MiRNA and use thereof

Abstract

The application belongs to the technical field of pest control, and discloses a miRNA and application thereof, and specifically discloses application of gma-miR-4387c in pest control and / or preparation of a product for pest control. It is found for the first time that injection of gma-miR-4387c into pests (such as Spodoptera frugiperda) can significantly reduce the survival rate of 3rd instar larvae of Spodoptera frugiperda and reduce the food intake. The above research results prove that gma-miR-4387c can be used for controlling Spodoptera frugiperda larvae, and has the potential to be applied by constructing a transgenic plant.

Description

Technical Field

[0001] This invention belongs to the field of pest control technology, specifically relating to a miRNA and its applications. Background Technology

[0002] fall armyworm ( Spodoptera frugiperda ), belonging to the order Lepidoptera ( Lepidoptera Noctuidae ( Noctuidae genus *Greywing noctuid* ( Spodoptera Originating in the tropical and subtropical regions of the Americas, it is widely distributed across the Americas. It is characterized by its wide distribution range, strong migratory ability, rapid reproduction rate, and difficulty in control, and is an important agricultural pest for global early warning by the Food and Agriculture Organization of the United Nations (FAO).

[0003] The current pest control strategies are mainly divided into: (1) Agricultural control: cultivation management. Such as reasonable planting, manual removal of egg masses, killing larvae, push-pull strategy - planting crops with a repelling effect at intervals and planting crops with an attractive effect around them. (2) Physical control: trapping and killing pests through sugar-vinegar-alcohol solution, yellow sticky traps and green lights. (3) Chemical control: using chemical insecticides. (4) Biological control: using the natural enemies of pests for pest control.

[0004] However, the aforementioned pest control strategies have certain limitations. For example, manually killing larvae requires a significant amount of manpower; physical control methods such as insect traps and insecticidal lamps, on the one hand, attract and kill natural enemies and neutral insects, thus affecting the ecological balance, and on the other hand, have high maintenance costs, requiring regular manual installation, maintenance, and treatment; biological control methods, such as raising natural enemies, have relatively high costs, large-scale breeding is not yet mature, transportation is difficult, and farmers need to master the corresponding release methods and timing, resulting in high learning costs; sex pheromone traps only work on emerging adults. The most effective strategy is chemical pesticides. However, despite their good control effects, long-term and excessive use of chemical pesticides has led to a series of problems, including serious environmental pollution, food safety issues, and pesticide resistance.

[0005] Therefore, there is a need for efficient, specific, and environmentally friendly alternative methods for pest control, and RNA interference (RNAi) technology has great potential as a novel approach to pest control. Utilizing microRNAs (miRNAs) found in everyday fruits and vegetables for pest RNAi can reduce public concerns about the safety of exogenous miRNAs; however, there are currently no reports on plant-derived miRNAs for controlling fall armyworm. Therefore, screening and identifying safe and efficient insect-resistant plant-derived miRNAs will contribute to the promotion and application of green pest control strategies. Summary of the Invention

[0006] The first aspect of the present invention aims to provide the application of gma-miR-4387c and related biomaterials in pest control and / or the preparation of pest control products.

[0007] The second aspect of the present invention is to provide a product.

[0008] The third objective of this invention is to provide a method for controlling pests.

[0009] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the invention provides the use of any one of the substances shown in (1)-(5) in pest control and / or in the preparation of pest control products; (1) gma-miR-4387c; (2) The precursor of gma-miR-4387c; (3) gma-miR-4387c agomir; (4) A DNA molecule encoding the precursor of gma-miR-4387c described in (1) or gma-miR-4387c described in (2); (5) Expression cassettes, recombinant vectors or transgenic cells containing the DNA molecules described in (4).

[0010] In some embodiments of the present invention, the nucleotide sequence of the gma-miR-4387c is shown in SEQ ID NO:22.

[0011] In some embodiments of this invention, miRNA agomir is a specially chemically modified miRNA agonist that can be directly injected into animals to mimic endogenous miRNAs and enhance their function. Compared to cellular miRNA mimic, animal miRNA agomir has higher stability and miRNA activity, is more likely to cross cell membranes and intercellular spaces to accumulate in target cells, and can prevent degradation of miRNAs by nucleases in insects. Specifically, gma-miR-4387cagomir, i.e., gma-miR-4387c agonist, is a small double-stranded miRNA designed and synthesized targeting the mature form of gma-miR-4387c. Its function is the same as that of mature gma-miR-4387c in vivo, upregulating the intracellular content of the corresponding gma-miR-4387c and enhancing the function of endogenous gma-miR-4387c. gma-miR-4387c agomir contains the sequence shown in SEQ ID NO:22 and / or its complementary sequence.

[0012] In some embodiments of the present invention, the gma-miR-4387c of the present invention includes functional equivalents of constitutive nucleic acid molecules, i.e., variants, which exhibit the same function as the complete gma-miR-4387c nucleic acid molecule, and may be mutated by deletion, substitution or insertion of nucleotide residues.

[0013] As is well known to those skilled in the art, to ensure the stability of miRNA, protective bases, such as TT, can be added to one or both ends of the miRNA; alternatively, the miRNA bases can be modified without affecting its function. Therefore, it is well known to those skilled in the art that sequences obtained by modifying gma-miR-4387c or adding bases to both ends without affecting its function are also included within the scope of protection of this invention, that is, gma-miR-4387c can be any one or more ribonucleotides modified in the sequence shown in SEQ ID NO:22.

[0014] In some embodiments of the present invention, the gma-miR-4387c is a mature miRNA, a precursor miRNA, or a primary transcript.

[0015] In some embodiments of the present invention, the nucleic acid molecule of gma-miR-4387c can exist in single-stranded or double-stranded form. Mature gma-miR-4387c is mainly in single-stranded form, while the precursor of gma-miR-4387c is partially self-complementary to form a double-stranded structure. The nucleic acid molecule of gma-miR-4387c can be in the form of RNA, DNA, PNA, or LNA.

[0016] In some embodiments of the present invention, the pests include lepidopteran insects.

[0017] In some embodiments of the present invention, the pest is the fall armyworm.

[0018] In some embodiments of the present invention, the pest is a larval stage pest.

[0019] In some embodiments of the present invention, the product is an insecticide or pesticide.

[0020] In some embodiments of the present invention, the product can be prepared into conventional dosage forms for use, such as dry powder, wettable powder, emulsifiable concentrate, microemulsion, paste, granules or suspension.

[0021] In some embodiments of the present invention, the substance achieves the purpose of pest control by inhibiting pests from feeding, inhibiting pests from growing and developing, and / or killing pests.

[0022] In some embodiments of the present invention, the substance delays the growth of pests, preventing them from undergoing metamorphosis and thus causing them to die.

[0023] Soybean-derived miRNA (gma-miR-4387c) has a controlling effect on the fall armyworm. Since gma-miR-4387c is derived from soybean, it is safe for humans and can be used as a novel, safe, and effective insecticide for controlling the fall armyworm. It can be used directly or used to construct transgenic plants; therefore, gma-miR-4387c transgenic plants (i.e., plants overexpressing gma-miR-4387c) will have practical application value for fall armyworm control.

[0024] A second aspect of the present invention provides a product comprising any one of the substances shown in (1)-(5) below; (1) gma-miR-4387c; (2) The precursor of gma-miR-4387c; (3) gma-miR-4387c agomir; (4) A DNA molecule encoding the precursor of gma-miR-4387c described in (1) or gma-miR-4387c described in (2); (5) Expression cassettes, recombinant vectors, or transgenic cells containing the DNA molecules described in (4). In some embodiments of the present invention, the nucleotide sequence of the gma-miR-4387c is shown in SEQ ID NO:22.

[0025] In some embodiments of the present invention, the product includes at least one of a reagent, a drug, and an insecticide.

[0026] In some embodiments of the present invention, the product further includes a pharmaceutically acceptable carrier, including but not limited to: diluents, buffers, suspensions, emulsions, granules, encapsulation agents, excipients, fillers, binders, sprays, transdermal absorbents, humectants, disintegrants, absorption enhancers, surfactants, flavoring agents, or adsorbents.

[0027] A third aspect of the present invention provides a method for controlling pests, comprising applying the substance described in the first aspect of the present invention or the product of the second aspect of the present invention to pests or pest habitats.

[0028] In some embodiments of the present invention, the method includes treating pests, their food (such as corn), and their habitat (soil, area, material, or environment where the pest is growing or can grow, or materials, cultivated plants, plant propagation materials (such as seeds), or soil surfaces) with the substance or product. For example, this can be achieved by constructing transgenic plants expressing gma-miR-4387c or its agomir or precursor for pest control; or by directly introducing gma-miR-4387c or its agomir or precursor into the pest through spraying or injection (e.g., injecting the substance between the penultimate and penultimate abdominal segments of the fall armyworm).

[0029] In some embodiments of the present invention, an effective dose of the substance described in the first aspect of the present invention or the product of the second aspect of the present invention is applied to the pest or the pest habitat.

[0030] Generally, "effective amount" refers to the amount of active ingredient required to achieve observable effects on growth, including necrosis, death, inhibition, prevention and removal, destruction or reduction of the presence and activity of target organisms. For gma-miR-4387c or agomir used in this invention, the effective amount can vary. The effective amount of gma-miR-4387c or agomir also varies depending on key conditions such as desired insecticidal effect and duration, climate, target species, location, application method, etc.

[0031] In some embodiments of the present invention, the pests include lepidopteran insects.

[0032] In some embodiments of the present invention, the pest is the fall armyworm.

[0033] The beneficial effects of this invention are: This invention is the first to discover that injecting gma-miR-4387c into pests (such as the fall armyworm) can significantly reduce the survival rate and food intake of third-instar larvae of the fall armyworm. The early larval stages are the most effective period for pest control. These findings demonstrate that gma-miR-4387c can be used to control fall armyworm larvae and has the potential for application through the construction of transgenic plants (such as maize).

[0034] Specifically, this invention uses RNAhybrid software to predict that soybean-derived gma-miR-4387c may target multiple genes important for growth and development. By artificially synthesizing miRNA and injecting it into the fall armyworm, gma-miR-4387c was found to have a strong insecticidal effect. Further phenotypic analysis revealed that, compared with the control (water), the mortality rate of fall armyworms treated with gma-miR-4387c increased by 46.08±5.86% and 64.92±4.77% at 24 and 48 h, respectively, and the growth of surviving insects was delayed. Dissection revealed that the midgut of the treated insects contained no food, indicating that reduced food intake was likely the cause of death.

[0035] Incubation of gma-miR-4387c in hemolymph revealed that gma-miR-4387c was not degraded, confirming the primary condition for its application in the fall armyworm. To determine the cause of death in fall armyworms due to gma-miR-4387c, transcriptome sequencing analysis was performed 24 and 48 hours after injection. GO and KEGG analyses of downregulated genes revealed that gma-miR-4387c primarily slows larval growth and even causes death by regulating the expression of genes involved in nutrient metabolism pathways (carbohydrate, fatty acid, and amino acid metabolism), energy metabolism, oxidoreductases, and the ecdysone pathway. Furthermore, analysis of downregulated genes at both 24 and 48 hours revealed that genes in the later stages of the ecdysone pathway... E75 , E78c Nuclear hormone receptors HR3 Expression was downregulated. This indicates that gma-miR-4387c can act on regulatory factors of insect hormone pathways expressed during the larval stage, thereby regulating insect molting. Therefore, gma-miR-4387c can act on functional genes and pathways required for metabolism such as nutrition and energy, hormone pathways, and other important life activities, thus affecting physiological activities during the larval and molting stages, making it a promising molecule for pest control. Attached Figure Description

[0036] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 The mortality rate of fall armyworm 48 h after injection of different doses of gma-miR-4387c was determined.

[0037] Figure 2 The images show the phenotype of fall armyworm 48 hours after injection of gma-miR-4387c. A represents the phenotype of fall armyworms 48 hours after treatment; B represents the anatomical diagram of fall armyworms 48 hours after treatment; and C represents the mortality rate of fall armyworms within 168 hours of treatment. NC represents the negative control RNA.

[0038] Figure 3 The percentage of different phenotypes in fall armyworm 168 hours after injection of gma-miR-4387c.

[0039] Figure 4 Electrophoresis diagrams of miRNA incubated in the hemolymph of fall armyworm; where A represents miRNA incubated in fall armyworm hemolymph for 3 h; B represents miRNA incubated in fall armyworm hemolymph for 24 h. In the figure, 1: PBS-NC (negative control RNA); 2: PBS-gma-miR-4387c; 3: PBS-zma-miR-319d; 4: hemolymph-NC (negative control RNA); 5: hemolymph-gma-miR-4387c; 6: hemolymph-zma-miR-319d.

[0040] Figure 5 This is the BLAST result of gma-miR-4387c in the miRNA library. In the figure, gma Soybeans; ghr Upland cotton; osa Rice.

[0041] Figure 6 The results show the prediction of maize target genes for gma-miR-4387c using psRNATarget.

[0042] Figure 7 Volcano plots of differentially expressed genes after injection of gma-miR-4387c into fall armyworm at 24h (A) and 48h (B). In the plots, Up: gene expression upregulated; Down: gene expression downregulated; Normal: no significant difference.

[0043] Figure 8 KEGG enrichment map of differentially expressed genes after injection of gma-miR-4387c into fall armyworm; where A represents 24h-down; B represents 48h-down; C represents 24h-up; and D represents 48h-up.

[0044] Figure 9KEGG enrichment map of specifically downregulated genes after injection of gma-miR-4387c into fall armyworm; where A represents 24 h; B represents 48 h; and C represents 24 h results from qPCR detection. In the figure, ACY: aminoacylase; G6PDH: glucose-6-phosphate dehydrogenase; PYK: pyruvate kinase; ATPe: ATP synthase subunit e; ND: NADH dehydrogenase; FAS: fatty acid synthase.

[0045] Figure 10 KEGG analysis of downregulated genes expressed in samples at both 24 and 48 h; where A is the Venn diagram of the intersection of downregulation at 24 h and 48 h; and B is the KEGG diagram.

[0046] Figure 11 This study validated the detection of target genes in the downregulated hormone pathway in the transcriptome. A represents the insect hormone pathway diagram; B shows the changes in mRNA expression levels of insect hormone pathway genes after injection; and C explains the symbols in the dual-luciferase activity assay. In the figures, control: DEPC-H2O; housekeeping genes: mRNA levels corrected for housekeeping gene expression levels. Data are presented as mean ± SEM. For the t-test: p <0.05( ), p <0.01( )or p <0.001( ).

[0047] Figure 12 This study analyzed the expression of genes in the molting hormone pathway during the larval stage. 3L1-3D: Days 1-2 of the third instar; 3LM: molting stage of the third instar; 4L1D: Day 1 of the fourth instar. Detailed Implementation

[0048] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0049] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0050] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0051] Example 1 1. Experimental Materials The fall armyworm used in this invention ( S.frugiperda The larvae were purchased from Keyun Biotechnology Co., Ltd. and then preserved in the laboratory. Specific breeding methods: (1) Larval breeding: The hatching of larvae is concentrated in sterilized plastic boxes, and the plastic boxes and artificial culture medium are changed every one to two days; when the larvae grow to the 3rd instar, they are separated and raised individually in plastic cups; after the larvae pupate, the pupae are transferred to the adult egg-laying plastic boxes; (2) Adult egg-laying: After the pupae emerge as moths, they are fed with cotton dipped in 10% honey water, and sterile water is sprayed twice a day to increase humidity. The egg masses are collected in time and the paper used for egg-laying is replaced. Breeding conditions: The artificial culture medium is used for breeding under the conditions of temperature (27±1)℃, relative humidity 55%-60%, photoperiod 14 h:10 h (light:dark).

[0052] The artificial culture medium is prepared as follows: (1) Divide the components of the artificial culture medium in Table 1 into three groups: A, B, and C. First, mix the components in groups A and B evenly; (2) Add the agar in group B to the distilled water in the pot and boil until boiling. Then add component C, continue heating and stirring, and finally add component A and heat and mix evenly; (3) While still hot, pour the completed feed into a plastic square box. After the feed cools down, transfer it to a 4°C refrigerator for later use.

[0053] Table 1. Culture medium formula for fall armyworm larvae

[0054] The cell line used in this invention, the Spodoptera litura Spli-221 cell line, was obtained from the Institute of Entomology, Sun Yat-sen University. Culture conditions: The cells were cultured at 28°C in insect medium containing 10% fetal bovine serum (FBS) (SF-900 III SFM, GIBCO, Invitrogen, USA). Depending on cell density, the cells were diluted 1:3 every 2 or 3 days and passaged.

[0055] The bacterial strains and vector plasmids used in this invention are as follows: pMD18-T vector was purchased from Takara; the prokaryotic expression vector pGEX-6P-1 used to construct the fall armyworm double-stranded RNA nuclease protein was preserved in our laboratory; and the psi-check2 vector used to construct the dual-luciferase reporter gene vector was purchased from Promega. The *E. coli* DH5α strain used for transformation and protein expression...E. coli DH5α and BL21(DE3) were purchased from Shenzhen Kangti Life Technology Co., Ltd.

[0056] The reagents and kits used in this invention were as follows: Taq polymerase / Ex-Taq DNA polymerase, DNA restriction endonuclease, T4 ligase, low molecular weight standard protein marker, and pre-stained protein marker were all purchased from TAKARA; RT-PCR kit and quantitative real-time PCR kit were purchased from Novizan; FuGENE® HD transfection reagent and the Dual Luciferase kit were purchased from Promega; fetal bovine serum and optimized culture medium Opti-MEM and SF900-Ⅲ (GIBCO, USA) medium used for cell culture were purchased from Life Sciences; TEMED (tetramethylethylenediamine) was purchased from Amresco; and all other reagents used in the experiments were domestically produced analytical grade reagents. miRNA was synthesized by Gemma Gene Technology Co., Ltd.

[0057] The primers used in this invention are shown in Table 2.

[0058] Table 2 Primer sequences used in this invention

[0059] 2. Experimental Methods 2.1 RNA extraction Sampling and lysis: RNA was extracted from whole fall armyworms as needed. The insects were first washed with DEPC water and then placed in EP tubes containing 1 mL Trizol (AG RNAex Pro Reagent). The tubes were then ground at 70 Hz for 2 min and then placed on ice for 5 min.

[0060] Nucleic acid and protein separation: Add 200 μL of chloroform / isoamyl alcohol (24:1) to 1 mL of AG RNAex Pro Reagent, shake vigorously for 10 s, place on ice for 10 min, and then centrifuge (12000 rpm, 4℃) for 15 min.

[0061] Isopropanol precipitation: Take 400 μL of the supernatant, add an equal volume of isopropanol, gently invert to mix, and incubate at -20°C for 1 h. Then centrifuge (12000 rpm, 4°C) for 20 min.

[0062] Washing: Discard the supernatant, add 1 mL of 75% ethanol prepared with DEPC water to the precipitate, gently invert, and centrifuge (12000 rpm, 4℃) for 5 min. Repeat the washing twice. After discarding the supernatant, centrifuge briefly, remove the remaining liquid with a pipette tip, and allow the precipitate to air dry for 10 min to allow the ethanol to evaporate completely.

[0063] Dissolving: Once the edge of the RNA precipitate just turns transparent, add a certain amount of DEPC water to dissolve it, depending on the size of the precipitate.

[0064] RNA concentration and quality testing: The purity and concentration of RNA were measured using NanoDrop ND-2000. If subsequent reverse transcription is required, the RNA concentration was diluted to approximately 1000 ng / μL. The integrity of the extracted RNA was checked by agarose gel electrophoresis and stored at -80°C for later use.

[0065] 2.2 Synthesis of the first strand of cDNA The reverse transcription kit used was Hifair® Ⅲ 1st Strand cDNA Synthesis SuperMix for qPCR (gDNA digester plus) (Yisheng Biotechnology Co., Ltd.). The procedure was performed according to the instructions, roughly as follows: (1) Residual genomic DNA removal: Prepare a 10 μL reaction system: 3 μL of 5X gDNA digester mix, 1 μg of total RNA or mRNA, and add RNase-free water to a final volume of 15 μL. After centrifugation, place the mixture in a PCR instrument and react at 42℃ for 2 min; then incubate at 4℃.

[0066] (2) Preparation of reverse transcription reaction system (20 μL system): 15 μL of the reaction solution from the previous step, 5 μL of 4×Hifair® Ⅲ SuperMix plus. After vortexing and centrifugation, place in a PCR instrument. The reaction conditions are: 25℃, 5 min; 55℃, 15 min; 85℃, 5 min; incubate at 4℃. After the reaction, dilute 5 times with 80 μL of RNase-free water and perform qPCR reaction.

[0067] 2.3 Real-time quantitative PCR The Hieff® qPCR SYBR Green Master Mix (Low Rox Plus) real-time quantitative PCR kit used was manufactured by Yisheng Biotechnology Co., Ltd. The procedure was performed according to their instructions, roughly as follows: (1) Prepare PCR reaction solution (20 μL) for the sample obtained by reverse transcription according to the following system: 2 μL template cDNA, 10 μL Hieff® qPCR SYBR Green Master Mix (Low Rox Plus), 0.4 μL each of forward and reverse primers (10 μM), and 7.2 μL ddH2O. After adding the reaction solution, attach the optical membrane to a 96-well plate, centrifuge, and then place it in a 7300 Real-time PCR System for qPCR reaction.

[0068] (2) According to the instruction manual, the amplification program (two-step method) is set as follows: Step 1: pre-denaturation 95℃, 5 min; Step 2: denaturation 95℃, 10 s; Step 3: annealing / extension 60℃, 30 s; Go to Step 2, 40 cycles; Melting curve stage, instrument default settings.

[0069] (3) Analysis of quantitative PCR results. A relative quantitative analysis method (2...) was used. -ΔΔCt Determine the relative expression level of each target gene relative to the internal reference gene Ribosomal protein 32 (Rp32). Perform three replicates for each sample on the same plate.

[0070] ANOVA (pairwise comparisons between multiple treatments) or independent samples t-test (comparison between two samples) was used for difference comparison analysis. P A value less than 0.05 indicates a significant difference. Indicates; when P A value less than 0.01 indicates a highly significant difference. Indicates; when P When the value is less than 0.001, use The experimental results were analyzed and plotted using GraphPad Prism 8 software.

[0071] 2.4 Treatment of miRNA agomir The miRNA agomir used for injection was produced by Gemma Biosciences. Agomir is a specially labeled and chemically modified double-stranded small RNA that regulates the biological function of target genes by mimicking endogenous miRNAs. Agomir is particularly suitable for in vivo interference experiments in animals and exhibits higher stability and inhibitory effects in vivo. Therefore, the more stable agomir-modified miRNA was selected for the miRNA injection process. The NC sequence is UUCUCCGAACGUGUCACGU (SEQ ID NO:21), and the gma-miR-4387c sequence is AGCGUGAUGACGUGACACUCCGUC (SEQ ID NO:22).

[0072] Several healthy fall armyworms that had just entered the third instar and were of similar growth were selected and frozen on ice. Using a microsyringe, each insect in the control group was injected with 1 μL of DEPC water or NC agomir, and each insect in the experimental group was injected with 10 μg of gma-miR-4387c agomir. The injection site was between the penultimate abdominal segment and the penultimate abdominal segment. Each insect was reared separately in a plastic cup, and its growth was observed and recorded. After 24 h or 48 h, three fall armyworms from each group were randomly selected for subsequent experiments.

[0073] 2.5 miRNA target prediction methods Three target prediction software programs were used to predict insect targets: RNAhybrid (http: / / bibiserv.techfak.uni-bielefeld.de / rnahybrid / ), PITA (https: / / www.ncbi.nlm.nih.gov / pubmed / 17893677), and Miranda (https: / / www.ncbi.nlm.nih.gov / pubmed / 14709173). The evaluation criteria were as follows: RNAhybrid (mfe ≤ -20 kcal / mol), p Genes with a binding site difference of less than 20 bp are selected as potential target genes. The target genes are PITA (seed region with 7-8 bp of complete base pairing, ddG≤-10) and Miranda (score≥150, Energy≤-20).

[0074] The plant prediction target was psRNATarget (http: / / plantgrn.noble.org / psRNATarget / ), with an expected value of 3.0.

[0075] 2.6 GO and KEGG Analysis Methods GO and KEGG analyses were performed on the predicted target genes. First, GO and KEGG annotation background files for the fall armyworm were obtained from the EggNOG (http: / / eggnog-mapper.embl.de / ) and KEGG (https: / / www.kegg.jp / kegg / ) websites. Then, the GO and KEGG enrichment functions were used on the Kiddio Bioinformatics Cloud Platform according to the instructions.

[0076] 3. Experimental Results and Analysis 3.1 Screening of plant-derived miRNAs for the control of fall armyworm To discover small RNAs for pest control, the first step is to screen for potential pairings of small RNAs targeting effective pest control molecules. Using RNAhybrid, PITA, and Miranda software (R site, P site, and M site as the predicted site), we performed existing plant miRNA pairing predictions on some reported lethal genes in the fall armyworm. We found that soybean gma-miR-4387c may bind to acetylcholinesterase (XM_035573837.1 and XM_035573808.1), which are target molecules of organophosphate insecticides. The prediction results are shown in Table 3.

[0077] Table 3. Predicted binding results of plant-derived miRNAs to the acetylcholinesterase gene of Fall Armyworm.

[0078] 3.2 Identification of the insect-resistant effect of soybean-derived GMA-miR-4387c To test the insecticidal effect of the selected gma-miR-4387c, the inventors first determined the dosage. The initially screened gma-miR-4387c was injected into third-instar fall armyworms, and the mortality rate was calculated after 48 hours. The results showed that the mortality rate of the pest was positively correlated with the dosage; the mortality rate of gma-miR-4387c exceeded 50% at injection doses of 10 μg and 15 μg per insect. Considering both efficacy and application cost, subsequent experiments used a dosage of 10 μg.

[0079] To further determine the experimental dosage for subsequent parasite injection experiments, the inventors conducted further measurements within the dosage range of 1-10 μg. The results showed that after 48 hours, the 1 μg dosage group had no lethal effect, and the parasite growth was similar to the control group; the 5 μg dosage group had a 20% mortality rate, and the surviving parasites exhibited diapause; the 10 μg dosage group had a 67% mortality rate, and the surviving parasites showed significant diapause. Figure 1 Therefore, the inventors determined that 10 μg was the dosage for injecting the insect body.

[0080] The inventors injected 10 μg of gma-miR-4387c into the first day of the third instar larvae, and then performed phenotypic analysis on the treated larvae. The results showed that, compared with the control group, the fall armyworms treated with gma-miR-4387c for 48 h were significantly smaller in size and shorter in length, and exhibited growth retardation; the control group had reached the late third instar, while the NC group (speechless small RNA) and gma-miR-4387c were still in the middle of the third instar (…). Figure 2 (A). Dissection of the worm revealed that the midgut of the experimental group contained virtually no culture medium. Figure 2 (Middle B) indicates that the insects died without feeding. After three replicates, the mortality rate of the 30-insect treatment group was 46.08±5.86% at 24 h and 64.92±4.77% at 48 h. Figure 2 (C). Because the mortality rate of NC at 48 h was 34.09±0.70% and showed growth retardation, NC was not used as a control group in subsequent treatments; instead, DEPC-H2O was used. The mortality rate of the insects remained at a balanced state from 48 to 168 h of treatment. Figure 2 (C) After 168 hours of treatment, the worms that did not die experienced delayed growth and were unable to undergo metamorphosis; some remained in a state of cessation of growth. Figure 3 In summary, injection of 10 μg of gma-miR-4387c into the third instar fall armyworm caused mass mortality within 48 hours and delayed growth in a small number of individuals.

[0081] 3.3 Stability analysis of gma-miR-4387c in fall armyworm To explain whether the injection effect of gma-miR-4387c is related to its in vivo stability, hemolymph from 6th instar fall armyworms was incubated (the activity of nucleic acid metabolic enzymes in 6th instar larvae is much stronger than that in 3rd instar larvae) to verify the stability of miRNA after injection. Hemolymph from 6th instar fall armyworms was diluted 10-fold with PBS solution, and approximately 1 μg (one-tenth of the in vivo injection dose) of miRNA mimic was used for incubation. To ensure accuracy, hemolymph from one worm was used for different treatments, and the same miRNA was also divided into two equal portions, one for treatment and one for control. Gel electrophoresis results showed that after 3 h of incubation at room temperature, compared with the control group PBS solution (… Figure 4 Compared to the upper lane of A, the incubation of miRNA with hemolymph ( Figure 4 After the lower lane of A, both NC and gma-miR-4387c were relatively stable in hemolymph. Figure 4 (A). However, after 24 h of incubation at room temperature, NC was degraded, while gma-miR-4387c remained stable and was not degraded by double-stranded RNA nucleases in hemolymph ( Figure 4 (B). The results showed that the stability of gma-miR-4387c is one of the reasons why it can exert its insecticidal effect.

[0082] 3.4 Target gene analysis of gma-miR-4387c in plants The above experimental results have confirmed the insect-resistant effect of gma-miR-4387c. In order to overexpress gma-miR-4387c in transgenic plants without affecting the normal growth and development of plants, we will further explore the role of gma-miR-4387c in plants.

[0083] First, regarding the conservation of soybean-derived gma-miR-4387c, the inventors performed BLAST operations in the miRNA database (miRbase, https: / / www.mirbase.org / ) and the plant non-coding RNA database (PNRD, http: / / structuralbiology.cau.edu.cn / PNRD / index.php). The results showed that gma-miR-4387c exists only in soybean. The sequence differences between gma-miR-4387a and gma-miR-4387b in the same family are about 7 bp. Although ghr-miR-4387 exists in cotton, its seed sequence is completely different. Figure 5 Furthermore, in plants, miRNAs require complete pairing to function, indicating that gma-miR-4387c has no homologous miRNAs present in other plants, and is only found in soybeans, suggesting a high degree of conservation.

[0084] To ensure the plant safety of overexpressing the fall armyworm on maize, its host plant, DPMIND only provides miRNA and plant prediction results. Therefore, the inventors used the psRNATarget website to predict the target genes of soybean-derived gma-miR-4387c and the exogenous species maize. Among the maize target gene predictions, targeting p-hydroxybenzoate-polyene transferase showed the highest reliability, but it still had 8 base pair mismatches. Figure 6 The above indicates that gma-miR-4387c does not have a completely or nearly completely paired target gene in soybean (its own source) and maize (an exogenous plant), and its function is unknown. However, the fact that it does not target important pathway genes also suggests that its function may not be important in plant growth and development.

[0085] 3.5 Transcriptome analysis of the insect resistance mechanism of gma-miR-4387c After demonstrating the insect-resistant effect of gma-miR-4387c, the possible reasons for this effect were analyzed through transcriptome analysis.

[0086] 3.5.1 Analysis of the number of differentially expressed genes in the transcriptome The above experiments showed that the lethality of third-instar fall armyworms injected with gma-miR-4387c was mainly concentrated at 24h and 48h, especially at 24h. Therefore, the inventors collected whole fall armyworms 24h and 48h after injection with DEPC water and gma-miR-4387c, respectively, and performed transcriptome sequencing. In the differentially expressed gene detection process, FoldChange ≥ 2 and FDR < 0.01 were used as the screening criteria to exclude new genes. The already annotated genes were classified. Among the differentially expressed genes between gma-miR-4387c and the control at 24h, 1979 were upregulated and 1873 were downregulated. Figure 7 (China A), while in the 48 hours, there were 1058 upward adjustments and 725 downward adjustments (China A), Figure 7 (B). The results showed that the number of differentially expressed genes was greater at 24 hours after gma-miR-4387c injection than at 48 hours, which may be one of the reasons for the increased mortality rate at 24 hours compared to 48 hours.

[0087] 3.5.2 KEGG enrichment analysis Subsequently, the inventors performed KEGG enrichment analysis on genes downregulated after gma-miR-4387c injection. The results showed that the enriched pathways at 24 hours were DNA replication, metabolic pathways, biosynthesis of secondary metabolites, and the ribosomal pathway. Figure 8 (A); at 48h, the metabolic pathways, amino sugar and nucleotide sugar metabolism pathways, peroxisomes, and steroid hormone biosynthesis are observed. Figure 8 (B). This indicates that the normal metabolic pathways for growth and development are indeed inhibited, consistent with the inhibition of feeding and delayed growth in the insect. Furthermore, the inventors also performed KEGG enrichment analysis on the upregulated genes. The results showed that the enriched pathways at 24h were the Toll and Imd signaling pathways, the autophagy pathway, and the AMPK signaling pathway (…). Figure 8 (C) At 48h, the pathways are ribosomal, drug metabolism, and glutathione metabolism. Figure 8 (D). The upregulation of these genes was not significantly related to pest mortality.

[0088] 3.5.3 Analysis of genes specifically downregulated by gma-miR-4387c at different time points after treatment By analyzing the transcriptomes of gma-miR-4387c-treated larvae at 24 and 48 hours, the inventors discovered that the downregulation of hormone pathway genes at 48 hours might be the reason why larvae could not molt and enter the next instar. However, what caused the large-scale mortality and growth delay of larvae 24 hours later? To address this, the inventors analyzed genes with specific expression changes at 24 and 48 hours after gma-miR-4387c treatment. The results showed that the enriched pathways at 24 hours were DNA replication, ribosomes, and metabolic pathways (…). Figure 9 (A), 48h is for glycosaminoglycan degradation, metabolism of amino sugars and nucleotide sugars, and metabolic pathways ( Figure 9 (B) The inventors detected genes involved in carbohydrate metabolism, protein metabolism, lipid metabolism, and energy metabolism during 24-hour metabolism, such as glucose-6-phosphate dehydrogenase, pyruvate kinase, aminoacylase, fatty acid synthase, ATP synthase subunit e, and NADH dehydrogenase. Quantitative PCR confirmed that glucose-6-phosphate dehydrogenase, pyruvate kinase, and ATP synthase subunit e were significantly downregulated in the 24-hour treatment group, while the others were not significantly downregulated. Figure 9 (C). This indicates that gma-miR-4387c induces pest death by affecting energy synthesis.

[0089] 3.5.4 Analysis of co-downregulated genes at different time points after gma-miR-4387c treatment The above analysis results indicate that gma-miR-4387c affects the growth and development of the fall armyworm at different developmental stages by regulating genes involved in important functions and regulatory pathways such as metabolism and hormones. To further clarify the gene regulation by which gma-miR-4387c plays a role throughout the entire growth cycle, the inventors intersected the downregulated genes in the 24h and 48h transcriptomes, obtaining 288 genes (…). Figure 10 According to KEGG analysis, these 288 genes are mainly distributed in metabolic, drug metabolism, and insect hormone synthesis pathways. Figure 10 (Middle B). Analysis of metabolic pathway genes in the largest group revealed that gma-miR-4387c primarily regulates phase II detoxification enzymes and oxidoreductases, indicating that gma-miR-4387c participates in regulating redox balance in the body by modulating these genes. In addition, ecdysone-induced proteins in the ecdysone pathway... E75 , E78c and possible nuclear hormone receptors HR3 The expression of ecdysone also changes during these two time periods. Ecdysone is a major regulator of insect tissue apoptosis and remodeling, molting, and other developmental physiological activities. Ecdysone exerts a cascade effect through a series of regulatory factors. Figure 11 (A). This was confirmed by quantitative PCR. E75 , E78c and HR3 Genes of the molting hormone pathway were downregulated in both the 24-hour and 48-hour treatment groups (samples were taken from surviving insects in poor growth condition). Figure 11 (Middle B). This indicates that gma-miR-4387c does indeed regulate the expression of these ecdysone pathway genes. Because... E75 , E78C and HR3 The ecdysone pathway, responding to the pulsatile effect of ecdysone, is upregulated only when ecdysone levels drop to baseline, thus exhibiting higher expression during the larval stage. The inventors analyzed data from third instar larvae on days 1, 2, and 3 (48 hours after gma-miR-4387c treatment) and day 1 of the fourth instar. E75 , E78C and HR3 The expression patterns demonstrated that the expression trend of these genes in the ecdysone pathway is upregulated before molting and downregulated after molting. Figure 12 When gma-miR-4387c is injected, the expression of these genes is downregulated, and the insect cannot molt to enter the next instar and dies.

[0090] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. The use of any one of the substances shown in (1)-(5) below in pest control and / or in the preparation of pest control products; (1) gma-miR-4387c; (2) The precursor of gma-miR-4387c; (3) gma-miR-4387c agomir; (4) A DNA molecule encoding the precursor of gma-miR-4387c described in (1) or gma-miR-4387c described in (2); (5) Expression cassettes, recombinant vectors or transgenic cells containing the DNA molecules described in (4).

2. The application according to claim 1, characterized in that, The nucleotide sequence of gma-miR-4387c is shown in SEQ ID NO:

22.

3. The application according to claim 1, characterized in that, The pests include lepidopteran insects; The preferred pest is the fall armyworm.

4. The application according to any one of claims 1-3, characterized in that, The substance achieves pest control by inhibiting pests from feeding, inhibiting their growth and development, and / or killing them.

5. The application according to claim 4, characterized in that, The pests mentioned are pests in their larval stage.

6. A product comprising any one of the substances shown in (1)-(5) below; (1) gma-miR-4387c; (2) The precursor of gma-miR-4387c; (3) gma-miR-4387 cagomir; (4) A DNA molecule encoding the precursor of gma-miR-4387c described in (1) or gma-miR-4387c described in (2); (5) Expression cassettes, recombinant vectors, or transgenic cells containing the DNA molecules described in (4); Preferably, the nucleotide sequence of gma-miR-4387c is shown in SEQ ID NO:

22.

7. The product according to claim 5, characterized in that, The product includes at least one of reagents, drugs, and pesticides.

8. A method for controlling pests, comprising applying the substance of claim 1 or the product of claim 6 or 7 to the pests.

9. The method according to claim 8, characterized in that, The method includes treating pests, their food, and their habitat with the substance or product.

10. The method according to claim 8 or 9, characterized in that, The pests include lepidopteran insects; Preferably, the pest is the fall armyworm.

Images