scarab beetle.

[0032] 1. Preparation of spore suspension

[0033] (1) The biocontrol bacterium Simons colloid head JSAFC 2056 was inoculated on PDA medium and cultured to prepare a culture. The culture conditions were: cultured at 25℃ in the dark for 5-7 days.

[0034] (2) Using an inoculation needle, pick up a piece of mycelium from the culture and place it in Tween-80 solution (0.1%). Shake thoroughly, filter out the spores, and adjust the concentration to prepare the *Cyclobalanopsis fargesii* biocontrol agent. The spore concentration of the *Cyclobalanopsis fargesii* biocontrol agent is 10. 8 per mL.

[0035] 2. Pathogenicity determination

[0036] (1) Immersion method: Take healthy and uniformly sized larvae of the green scarab beetle (collected from the fields of Sizhuang Village, Houbai Town, Jurong City), and immerse them in water at a concentration of 10... 8 After soaking in a spore suspension of 1 larvae / mL for 20 seconds, the larvae were quickly removed and placed in a culture box containing one larva per box filled with sand. The control group was soaked in 0.1% Tween-80. There were 10 larvae in each group, with 3 replicates. The treated larvae were kept at a constant temperature of 22℃. After 3 days, the color change, mortality and infection status of the larvae were observed and recorded daily.

[0037] Data statistical analysis was performed using SPSS 27.0 software, and lethal median time (LT) was calculated using Probit regression (probability unit regression). 50 ).

[0038] Ten days after infection with strain Gliocephalotrichum simmonsii JSAFC 2056, larvae of the green scarab beetle were observed. Figure 3 This indicates that the strain is pathogenic to the green-spotted beetle. Spore suspension of strain JSAFC 2056 (10... 8 The pathogenicity test results for infecting *Ceratophyllum demersum* larvae (number / mL) are shown in [link to relevant data]. Figure 4 ,Depend on Figure 4 It was found that the survival rate of larvae inoculated with *Symplocos purpurea* was significantly lower than that of the control; the survival activity curve showed a rapid downward trend from 10 to 20 days, followed by a slow downward trend, until day 28, when the survival rate of *Symplocos purpurea* larvae infected with strain JSAFC 2056 reached 0, and the virulence regression equation was y = 0.162 - 1.873x(R). 2 =0.975), LT 50The value was 11.56d, with a 95% confidence interval of 10.88–12.25d.

[0039] (2) Pot method: Select pots with a diameter of 12cm, and place one healthy and uniformly sized green scarab beetle larva in each pot. Two groups were set up (control group and treatment group), with 10 larvae in each group. The experimental group was treated by pouring 8mL of JSAFC 2056 spore suspension (10...) into each pot. 8 The control group was: each pot was watered with 8 mL of 0.1% Tween-80.

[0040] (3) Water the pots every 2 days, and count the mortality rate of the copper green beetle after 28 days.

[0041] After 28 days, all the larvae of the green scarab beetle in the experimental group died, while the mortality rate of the larvae in the control group was only 3%.

[0042] In summary, the strain JSAFC 2056 provided by this invention is a biocontrol fungus that can be used to control the green scarab beetle. It has the characteristics of strong pathogenicity against the green scarab beetle larvae, being environmentally friendly and pollution-free, and not easily developing drug resistance. It can be widely used for the control of green scarab beetle larvae before emergence.

Claims

1. A type of Gliocephalotrichum simmonsii, characterized in that, The strain number of *Gliocephalotrichum simmonsii* is JSAFC 2056, which was deposited at the China General Microbiological Culture Collection Center on September 23, 2024, with accession number CGMCC No. 41562.

2. The *Gliocephalotrichum simmonsii* according to claim 1, characterized in that, The nucleotide sequence of the ITS gene of *Symplocos simiens* is shown in SEQ ID NO.1, and the nucleotide sequence of the His gene is shown in SEQ ID NO.

2.

3. A biocontrol agent, characterized in that, The active ingredient of the biocontrol agent is *Gliocephalotrichum simmonsii* as described in any one of claims 1 to 2.

4. The application of *Gliocephalotrichum simmonsii* as described in any one of claims 1 to 2 and the biocontrol agent as described in claim 3 in the control of *Gliocephalotrichum simmonsii*.

5. The application according to claim 4, characterized in that, The application specifically involves spraying a spore suspension of Gliocephalotrichum simmonsii JSAFC 2056 as described in any one of claims 1 to 2 onto the larvae of the green scarab beetle.

6. The application according to claim 5, characterized in that, The method for preparing the spore suspension is as follows: (1) The biocontrol bacterium Simons colloid head JSAFC 2056 was inoculated onto PDA medium and cultured to prepare a culture; (2) Place the culture obtained in step (1) into Tween-80 solution, shake well and filter out the spores.

7. The application according to claim 6, characterized in that, The culture conditions described in step (1) are 25°C, 75% humidity, and dark culture.

8. The application according to claim 5, characterized in that, The concentration of the spore suspension is 10. 8 / mL.

9. The application according to claim 5, characterized in that, The spore suspension was applied every 2 days for 28 days.

Images