Lactococcus garviae strain zb15 and cell-free fermentation freeze-dried product with anti-inflammatory activity and method for preparing same

Abstract

The present application relates to the fermentation technical field, especially to a lactococcus garvieae ZB15 and cell-free fermentation freeze-dried material with anti-inflammatory activity and a preparation method thereof.The lactococcus garvieae ZB15 is preserved in Guangdong Microbial Culture Collection Center, the address is No. 59, Building 5, Institute of Microbiology, Guangdong Academy of Sciences, 100, Martyrs' Road, Guangzhou, the preservation date is February 27, 2025, and the preservation number is GDMCC No: 65947.The lactococcus garvieae ZB15 of the present application is prepared into cell-free fermentation freeze-dried material, the cell-free fermentation freeze-dried material can relieve and improve enteritis, improve the immune capacity of the body by changing the intestinal microbial community structure, and provide a basis for the preparation of enteritis drugs.

Description

Technical Field

[0001] This invention relates to the field of fermentation technology, and in particular to a strain of Lactococcus gasseri ZB15 and a cell-free, freeze-dried fermentation product with anti-inflammatory activity, as well as a method for its preparation. Background Technology

[0002] Ulcerative colitis (UC) is a relapsing inflammatory bowel disease. As one of the major types of inflammatory bowel disease, UC is characterized by weight loss, abdominal pain, diarrhea, and rectal bleeding. Although UC is more prevalent in Western countries, its incidence has increased dramatically in developing countries in recent years, making it one of the global health problems of the 21st century. The occurrence of UC is closely related to multiple factors, including genetic factors, environmental factors, immune regulation, gut microbiota, and lifestyle. Its exact pathogenesis remains unclear, and there is currently no effective cure. Conventional UC interventions include corticosteroids, 5-aminosalicylic acid, immunosuppressants, and antibiotics, but their effectiveness is limited and they are accompanied by a range of side effects. The toxicity from long-term use also limits their efficacy. Therefore, exploring safe and effective ways to prevent or improve UC is crucial.

[0003] Studies have shown that the ingestion of probiotics by the human body has a certain inhibitory effect on colitis. Lactobacillus and Bifidobacterium, as important members of the probiotic family, are widely present in the human body. They are not only physiological bacteria that maintain the health of the host's gut, but also inhibit the occurrence of cancer to a certain extent. The anti-tumor function of Bifidobacterium infantis (B. infantis) in mice was first reported in 1978. Since then, numerous in vivo experiments have confirmed that fermented foods rich in lactic acid bacteria are beneficial to the human body and can inhibit the occurrence of tumors. For example, long-term consumption of yogurt or fermented dairy products can reduce the incidence of colitis or other cancers, while ingestion of Bulgarian yogurt can inhibit the growth of colon tumors.

[0004] Studies by Rafter and Commane suggest that lactic acid bacteria may inhibit colon cancer through the following pathways: altering the quantity or types of the host's gut microbiota; binding to or degrading potential carcinogens; producing anti-tumor or anti-mutagenic substances; inhibiting tumor growth; increasing the host's immune stress; and affecting the host's physiological metabolism.

[0005] The immune system plays a crucial regulatory role in the occurrence and development of tumors. Studies have shown that the anti-colorectal cancer function of lactic acid bacteria is closely related to its immune regulation. Research indicates that lactic acid bacteria can increase macrophage activity, activate NK cells in mice, promote the release of tumor necrosis factor-α, interleukin IL-10, and IL-12 from human peripheral blood mononuclear cells, and stimulate dendritic cells to release IL-12 and regulate IL-10 release. This demonstrates that lactic acid bacteria can achieve anti-tumor function by enhancing the body's immunity. Studies by Wang Shumei et al. have shown that live bacteria, cell walls, and bacterial DNA of *Lactobacillus paracasei* subsp. *paracasei* (L. paracasei subsp. *paracasei*) M5, *L. coryniformis* subsp. *torquens* T3, and *Lactobacillus rhamnosus* (L. rhamnosus) SB5, SB31, J5, and INI can promote the proliferation of blood monocytes (PBMCs) and the release of IL-12, IFN-γ, and TNF-α in vitro, thereby achieving their immune-boosting function. These findings all indicate that lactic acid bacteria have certain probiotic effects on the body, especially in enhancing immunity.

[0006] Currently, the pathogenesis of colitis remains unclear, and the toxic side effects of drug treatment cannot be ignored. Lactic acid bacteria, as recognized probiotics, have had their antibacterial and anti-inflammatory effects confirmed by numerous studies, and some researchers have used lactic acid bacteria to intervene and treat colitis. However, the potential of lactic acid bacteria in treating colitis has not been fully realized, and there are many significant limitations. For example, differences in patients' gut microbiota composition, immune status, and genetic background can lead to varying efficacy of lactic acid bacteria treatments, and the patient's pre-existing gut microbiota may inhibit the colonization or function of exogenous lactic acid bacteria. Some studies have found that lactic acid bacteria may exacerbate inflammation by activating the TLR signaling pathway; the bidirectional nature of this mechanism needs further verification. Gastric acid and bile salts may disrupt lactic acid bacteria activity, resulting in an inconsistent number of live bacteria reaching the intestines. Long-term use of live bacteria may disrupt the gut microbiota balance and induce drug resistance gene transfer (such as plasmid-mediated antibiotic resistance).

[0007] To address the aforementioned shortcomings in the treatment of colitis with lactic acid bacteria, existing technologies require a formulation that maximizes the preservation of the therapeutic effects of lactic acid bacteria fermentation products while minimizing the negative impacts of live bacteria. Summary of the Invention

[0008] The purpose of this invention is to provide a strain of Lactococcus gasseri ZB15, a cell-free fermented freeze-dried product with anti-inflammatory activity, and a method for preparing the same.

[0009] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0010] This invention provides a strain of Lactococcus garvieae ZB15, deposited at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, with a deposit date of February 27, 2025 and accession number GDMCC No:65947.

[0011] The present invention also provides the use of the aforementioned Lactococcus garvieae ZB15 in the preparation of products with anti-inflammatory activity.

[0012] The present invention also provides the use of the aforementioned Lactococcus garvieae ZB15 in the preparation of products for treating colitis.

[0013] The present invention also provides a cell-free fermented freeze-dried product with anti-inflammatory activity, wherein the cell-free fermented freeze-dried product is obtained by fermentation and freeze-drying of the aforementioned Lactococcus garvieae ZB15.

[0014] This invention also provides a method for preparing a cell-free fermented freeze-dried product with anti-inflammatory activity, comprising the following steps:

[0015] (1) The Lactococcus garvieae ZB15 was inoculated into MRS solid medium and cultured at 36-38℃ for 20-28h to obtain single colonies;

[0016] (2) Inoculate the single colony described in step (1) into MRS liquid culture medium and culture at 36-38℃ for 20-28h to obtain seed culture; inoculate the seed culture into MRS liquid culture medium and culture at 36-38℃ for 20-28h to obtain working culture.

[0017] (3) The working bacterial solution was inoculated into MRS broth medium and cultured at 36-38℃ for 20-28h to obtain fermentation broth; the fermentation broth was centrifuged, the supernatant was collected, filtered, and the filtrate was taken to obtain cell-free fermentation supernatant;

[0018] (4) Freeze-dry the cell-free fermentation supernatant to obtain cell-free fermentation freeze-dried product;

[0019] The freeze-drying step (4) includes pre-cooling and vacuum freezing steps;

[0020] The precooling temperature is -75 to -85°C, and the precooling time is 18 to 22 hours;

[0021] The vacuum freezing temperature is -45 to -55°C, the vacuum degree is 20 to 40 Pa, and the vacuum freezing time is 22 to 26 hours.

[0022] Preferably, the inoculation amount of the working bacterial solution in step (3) is 0.5 to 1.5% of the volume of MRS broth culture medium.

[0023] Preferably, the centrifugation speed in step (3) is 3500-4500 rpm and the centrifugation time is 15-25 min.

[0024] Preferably, the filtration in step (3) is membrane filtration, and the pore size of the membrane is ≤0.22μm.

[0025] The present invention also provides the application of the cell-free fermented freeze-dried product or the cell-free fermented freeze-dried product prepared by the above preparation method in the preparation of products for treating colitis.

[0026] The present invention also provides the application of the cell-free fermented freeze-dried product or the cell-free fermented freeze-dried product prepared by the above preparation method in the preparation of products having any one or more of the following effects;

[0027] (i) Reduce serum anti-inflammatory factors;

[0028] (ii) Increase the number of anti-inflammatory gut bacteria and suppress the number of harmful bacteria;

[0029] (iii) Increase the level of metabolites that have anti-inflammatory and antibacterial effects in the gut;

[0030] (iv) Activate pathways in KEGG that have anti-inflammatory and antioxidant effects;

[0031] The anti-inflammatory factors in the serum include one or more of interleukin-6, interleukin-1β, tumor necrosis factor-α, and interleukin-10.

[0032] The intestinal anti-inflammatory bacteria include, at the phylum level, Firmicutes and / or Bacteroidetes; and at the genus level, one or more of Bacteroides, Faecalibaculum and Lactobacillus.

[0033] The harmful bacteria include Campylobacter and / or Escherichia-Shigella.

[0034] The metabolites include one or more of the following: flavin, red lilacin, 7-dehydrocholesterol, 27-hydroxycholesterol, 6-hydroxydihydroquercetin, benzocaine, N-acetylmuramate, ganoderic acid A, alismosiderin A, and tea saponin E.

[0035] The pathways with anti-inflammatory and antioxidant effects include one or more of the following: insulin resistance, tryptophan metabolism, serum neuron, HIF-1 signaling pathway, fat digestion and absorption, cancer-centric carbon metabolism, insulin secretion, phospholipase D signaling pathway, cancer choline metabolism, purine metabolism, parathyroid hormone synthesis and secretion, cancer pathway, steroid biosynthesis, ascorbic acid and aldehyde metabolism, FCR-mediated phagocytosis, GmRH signaling pathway, pyrimidine metabolism, bile acid biosynthesis, and nucleotide metabolism.

[0036] This invention provides a strain of *Lactococcus garvieae* ZB15, a cell-free fermented freeze-dried product with anti-inflammatory activity, and a method for preparing the same. The *Lactococcus garvieae* ZB15 strain of this invention is deposited at the Guangdong Provincial Microbial Culture Collection Center, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, Institute of Microbiology, with a deposit date of February 27, 2025, and accession number GDMCC No: 65947. The strain of this invention is a homofermentative strain and no virulence genes were detected; it is a safe food-grade lactic acid bacterium.

[0037] The *Lactococcus gasseri* ZB15 of this invention was fermented and cultured, and the fermentation broth was obtained by centrifugation. The bacterial cells and other impurities were then filtered through a membrane filter. Finally, the cell-free fermentation supernatant was freeze-dried to obtain a cell-free freeze-dried product. This cell-free freeze-dried product was prepared into a solution with a defined concentration for the treatment of colitis. This approach avoids direct ingestion of live bacteria and allows for precise determination of the amount of cell-free freeze-dried product ingested by the patient, maximizing the therapeutic effect of the lactic acid bacteria fermentation product while minimizing the potential negative effects of live bacteria.

[0038] This invention utilizes cell-free fermentation supernatant obtained from Lactococcus gasseri ZB15 fermentation as an anti-inflammatory active ingredient. This active ingredient is not a chemical preparation and has no negative effects from antibiotics or other drugs. It is a green and natural anti-inflammatory material. Adding cell-free fermented freeze-dried material to the diet of mice can effectively improve the symptoms of colitis in mice.

[0039] When this invention is mass-produced industrially, the raw materials are easy to obtain, and the amount of antibiotics ingested by patients with enteritis can be reduced while ensuring the microbial safety of the product.

[0040] The cell-free fermented freeze-dried product prepared by this invention can not only alleviate and improve colitis, but also enhance the body's immunity by altering the structure of the intestinal microbial community. Attached Figure Description

[0041] Figure 1 Microscopic observation of Lactococcus gasseri ZB15;

[0042] Figure 2 Grouping and feeding methods for mice;

[0043] Figure 3 Colon length in mice from different groups;

[0044] Figure 4 A graph showing the changes in body weight of mice in different groups;

[0045] Figure 5 DAI score graphs for mice in different groups;

[0046] Figure 6 The table shows the levels of inflammatory factors in the serum of mice from different groups (top left: IL-6 cytokine level, top right: TNF-α level, bottom left: IL-1β cytokine level, bottom right: IL-10 cytokine level).

[0047] Figure 7 Image of mouse colon tissue stained with hematoxylin and eosin (HE);

[0048] Figure 8 Bar graphs of bacterial colonies in the colon contents of mice in each group;

[0049] Figure 9 To compare and analyze the phylum levels of colonic flora in the colonic contents of mice in each group;

[0050] Figure 10 To compare and analyze the colony genus levels in the colon contents of mice in each group;

[0051] Figure 11 Volcano plots showing the differences in metabolites among mouse intestinal groups (Figure A represents the difference between the DSS group and the blank control group, Figure B represents the difference between the CFS group and the blank control group, and Figure C represents the difference between the CFS group and the DSS group);

[0052] Figure 12 Bubble diagram for KEGG pathway enrichment.

[0053] Preservation Instructions

[0054] Lactococcus garvieae ZB15 is deposited at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, on February 27, 2025, with accession number GDMCC No:65947. Detailed Implementation

[0055] The following detailed description of the solutions provided by the present invention, in conjunction with the embodiments, should not be construed as limiting the scope of protection of the present invention.

[0056] The MRS solid culture medium described in this embodiment of the invention uses water as a solvent and comprises 66.2 g / L MRS agar medium and 2 wt% calcium carbonate. The MRS agar medium was purchased from Qingdao Haibo Biotechnology Co., Ltd., Qingdao High-Tech Industrial Park. The MRS liquid culture medium uses water as a solvent and further comprises 52.44 g / L MRS broth medium and 10 g / L glucose. The MRS broth medium was purchased from Qingdao Haibo Biotechnology Co., Ltd., Qingdao High-Tech Industrial Park.

[0057] Example 1

[0058] Take a sample of Zhenba cured pork during the curing period, weigh 5g of the sample, cut it into 1cm pieces, add 10mL of sterile physiological saline, vortex for 5min to fully suspend it, repeat twice, collect the supernatant, centrifuge at 6000rpm for 10min, discard the supernatant, and collect the bacterial cells.

[0059] Resuspend the bacterial cells in 5 mL of physiological saline to obtain a bacterial suspension. Observe the microorganisms under a microscope to preliminarily estimate the microbial concentration, and select an appropriate dilution factor based on the initial concentration. Serially dilute the bacterial suspension to 10⁻⁶ with physiological saline. -1 10 -2 100 μL of bacterial suspensions at different dilutions were spread onto MRS solid medium containing calcium carbonate (CaCO3) and incubated statically at 37°C for 24 h. Colonies with obvious calcium dissolution zones were selected and inoculated into fresh MRS solid medium containing CaCO3 using sterilized bamboo sticks, and incubated at 37°C for 48 h. The diameter of the calcium dissolution zone and colony characteristics were observed and recorded. The isolated lactic acid bacteria were stored in glycerol at -80°C for later use.

[0060] Observe the color, transparency, and edge morphology of individual colonies on the culture plates. Select single colonies that meet the basic characteristics of lactic acid bacteria for Gram staining, observe the staining results, and record the microscope images, such as... Figure 1 As shown.

[0061] The preserved lactic acid bacteria strains were streaked onto MRS solid medium containing CaCO3 for activation. After incubation at 37°C for 24 h, single colonies were picked and inoculated into 1 ml MRS liquid medium, and incubated statically at 37°C for 24 h. Genomic DNA was extracted from the strains using a genomic DNA extraction kit. 16S rDNA was amplified using universal primers 27F (SEQ ID NO. 1) and 1429R (SEQ ID NO. 2) (Table 1). The PCR program was as follows: 95°C pre-denaturation for 5 min; 34 cycles (95°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 1 min); 72°C final extension for 10 min. The amplified products were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing (SEQ ID NO. 3).

[0062] Table 1 Primers

[0063] Primers Sequence (5'→3') Serial Number 27F AGAGTTTGATCCTGGCTCAG SEQ ID NO.1 1429R GGTTACCTTGTTACGACTT SEQ ID NO.2

[0064] SEQ ID NO.3:

[0065]

[0066] Sequencing data analysis and alignment were performed using CloneManager software and BLAST (Basic Local Alienation Search Tool) to determine its species by comparing it with known sequences in NCBI (National Center for Biotechnology Information). 16S rDNA sequencing, NCBI homology sequence alignment analysis, and Mega5 software plotting identified it as *Lactococcus garvieae*, a homofermentative strain, with no detected virulence genes, indicating it is a safe, food-grade lactic acid bacterium.

[0067] The strain was ultimately identified as *Lactococcus garvieae*, named ZB15. This *Lactococcus garvieae* ZB15 was deposited at the Guangdong Provincial Microbial Culture Collection Center, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, on February 27, 2025, with accession number GDMCC No:65947.

[0068] Example 2

[0069] Lactococcus gasseri ZB15 was taken, and a small amount of bacterial culture was streaked onto MRS solid medium in a zigzag pattern using an inoculation loop. The culture was incubated at 37°C for 24 hours. After streaking, 1.2 mL of MRS liquid medium was added to a 1.5 mL centrifuge tube. A single colony was picked up using an inoculation loop and transferred to the 1.5 mL centrifuge tube. The tube was then incubated at 37°C for 24 hours to obtain the seed culture. The seed culture was inoculated into MRS liquid medium and incubated at 37°C for 24 hours to obtain the working culture. The working culture was inoculated into MRS broth at a 1 vt% inoculation rate and incubated at 37°C for 24 hours to obtain the fermentation broth. The broth was centrifuged at 4000 rpm for 20 minutes at 4°C using a high-speed, low-temperature refrigerated centrifuge. The supernatant was collected and filtered through a 0.22 μm aqueous filter to remove impurities, yielding a cell-free supernatant of Lactococcus gasseri, which was collected in a 50 mL centrifuge tube. The cell-free supernatant was poured into glass petri dishes, sealed with sterile plastic wrap, and pre-frozen at -80°C for 20 hours. After pre-freezing, the petri dishes were placed in a vacuum freeze dryer, the temperature was set to -50°C, and a vacuum pressure of 30 Pa was applied for 24 hours of freeze-drying. After freeze-drying, the freeze-dried product was collected in 10 mL sterile centrifuge tubes and stored at -80°C to obtain cell-free fermentation freeze-dried product (CFS).

[0070] Example 3

[0071] (1) Mouse grouping and establishment of enteritis model

[0072] Thirty male C57 mice aged 6–8 weeks were randomly divided into three groups (n=10 per group) after a one-week acclimatization period: a blank control group, a sodium dextran sulfate (DSS) model group, and a 100 mg / mL CFS group (DSS+CFS group). The ambient temperature was 23±1℃, and the humidity was 50%–60%. Transparent plastic cages were used, and the daily light and dark periods were equal (08:00–20:00). Mice had free access to water and a basal diet during the rearing period. Before modeling, the CFS group mice were administered CFS via gavage at 100 μL daily for 7 days (pre-protection period). After modeling began, except for the blank control group, all other groups received 4% DSS aqueous solution instead of normal drinking water. The CFS group received 100 μL of CFS via gavage daily for 7 days (during the pre-protection and modeling periods, mice in the blank control group and DSS model group received corresponding gavage stimulation and 100 μL of drinking water daily). Clinical symptoms of colon inflammation in mice were monitored daily, including daily activity, bloody stools, and diarrhea. After 7 days of continuous administration, the mice were sacrificed by cervical dislocation.

[0073] Mouse grouping and feeding methods as follows Figure 2 As shown.

[0074] The preparation method for 100 mg / mL CFS is as follows: Dissolve 100 mg of cell-free fermented freeze-dried product in 1 mL of water.

[0075] (2) Mouse sample collection and processing

[0076] Blood was collected from mouse eyeballs and placed in anticoagulant tubes containing sodium heparin. After standing for 2 hours, the blood was centrifuged (4℃, 3000 rpm, 15 min), and the supernatant serum was collected and stored at -80℃ for later use. Under aseptic conditions, mice were euthanized by cervical dislocation and dissected. The colon, cecum, etc. were removed, processed accordingly, and then quickly placed in liquid nitrogen and transferred to -80℃ for later use.

[0077] (3) Measurement of physiological indicators in mice

[0078] (3.1) Mouse colon length

[0079] Mice were euthanized by cervical dislocation, and colonic tissues from different groups of mice were collected, photographed, measured, and recorded. Results are as follows: Figure 3 As shown in Table 2.

[0080] Table 2. Statistics on colon length of mice in each group

[0081]

[0082]

[0083] Table 2 and Figure 3 It was found that the colon length of mice in the blank control group was significantly longer than that in the DSS model group and the DSS+CFS group, while the colon length in the DSS model group was the shortest. Table 2 shows that the average colon length of mice in the blank control group was 8.21 cm, the average colon length of mice in the DSS group was 5.85 cm, and the average colon length of mice in the DSS+CFS group was 6.83 cm. This indicates that the colon length of mice with enteritis after CFS gavage was significantly longer than that in the DSS model group, and that the cell-free fermented freeze-dried product of Lactococcus gasseri ZB15 can improve DSS-induced colitis in mice.

[0084] (3.2) Disease activity index (DAI) score in mice

[0085] From the start of modeling, the mice's diet, water intake, feces, and weight were recorded daily. After modeling was completed, the above four indicators were summarized and analyzed, and the disease activity index of the mice was scored according to the DAI scoring standard (the scoring standard is based on the literature Cooper, HS, et al. (1993). Gastroenterology 105(3):798-805). The results are as follows. Figures 4-5 As shown.

[0086] Figure 4 It can be seen that the body weight of mice in the DSS model group decreased with the extension of DSS feeding time, and the decrease was the largest; while the body weight loss of mice in the DSS+CFS group was significantly improved under the action of cell-free fermentation freeze-dried Lactococcus gasseri ZB15.

[0087] The Disease Activity Index (DAI) score for colitis in mice is a commonly used method for assessing the severity of colitis in mice. This scoring system typically assesses multiple indicators based on changes in body weight, stool morphology, and the presence of mucus and blood. By comparing DAI scores before and after treatment, changes in the severity of colitis in mice can be clearly observed. Figure 5 It can be seen that the DAI score of mice in the DSS model group was the highest, exceeding 3.0 on day 7, while the DAI score of mice in the DSS+CFS group was lower than 3.0, and the decrease was significant.

[0088] (3.3) Mouse serum cytokine assay

[0089] The serum collected in (2) was taken out of the -80℃ freezer, and the levels of the above four cytokines in the serum of the three groups of mice were detected according to the instructions of the ELISA kits for interleukin-6 (IL-6), interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), and interleukin-10 (IL-10). The results are as follows. Figure 6As shown.

[0090] IL-6 is an inflammatory marker reflecting the degree of inflammation and is an important molecular indicator for evaluating the severity of ulcerative colitis (UC). IL-6 is also associated with the assessment of colon cancer potential. IL-1β is a potent cytokine with broad biological effects, participating in local and systemic responses to injury, infection, and inflammation, and can exacerbate ulcerative colitis. Tumor necrosis factor-α (TNF-α) is a pro-inflammatory cytokine mainly produced by macrophages and monocytes, which can aggravate the degree of inflammatory response and damage to digestive tract tissues and mucosa. Studies have shown that persistently high levels of TNF-α can cause acute colitis and lead to intestinal barrier dysfunction. IL-10 is a cytokine involved in inflammation and immunosuppression. As an anti-inflammatory factor, it can inhibit the specific immune function of macrophages and enhance immune induction.

[0091] Depend on Figure 6 The results showed that the DSS model mice had the highest levels of IL-6, IL-1β, and TNF-α in their serum. Administration of *Lactococcus gasseri* ZB15 cell-free fermented freeze-dried product significantly reduced these levels. IL-10 was the highest level in the serum of the DSS model mice, indicating more severe inflammation. Administration of *Lactococcus gasseri* ZB15 cell-free fermented freeze-dried product significantly reduced IL-10 levels in the mouse serum, suggesting that the product improved the inflammatory condition in the mice.

[0092] (3.4) Colon HE staining

[0093] Colons of mice from each group were stained with hematoxylin and eosin (HE), and the results are as follows: Figure 7 As shown.

[0094] Figure 7 It was found that the colonic tissue of mice in the blank control group contained a large number of goblet cells, which formed well-defined crypt structures with intact tissue morphology and minimal invasion of inflammatory factors. In the DSS model group, the colonic tissue morphology of mice was disrupted, with a large loss of goblet cells, no intact crypt structures, and extensive invasion of inflammatory factors. The DSS+CFS group significantly improved DSS-induced colitis, with a significant increase in the number of goblet cells, obvious crypt structures, more intact intestinal tissue morphology, and a significant decrease in the number of inflammatory factors.

[0095] (4) Effects of fermentation products of Lactobacillus gasseri ZB15 on intestinal flora in mice

[0096] Colonic contents of euthanized mice were collected using sterile centrifuge tubes, rapidly transferred to liquid nitrogen for flash freezing, and then stored at -80°C for later analysis. A blank control group, a DSS model group, and a DSS+CFS group were selected for assay. The results are shown in the following genus-level colony Bar diagram. Figure 8 As shown; the differences in phylum-level bacterial colonies in the colonic contents of mice in each group were compared using LEfSe analysis (Linear discriminant analysis Effect Size (LDA>2, P<0.05)). The results are as follows. Figure 9 As shown; the differences in genus-level bacterial colonies in the colonic contents of mice in each group were compared, and the results are as follows. Figure 10 As shown.

[0097] Figure 8 It was found that in the colon contents of mice in the blank control group, *Muribaculaceae* bacteria were the most abundant, followed by *Lactobacillus*, with *norank-o-Clostridia_UCG-014* and *Dubosiella* being less common. Harmful bacteria were scarce in the blank control group. In the DSS group, *Muribaculaceae* bacteria significantly decreased, while *Femtobacter*, *Campylobacter*, and *Escherichia coli* significantly increased. The number of *Lachnospira*, which has anti-inflammatory effects, was also higher than in the blank control group. In the DSS+CFS group, the number of *Muribaculaceae* bacteria was higher than in the DSS group, and *Femtobacter* bacteria were significantly higher. Harmful *Campylobacter* bacteria significantly decreased, while *norank-o-Clostridia_UCG-014* bacteria significantly increased. The number of *Dubosiella* bacteria was also higher than in the DSS group, and the number of *Turicibacter* bacteria increased significantly.

[0098] Figure 9It was found that the abundance of Firmicutes in the CFS group was significantly higher than that in the DSS group (p<0.01). Firmicutes, as an important component of the gut microbiota, participate in the digestion and absorption of food, exerting a profound impact on host health. Some Firmicutes strains are used as probiotics to improve host health by regulating the balance of the gut microbiota. For example, certain Lactobacillus and Bifidobacterium belong to Firmicutes and are widely used in food additives and health products to promote gut health. Other Firmicutes, such as Lactobacillus, Faecalibacterium, Eubacterium, and Rochetomyces, produce acetic acid, lactic acid, butyric acid, and antibiotics, which can combat pathogens and are beneficial to human health. Among them, Lactobacillus is one of the few facultative anaerobic bacteria in Firmicutes and is relatively common in the small intestinal flora. Butyric acid is a major energy source for intestinal cells and plays a positive role in inhibiting inflammation and fighting tumors. The abundance of Bacteroidetes in the blank control group was significantly higher than that in the DSS and CFS groups (p<0.01). Bacteroidetes is an important component of the gut microbiota and plays a key role in fecal microbiota transplantation (FMT). By transplanting feces from healthy donors containing Bacteroidetes, the balance of the patient's gut microbiota can be restored, treating gut microbiota-related diseases such as ulcerative colitis. The abundance of Campylobacteria and Proteobacteria in the DSS group was significantly higher than that in the blank control group and the CFS group (p<0.01). Bacteroides such as Escherichia coli, Salmonella, Vibrio cholerae, and Helicobacter pylori can cause intestinal infections, gastritis, gastric ulcers, and other diseases. The phylum levels are as follows: Figure 9 As shown.

[0099] Figure 10 It was found that the abundance of *Muribaculaceae*, *Lactobacillus*, and *Bacillus* in the blank control group was significantly higher than that in the DSS and CFS groups (p<0.01). The abundance of *Femobacterium* in the CFS group was significantly higher than that in the DSS and CFS groups (p<0.001). In addition, the abundance of *Clostridium* in the CFS group was significantly higher than that in the blank control group and the DSS group (p<0.01). The abundance of *Campylobacter* and *Escherichia coli* in the DSS group was significantly higher than that in the blank control group and the CFS group (p<0.01).

[0100] In summary, gavage administration of cell-free fermented freeze-dried Lactococcus gasseri ZB15 to DSS mice significantly increased the number of beneficial bacteria in the mouse gut, such as Lactobacillus, Faecalibacterium, Eubacterium, and Rochebocyste from Firmicutes and Bacteroidetes, as well as Faecalibacterium and Clostridium species. The metabolites of these bacteria, such as lactic acid, acetic acid, butyric acid, and antimicrobial peptides, can effectively inhibit the growth of harmful bacteria, thus improving enteritis at the gut microbiota level.

[0101] (5) Effects on mouse intestinal metabolites

[0102] The expression levels of differentially expressed metabolites in the intestines of mice from different groups were detected and represented using a volcano plot. Results are as follows: Figure 11 As shown in Table 3, the metabolites that differ between the CFS group and the blank control group are different.

[0103] Figure 11 It was found that, compared with the blank control group, 75 intestinal metabolites were upregulated and 314 were downregulated in the DSS group; 75 intestinal metabolites were upregulated and 175 were downregulated in the CFS group; and compared with the DSS group, 219 intestinal metabolites were upregulated and 26 were downregulated in the CFS group.

[0104] Table 3. Differential metabolites between the CFS group and the blank control group.

[0105]

[0106] Table 3 shows that the metabolites upregulated in the intestines of DSS mice after gavage administration of cell-free fermented freeze-dried Lactococcus gasseri ZB15 were mainly substances with anti-inflammatory and antibacterial effects. Among them, flavonoids, rubigin lactone, 7-dehydrocholesterol, 27-hydroxycholesterol, 6-hydroxydihydroquercetin, and benzocaine had strong antibacterial inhibitory effects, while N-acetylmuramic acid ester, ganoderic acid A, alismaol A, and tea saponin E had good anti-inflammatory and antioxidant effects.

[0107] Metabolites in the selected metabolic set were compared and analyzed using the Kyoto Encyclopedia of Genes and Genomes database. The hypergeometric distribution algorithm was used to identify pathways with significant enrichment of metabolites in the set, with significant enrichment defined as P < 0.05. The KEGG pathway set bubble chart is shown below. Figure 12 As shown.

[0108] Figure 12 It was found that, compared to the DSS group, the KEGG pathways in the CFS group were mainly enriched in insulin resistance, tryptophan metabolism, serum neuron, HIF-1 signaling pathway, fat digestion and absorption, cancer-centric carbon metabolism, insulin secretion, phospholipase D signaling pathway, cancer choline metabolism, purine metabolism, parathyroid hormone synthesis and secretion, cancer pathways, steroid biosynthesis, ascorbic acid and aldehyde metabolism, FCR-mediated phagocytosis, GmRH signaling pathway, pyrimidine metabolism, bile acid biosynthesis, and nucleotide metabolism. Most of these pathways are related to cancer, followed by pathways involving steroids, ascorbic acid, and other substances with anti-inflammatory and antioxidant effects. This indicates that CFS can produce corresponding substances to improve colitis through these metabolic pathways.

[0109] As can be seen from the above embodiments, the present invention provides a strain of *Lactococcus garvieae* ZB15, a cell-free fermented freeze-dried product with anti-inflammatory activity, and a method for preparing the same. The *Lactococcus garvieae* ZB15 of the present invention is deposited at the Guangdong Provincial Microbial Culture Collection Center, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, with a deposit date of February 27, 2025, and accession number GDMCC No: 65947. The strain of the present invention is a homofermentative strain and no virulence genes were detected, making it a safe food-grade lactic acid bacterium. The *Lactococcus garvieae* ZB15 of the present invention is fermented, centrifuged to obtain the fermentation broth, then filtered through a membrane to remove bacterial cells and other impurities. Finally, the cell-free fermentation supernatant is freeze-dried to obtain the cell-free fermented freeze-dried product. Cell-free fermented freeze-dried products are formulated into solutions of predetermined concentrations for the treatment of colitis. This approach avoids direct ingestion of live bacteria and allows for precise control of the amount of cell-free fermented freeze-dried products ingested by the patient, maximizing the therapeutic efficacy of the lactic acid bacteria fermentation products while minimizing potential negative effects from live bacteria. This invention utilizes the cell-free fermentation supernatant obtained from the fermentation of *Lactococcus gasseri* ZB15 as an anti-inflammatory active ingredient. This active ingredient is not a chemical preparation and does not have the negative effects of antibiotics or other drugs; it is a green and natural anti-inflammatory material. Adding cell-free fermented freeze-dried products to the diet of mice effectively improves colitis symptoms.

[0110] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A strain of Lactococcus gasseri ( Lactococcus garvieae ZB15, characterized in that, It is deposited at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, Guangdong Academy of Sciences, on February 27, 2025, with accession number GDMCC No: 65947.

2. The Lactococcus gasseri as described in claim 1 ( Lactococcus garvieae Application of ZB15 in the preparation of drugs for treating colitis.

3. A cell-free fermented freeze-dried product with anti-inflammatory activity, characterized in that, The cell-free fermented freeze-dried product is derived from Lactococcus gasseri as described in claim 1. Lactococcus garvieae ZB15 is obtained through fermentation and freeze-drying.

4. A method for preparing a cell-free fermented freeze-dried product with anti-inflammatory activity, characterized in that, Includes the following steps: (1) The Lactococcus gasseri as described in claim 1 ( Lactococcus garvieae ZB15 was inoculated into MRS solid medium and cultured at 36-38℃ for 20-28 hours to obtain single colonies; (2) Inoculate the single colony described in step (1) into MRS liquid culture medium and incubate at 36~38℃ for 20~28h to obtain seed culture; The seed culture was inoculated into MRS liquid medium and cultured at 36-38℃ for 20-28 hours to obtain the working culture. (3) The working bacterial solution was inoculated into MRS broth medium and cultured at 36-38℃ for 20-28h to obtain fermentation broth; the fermentation broth was centrifuged, the supernatant was collected, filtered, and the filtrate was taken to obtain cell-free fermentation supernatant; (4) Freeze-dry the cell-free fermentation supernatant to obtain the cell-free fermentation freeze-dried product; The freeze-drying step (4) includes pre-cooling and vacuum freezing steps; The precooling temperature is -75~-85℃, and the precooling time is 18~22h; The vacuum freezing temperature is -45~-55℃, the vacuum degree is 20~40Pa, and the vacuum freezing time is 22~26h.

5. The preparation method according to claim 4, characterized in that, The inoculation amount of the working bacterial solution in step (3) is 0.5 to 1.5% of the volume of MRS broth culture medium.

6. The preparation method according to claim 4, characterized in that, In step (3), the centrifugation speed is 3500~4500 rpm and the centrifugation time is 15~25 min.

7. The preparation method according to claim 4, characterized in that, The filtration in step (3) is membrane filtration, and the pore size of the membrane is ≤0.22μm.

8. The use of the cell-free fermented freeze-dried product according to claim 3 or the cell-free fermented freeze-dried product prepared by any one of claims 4 to 7 in the preparation of a medicament for treating colitis.

Images